Sequence versus miRNA target sites
1

sequence_1">1ctggaagggataatttactcccaaagaagacaggatatccttgatctgtggatctaccacacacaag

81

gctacttccctgattggcagaactacacaccagggccagggatcagatatccactgacatttggatggtgcttcaagcta

161

gtaccagttgagccagagcaggtagaagaggccaataaaagagagaacgccagcttgttacaccctatgagccagcatgg

241

gatggatgacccagagaaagaagtactaatgtggaagtttgacagccgcctagcatttcatcacatggcccgagagaagc

321

atccggagttctacaaagactgctgacatcgagctttctacaagggactttccgctggggactttccaggggaggtgtgg

401

cctgggcgggactggggagtggcgagccctcagatgctgcatataagcagctgctttttgcctgtactgggtctctctgg

481

ttagaccagatctgagcctgggagctctctggctgactagggaacccactgcttaagcctcaataaagcttgccttgagt

561

gcttcaagtagtgtgtgcccatctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaa

641

tctctagcagtggcgcccgaacagggacttgaaaacgaaagtagaaccggaggagctctctcgacgcaggactcggcttg

721

ctgaagcgcgcacagcaagaggcgaggggcggcgactggtgagtacgccatttattttgactagcggaggctagaaggag

801

agagatgggtgcgagagcgtcagtattaagcgggggagaattagataaatgggaaaaaattcggttaaggccagggggaa

881

agaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggccttttagag

961

acatcagaaggctgtagacaaatactgggacagctacaaccgtcccttcagacaggatcagaagaacttagatcattata

1041

taatacagtagcaaccctctattgtgtgcatcaaaagatagatgtaaaagacaccaaggaagccttagagaaaatagagg

1121

aagagcaaaacaaaagtaagaaaaaggcacagcaagcggcagctggcacaggaaacagcagccaggtcagccaaaattac

1201

cctatagtgcagaacctacaggggcaaatggtacatcaggccatatcacctagaactttaaatgcatgggtaaaagtagt

1281

agaagagaaggctttcagcccagaagtaatacccatgttttcagcattatcagaaggagccaccccacaagatttaaaca

1361

ccatgctaaacacagtggggggacatcaagcagccatgcaaatgttaaaagagaccatcaatgaggaagctgcagaatgg

1441

gatagattgcatccagtgcatgcagggcctattgcaccaggccagatgagagaaccaaggggaagtgacatagcaggaac

1521

tactagtacccttcaggagcaaataggatggatgacaaataatccacctatcccagtaggagaaatctataaaagatgga

1601

taattctgggattaaataaaatagtaagaatgtatagccctaccagcattctggacataaggcaaggaccaaaggaaccc

1681

tttagagactatgtagacaggttctataaaactctaagagctgaacaagcttcacaggaggtaaaaaattggatgacaga

1761

aaccttgttggtccaaaatgcgaacccagattgtaagactattttaaaagcattgggaccagcagctacactagaagaaa

1841

tgatgacagcatgtcagggagtggggggacccggccataaagcaagagttttggctgaagcaatgagccaagtaacaaat

1921

tcagctaccataatgatgcagagaggcaattttaggaaccaaagaaagactgttaagtgtttcaactgtggcaaagtcgg

2001

gcacatagctaaaaattgcagggcccctaggaaaaagggctgttggaaatgtggaaaggaaggacatcaaatgaaagatt

2081

gtaatgagagacaggctaattttttagggaaaatctggccttcccacaaggggaggccagggaattttcttcagagcaga

2161

ccagagccaacagccccaccagaagagagcttcaggtttggggaagagaaaacaactccctctcagaagcaggagccgat

2241

agacaaggaactgtatcctttagcttccctcagatcactctttggcaacgacccctcgtcacaataaagataggggggca

2321

actaaaggaagctctattagatacaggagcagatgatacagtattagaagaaatgaatttgccaggaagatggaaaccaa

2401

aaatgatagggggaattggaggttttatcaaagtaagacagtatgatcagatacccatagaaatctgtggacataaagct

2481

ataggtacagtattagtaggacctacacctgtcaacataattggaagaaatctgttgactcagattggctgtactttaaa

2561

ttttcctattagtcctattgaaactgtaccagtgaaattaaagccaggaatggatggcccaaaagttaaacaatggccat

2641

tgacagaagaaaaaataaaagcattagtagaaatttgtacagaaatggaaaaggaaggaaaaatttcaaaaattgggcct

2721

gaaaatccatacaatactccagtatttgccataaagaaaaaagacagtactaaatggagaaaattagtagatttcagaga

2801

acttaataagagaactcaagacttctgggaagttcaattaggaataccacatcctgcagggttaaaaaagaaaaaatcag

2881

taacagtactggatgtgggtgatgcatatttttcagttcccttagataaagacttcaggaagtatactgcatttaccata

2961

cctagtacaaacaatgagacaccagggattagatatcagtacaatgtgcttccacagggatggaaaggatcaccagcaat

3041

attccaaagtagcatgacaaaaatcttagagccttttagaaaacaaaatccagacatagttatctatcaatacatggatg

3121

atttgtatgtaggatctgacttagaaatagggcagcatagaacaaaaatagaggaactgagacaacatctgttgaggtgg

3201

ggacttaccacaccagacaaaaaacatcagaaagaacctccattcctttggatgggttatgaactccatcctgataaatg

3281

gacagtacaacctataatgctgccagaaaaggacagctggactgtcaatgacatacagaagttagtgggaaaattgaatt

3361

gggcaagtcagatctatgcagggattaaagtaaagcaattatgtaaactccttaggggaaccaaagcactaacagaagta

3441

gtaccactaacagaagaagcagaactagaactggcagaaaacagagagattctaaaagaaccagtacatggagtgtatta

3521

tgacccatcaaaagacttaatagcagaactacagaaacaggggcaaggccaatggacatatcaaatttatcaagagccat

3601

ttaaaaatctgaaaacaggaaagtatgcaaaaatgaggggtacccacactaatgatgtaaaacaattaacagaggcagtg

3681

caaaaaatagccacagaaagcatagtaatatggggaaagactcctaaatttaaattacccatacaaaaggaaacatggga

3761

tgcatggtggatagactattggcaagccacctggattcctgagtgggagtttgtcaatacccctcccttagtgaaattat

3841

ggtaccagttagagaaagaacccatagtaggagcagaaactttctatgtagatggggcagctaatagggaaactagatta

3921

ggaaaagcaggatatgtgactgacagaggaagacaaaaagttgttcccctaacggacacaacaaatcagaagactgaatt

4001

acaagcaatttatctagctttgcaggattcgggattggaagtaaacatagtaacagactcacaatatgcattaggaatca

4081

ttcaagcacaaccagataagagtgaatcagagttagtcagtcaaataatagaggagttaataaaaaaggaaaaggtctac

4161

ctggcatgggtaccagcacacaaaggaattggaggaaatgaacaagtagataaattagtcagtgctggaatcaggaaagt

4241

actatttttagatggaatagataaggcccaagaagaacatgagaaatatcacagtaattggagagcaatggctagtgatt

4321

ttaacctgccacctgtagtagcaaaagaaatagtagccagctgtgataaatgtcagctaaaaggagaagccatgcatgga

4401

caagtagactgtagtccaggaatatggcagctagattgtacacatttagaaggaaaagttatcctggtagcagtgcatgt

4481

agccagtggatatatagaagcagaagttattccagcagagacagggcaagaaacagcatactttctcttaaaattagcag

4561

gaagatggccagtaaaaacaatacacacagacaatggtggcaatttcatcagtactacagttaaggccgcctgttggtgg

4641

gcagggatcaagcaggaatttggcattccctacaatccccaaagtcaaggagtagtagaatctatgaataatgaattaaa

4721

gaaaattataggacaggtaagagatcaagctgaacatcttaagacagcagtacaaatggcagtattcatccacaatttta

4801

aaagaaaaggggggattggggggtacagtgcaggggaaagaataatagacataatagcaacagatatacaaactaaagaa

4881

ttacaaaaacaaattacaaagattcaaaattttcgggtttattacagggacagcagagatccactttggaaaggaccagc

4961

aaagcttctctggaaaggtgaaggggcagtagtaatacaagataatagtgacataaaagtagtgccaagaagaaaagcaa

5041

agatcattagggattatggaaaacagatggcaggtgatgattgtgtggcaagtagacaggatgaggattagaacatggaa

5121

aagtctagtgaaacaccatatgtatatttcagggaaagctaagaaatggtcttatagacaccactatgaaagcactcatc

5201

caagaataagttcagaagtacacatcccactaggggaggctagattagtagtaacaacatattggggtctgcatacagga

5281

gaaagagactggcatttgggtcagggagtctccatagaatggaggacaaagggatataacacacaagtagaccctgacct

5361

agcagaccaactaattcatctgtactattttgattgtttttcagaatctgctataagaaaggccatagtaggacgattag

5441

ttagccctaggtgtgaatatcaagcaggacataacaaggtaggatctctacagtacttggcactaacagcattaatagca

5521

ccaaaaaagataaagccacctttgcctagtgttaggaaactgacagaggatagatggaacaaaccccagaagaccaaggg

5601

ccacagaggcagccatacaatgaatggacactagagcttttagaggaacttaagagtgaagctgttaggcattttcctag

5681

gccatggctccttgcattaggacaacatatctatgaaacttatggggatacttggccaggagtggaagccttaataagaa

5761

gtctgcaacaactgctgtttattcatttcagaattggatgccgacatagcagaataggcattattcaacagaggagatca

5841

aggaatggagccagtagatcctagactagagccctggaagcatccaggaagccagcctaggactgcttgtccaattgcta
......................................................................cguuagucgauugaugugacgga

5921

attgtaaacagtgtgctttcattgccaagtttgtttcataacaaaaggcttaggcatctcctatggcaggaagaagcgga
cguuagucgauugaugugacgga

6001

agacagcgacgaagaactcctcaaagcagtaagactcatcaagcttctctatcaaagcagtaagtagtacatgtaatgct

6081

tcctttacaaatataagcaatagtagcattagtagtagtagcaataatagcaatagttgtgtggactatagtgttcatag

6161

aatataggaaaataagaagacaaaaacaagtagacaggttaattgatagaataatagaaagagcagaagacagtggcaat

6241

gagagcgaaggggatcaggaagaattgtcagcgcttatggagatggggcacaatgctccttgggatgttaatgatctgta

6321

gtgctgcagacaaattgtgggtcacagtctattatggggtacctgtatggaaagaagcaaccaccactctattttgtgca

6401

tcagatgctaaagcatatgacacagaggtacataatgtttgggccacacatgcctgtgtacccacagaccctaacccaca

6481

agaagtagtattggaaaatgtgacagaaaattttaacatgtggaaaaataacatggtagaacagatgcatgaggatataa

6561

tcagtttatgggatcaaagcctaaagccatgtgtaaaattaaccccactctgtgttactttaatttgcactaatgtaaat

6641

aatactaggaccaatagtagtgattgggacaggagggaaggagaaaagatgaaaggagaaataaaaaactgctctttcaa

6721

tgtcaccacaagcataagaaataaggtgcggaaagaatatgcacttttttataaacttgatgtagtaccaatagataagg

6801

ctaatacaagttatacattgatacattgtaacacctcagtcattacacaggcctgtccaaaggtatcctttgaaccaatt

6881

cccatacattattgtaccccggctggttttgcgattctaaagtgtaatgataagaagttcaatggaaaaggaccatgtac

6961

aaatgtcagcacagtacaatgtacacatggaattaggccagtggtgtccactcaactattgttaaatggcagtctagcag

7041

aaaaagaggtagtaattagatctgaaaatttcacaaacaatgctaaaaccataatagtacagctaaaggaacctgtagaa

7121

attaattgtacaagactcaacaacaatacaagaaaaagtatagctataggaccggggagaacagtttatgcaacagacag

7201

aataataggagatataagacaagcacattgtaaccttagtagtacaaaatggaacaacactttaaaacagatagttacaa

7281

aattaaaagaacaatttgggaataagacaataatctttaatcaatcctcaggaggggacccagaaattgtgatgcacagt

7361

tttaattgtggaggggaatttttctactgtaatacaacacagctgtttaatactacttggctgtttaatggtacttggaa

7441

tgatactgaagggttaaataacactgaaagaaatattacacttccatgcagaataaaacaaattataaacaggtggcagg

7521

aagtaggaaaagcaatgtatgcccctcccatcacaggaacaattagctgttcatcaaatattacagggctgctattaaca

7601

agagatggtggtagaggcgaaaatgagaccgagaccttcagacctggaggaggagatatgagggacaattggagaagtga

7681

attatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagag

7761

aaaaaagagcagtgggagcgataggagctctgttccttgggttcttgggagcagcaggaagcactatgggcgcagtggca

7841

ctgacgctgacggtacagaccagacaattattgtctggtatagtgcaacagcagaacaatctgctgagggctattgaggc

7921

gcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagagtcctggctgtggaaagatacctaa

8001

aggatcaacagctcctagggatttggggttgctctggaaaactcatctgcaccactgctgtgccttggaatgctagttgg

8081

agtaataaatctctggataagatttggaataatatgacctggatggagtgggagagagaaattgacaattacacaaactt

8161

aatatacaccttaattgaagaatcgcagaaccaacaagaaaagaatgaaaaagacttattggaattggatacgtgggcaa

8241

gtttgtggaattggtttgacataacaaattggctgtggtatataaaaatattcataatgataataggaggtttaataggt

8321

ttaagaatagtttttactatactttctttagtgaatagagttaggcagggatactcaccattgtcatttcagacccgctt

8401

cccagttccaaggggacccgacaggcccgaaggaatcgaagaagaaggtggagggagagacagagacacatccgggcgat

8481

tagtaactggattcttagcactcatctgggacgacctgcggagcctgtgcctcttcagctaccaccgcttgagagactta

8561

ctcttgattgtagcaaggattgtggaacttctgggacgcagggggtgggaagccctcaaatattggtggaatctcctgca

8641

gtattggagtcaggaactaaggaatagtgctgttagtttgtttgataccatagctatagcagtagctgagggaacagata

8721

gggttatagaagtagtgcaaagagcttgtagagctattctccacatacctagaagaataagacaaggcttagaaaggctt

8801

ttgctataaaatgggtggcaagtggtcaaaacgtagtctgggtggatggtctgctgtaagggaaagaatgcaacgagctg

8881

agccacgagctgagccagcagcagagggggtgggagcagtatctagagacttggaaaaacatggagcaatcacaagtagc

8961

aatacagcagctactaatgctgattgtgcctggctagaagcacaagaggaggaggaggtgggctttccagtcagacctca

9041

ggtaccgttaagaccaatgacttacaaggcagctttagatattagccactttttaaaagaaaaggggggactggaaggga

9121

taatttactcccaaagaagacaggatatccttgatctgtggatctaccacacacaaggctacttccctgattggcagaac

9201

tacacaccagggccagggatcagatatccactgacatttggatggtgcttcaagctagtaccagttgagccagagcaggt

9281

agaagaggccaataaaagagagaacgccagcttgttacaccctatgagccagcatgggatggatgacccagagaaagaag

9361

tactaatgtggaagtttgacagccgcctagcatttcatcacatggcccgagagaagcatccggagttctacaaagactgc

9441

tgacatcgagctttctacaagggactttccgctggggactttccaggggaggtgtggcctgggcgggactggggagtggc

9521

gagccctcagatgctgcatataagcagctgctttttgcctgtactgggtctctctggttagaccagatctgagcctggga

9601

gctc

9681