Orderunassigned
FamilyFlaviviridae
GenusHepacivirus
AccessionAF139594
Nucleic acidssRNA positive-strand viruses, no DNA stage
Targeted byhsa-mir-122a
RankTarget locationvirus geneMfeHybridization
19402 - 9408unknown-20.1
UGGAGUGUGACAAUGGUGUUUGU
((((((((.....((((.(((((
.......................)))))..)))).)))))))).
UCUACUUGCUCCCCAAUCGAUGAACGGGGAGCUAAACACUCCAG




view map
hsa-miR-122a
Target on 8818-8824 hsa-miR-122a
Target on 9402-9408