virusKadipiro virus
accAF133429        
locusAF133429 3774 bp RNA linear VRL 27-JUN-2000
descriptionKadipiro virus segment 1 putative RNA-dependent RNA polymerase VP1 gene, complete cds.
versionAF133429.1 GI:8745242
organismKadipiro virus
 
feature
  * location : AF133429
  * mol_type : 1..3774
  * strain : Kadipiro virus
  * db_xref : genomic RNA
    
Sequence versus miRNA target sites
1

gtagaaaattcatttatgatggtaggatgctagacttagaatttgagaactgtttaatcgatgatttgaagactattgat

81

aaatgggagaaacaacaattgtccgtttatgatgagttatatggaactgaaactgctgagtttgtacttggagagggtaa

161

gttacccaactcttataggacaaacgtctttaagataactgaatctggtgataagatatttcttggtacactaattaaca

241

agttgttcagaccgcaaattgatttaagtaagttaaaagatgaacgactattaagatgtgttgagtatgataatggttgg

321

tatcaactatgtgttaagatacaacgcgctatcgataacggattggagatagagaaagctgatttacctaagtatgatcc

401

aaaatttgaatataacataaaacatccaacccgtgagaatggtttccttaactactatgttcttaaggaatgtagtgttg

481

agatatatatgaaggatgataacggtatacctgatccagcaatattacgtggttgggacatcagtactatacctgagtca

561

attcaactgccttctggtgtcgtctttaatgttagaaaagcttgcatgcgtaggatcaacgatgaagcacctttctatct

641

ctatacaagtatatttcaatatgctgcgactagaatagatatggacgatccatacacacggatttggttgaagtatttta

721

tcggagctgaagacttcttctcatataatggtagagttatagagtgtgacaaaagtctattagctcataaacgcttcgag

801

atgatgatagctgctcaacgtgcagcattgaaatatgacatggttggaaatgatatctttaaggagtgtatgcttgaagc

881

gtttgaaaatataattcgtgatccaatatataattcatatcggcttagaggtgcatttggcgatctaaatcaacatgtgt

961

ttgcgaggacggattcacctgcattgaacatctcaatggttggggtcgagtcaactagttttagaatgagagaggggacg

1041

gggataactgactctgattcccgtatcaacttgattgacggtgaatcatttgaggcttcactgcagacccttcgtgatta

1121

cggtcttagtaaaaatgcagacttacttcaacgtgcagttagatttcctattaatagggttaattgtaaattaggcttct

1201

tgaatcgtatggtacttggtttatgtggttatacgggttcgcatggtaattctgctgtggtgaagcagtttactgggaca

1281

cgtgacatggggccgaacgtgacgaaagagttttacgatgaggtagtaaatgaggtctttctaacgtataagtcagctct

1361

gcaaatgggtgattttgttgaaccacaatacagacttgatgtgttaatgaaaggtggaacttcatcagcaagtagcacct

1441

ttaatcaccataaaataaaagctagaatacgttataattcgccgttcttcactgacgacgatttagattcaaagtccgat

1521

aaggtggttaaaactgtggacggtaagtaccgtataattaccgaagttgcaactactttgaaatcgaaaagcgccacgat

1601

tctgacgcacccagaggacttcatttatgcatctgatgatatgttaaagtgccgtgttaaaatgggctctaggttagtgc

1681

gtggtacgcgtgataaacgtataataacacctaattacggttcaacctatttttcaatgctgttatcttcgctttctgct

1761

gttcgtttgttatctagtaggataccaaatatgccagctttgtccgtttctggtagaataggaacaacttatgaaggtgc

1841

attgccgcatgtagttatggctccaatgatggcagctttaagtggatcaacaaaatatgccgctgttgctctcgatttct

1921

cacaatatgattctagtttacatggcgacatctcaaaagctcatgctgaaggattacgcaaatatgcaagtttgtatcca

2001

aagggctcaaattatgacgatgctgagattgttgacttaacgaaagtatcgccaaataaattttgtgacattacagctaa

2081

gaattacgagacgccattagaatatgaaagcgtgggtatagtagctgaggctgcaggtgtaaaatctggtgagttgacaa

2161

cccaactacgtaatactgatccgaataaagctcatacgacgttaactctcaaacggtataactctaagtatgttagaaaa

2241

atggatttagttcacgagaatattgtaggtgacgataaatacgtaatattagtgatgacagatggtaaaccagttacgaa

2321

gttagacttaaagcggttcattgactgtgccgttgatgttgcagctgaaaatcacctcgtcatatcaggtaaacgatctg

2401

ttgctggtaatataaagggagaacacattaagatatgggttattaaaggatacattacacaagatgtatttctagattcg

2481

ctcgtgtcagaaaagatctcatttagagagatgaagtacgtagacaaactaactactatttatgatatattcatgtccat

2561

gttaacgaggtttgctacgacaggaccattaatggagttattcatgagagatatcatattaattgaaggcgttaaaatgg

2641

gatatcttaactttataccgactgttaagctaattagtgcagttggtggacctgaaatgtgtccatctgctccagagtta

2721

cggggtatggctagatacatgcatgattacgataaggataaatttgataccataaatagattatttgccacgttacgcga

2801

acgtaatggtacagaggcctttagacgacaaatcttacgtcaagtgcgtgaggatgaaatcgttaaaaatgagccactgg

2881

tatcaccactttggcgtatacatttcagacgcaggaatgggatcatcgtagataatgacttggtagctgatacttttaat

2961

gatataaagaaattcatgccagaacatgtggatataaagttgactgaagatttgatatcaactttgaaagagccagttgc

3041

tggcagaatggatgataatgttatactgattaatttatttacagtaggtaagttaggtaagtatgatagacccaagttta

3121

agtacaaatttttcttgacagagtataaaactactggcgtagaatcaccatacttaggagcttgtgagggtgttaggatg

3201

gtgcataagatagttggtttggctgatgctaatgttaaggtgcttaaccagctgcacggctgagcgctttacttagatct
...............................................cgauggacgugacauucgugaaaa

3281

tagacccggaacacatccagcttatttaagtggtgaagacatatttggtgtgttaagtagtagagttaatgcccaacaaa

3361

cttgggtcacagtacttgaacttcttgacttttcagcttcagttatacccgacgtaatcgacttttgttcaaagaacatg

3441

caccgttatttgacggataagaatgtcaatctaaccgctatttttgataacacatcgcgtacttatgacgtgtcagccga

3521

aatgatcaaacaacgcgttaagatttcaggtagtgagagagctgggatggtgctaacacgtggacttggtctggagggta

3601

tgaagtacatgctctatatggctagacgcggcagatcagttaaagcaagcacaacaccgacagttgttggtaatttgact

3681

ataatagatgatgattagttattgttaattgttcatatcgattaaaactaatctctaattcagtttagttcatcattgag

3761

ttttgaaaactgac

3841