Family
Genus
AccessionK03454
Nucleic acid
Targeted byhsa-miR-378
RankTarget locationvirus geneMfeHybridization
18171 - 8178unknown-31.1
CUCCUGACUCCAGGUCCUGUGU
.((((((((((((...(((((.
.......................)))))..)))))))))))).
CCUCAAAUAUUGGUGGAAUCUCCUACAGUAUUGGAGUCAGGAA




view map
hsa-miR-378
Target on 8171-8178