Orderunassigned
FamilyFlaviviridae
GenusHepacivirus
AccessionAF011751
Nucleic acidssRNA positive-strand viruses, no DNA stage
Targeted byhsa-mir-122a
Targe sitesRank by score
RankTarget locationvirus geneMfeScoreHybridizationmiRandaTragetScan
16231 - 6254unknown-17.5142
UGUUUGUG-GUAACAGUGUGAGGU
|:||:| | | ||| |||||||
ATAAGCTCGGAGTGTACCACTCCA
YesNO
29374 - 9397unknown-14.3146
UGUUUGUGGUAACA-GUGUGAGGu
|::|| :::: || |||||||
ATGAAGGTTGGGGTAAACACTCCg
YesNO
364 - 87unknown-14.3146
UGUUUGUGGUAACA-GUGUGAGGu
|::|| :::: || |||||||
AUGAAGGUUGGGGUAAACACUCCg
YesYes
49016 - 9038unknown-17.3147
uguuUGUGGUAACAGUGUGAGGU
|| ||| ||:|| |||||
tttcACTCCACAGTTACTCTCCA
YesNO
56402 - 6425unknown-19.7148
ugUUUGUGGUAACA-GUGUGAGgu
|:||: |||| | |||||||
ggAGACGGCATTATGCACACTCgc
YesNO
64746 - 4774unknown-18.5148
UGUUUGUGGUAAC------AGUGUGAGGu
|| :||||||| |||:||||
ACCTTTACCATTGAGACAACCACGCTCCc
YesNO
72 - 29unknown-25156
uGUUUGUGG--UA--ACAG-UGUGAGGU
||: | || || | | ||||||||
cCAGCCCCCTGATGGGGGCGACACTCCA
YesNO
8990 - 1013unknown-20.1169
uGUUUGUGGUA--ACAGUGUGAGGu
| :|::|||| || ||||||||
gCCGATGCCATCCTG-CACACTCCg
YesYes
98792 - 8813unknown-19.9171
ugUUUGUGGUAACAGUGUGAGGU
|:||| || | |||||||||
ggAGACAGCA-AGACACACTCCA
YesNO




view map