virusMammalian orthoreovirus 2
accNC_004273        
locusNC_004273 1196 bp ds-RNA linear VRL 21-OCT-2005
descriptionMammalian orthoreovirus 2 segment S4, complete sequence.
versionNC_004273.1 GI:23307908
organismMammalian orthoreovirus 2
 
feature0
  * location : NC_004273
  * mol_type : 1..1196
  * strain : Mammalian orthoreovirus 2
  * db_xref : genomic RNA
    
Sequence versus miRNA target sites
1

GCTATTTTTGCCTCTTCCTAGACGTTGTCGCAATGGAGGTGTGCCTGCCTAACGGTCATCAGATCGTCGACTGGATCAAT

81

AACGCATTTGAAGGACGAGTGTCAATTTACAGTGCTCAGCAAGGATGGGACAAAACAATCTCAGCACAGCCGGACATGAT

161

GGTGTGTGGTGGCGCCGTCGTATGCATGCATTGTCTAGGTGTGGTTGGGTCACTGAGCGAAAGCTGAAGCACTTGCCCCA
.......................................................gaugauuuuguaccuucgugaau

241

ATCATAAGTGCAACCAACAGCTACGCCAACAGGACTACGTTGATGTGCAGTTCGCTGATCGGGTTACTGCTCACTGGAAA

321

CGTGGTATGCTATCATTTGTCTCTCAGATGCATGCTATCATGAACGATGTGACACCCGAAGAGCTTGAAAGAGTGAGAAC

401

TGACGGAGGTTCTTTGGCTGAGCTTAACTGGCTACAAGTGGATCCTGGCTCAATGTTTCGATCAATTCATTCCAGCTGGA

481

CTGATCCCCTTCAAGTGGTTGAGGATCTCGATACTCAGCTAGACCGCTATTGGACAGCGTTAAATCTAATGATTGACTCA

561

TCAGACTTGGTGCCGAACTTTATGATGCGTGATCCATCGCATGCTTTTAATGGGGTGAAGTTGGAAGGTGAGGCACGACA

641

GACTCAGTTTTCTCGTACATTCGATTCAAGATCGAACTTGGAGTGGGGCGTCATGATCTATGACTATTCTGAATTAGAAA

721

GAGATCCCCTAAAAGGGCGAGCCTACAGGAAGGAGGTTGTTACACCAGCGAGAGATTTTGGTCACTTTGGACTGTCGCAT

801

TACTCTCGCGCTACAACGCCGATTCTTGGCAAGATGCCAGCCGTCTTTTCCGGGATGCTCACTGGAAACTGCAAAATGTA

881

CCCCTTCATAAAAGGGACTGCCAAATTAAGAACGGTCAAAAAGCTAGTAGATGCTGTGAATCATACGTGGGGCTCTGAGA

961

AGATTAGATACGCGTTGGGTCCTGGCGGAATGACAGGATGGTATAACAGGACCATGCAGCAAGCTCCGATTGTGTTGACT

1041

CCTGCGGCCCTAACGATGTTTCCAGACATGACTAAATTTGGTGATCTCCAGTACCCGATTATGATTGGCGATCCGGCTGT

1121

CCTTGGGTAAATGCCTCCATCTTCTCAGCGCCGGGCCTGACCAACCTGGTGTGACGTGGGACAGGCATCATTCATC

1201