Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HBV subtype ayw (patient C) target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    adr   adyw   unspecified   ayw   adr4   ayw(patient C)   adw2   wildtype    
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 800 rescords (17 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7a31193137-13.1121
uugaUAUGUUGGAUGAUGGAGu
| :||:| ||||| |
aggaAGGCAGC---CTACCCCt
11.678NO
2hsa-let-7a20412068-14.8121
uUGAUAUGU----UGG-AUGAUG-GAGU
|:|:| || ||| ||||:| ||||
cATTGTTCACCTCACCATACTGCACTCA
11.678NO
3hsa-let-7b11291152-12.6121
UUGGUGUG---UUGGAUGAUGGAGu
||| |:|| ||||| :|||| |
AACAATACCTGAACCT-TTACCCCg
11.726NO
4hsa-let-7b31193137-13.4121
uuggUGUGUUGGAUGAUGGAGu
| :||:| ||||| |
aggaAGGCAGC---CTACCCCt
11.726NO
5hsa-let-7g405430-13121
uGACAUGU---UUGAUGAU--GGAGU
|| | || :||:||| |||||
cCTCTTCATCCTGCTGCTATGCCTCA
9.988NO
6hsa-miR-114151436-14.1121
aUGUAUGAAG-AAAUGUAAGGu
||:| |||: |||||:| ||
gACGTCCTTTGTTTACGTCCCg
5.340NO
7hsa-miR-10029823010-16.21121
gUGUUCAAGCCUAG-------AUGCCCaa
||||| | ||| | | ||||
aACAAGGTAGGAGCTGGAGCATTCGGGct
9.137NO
8hsa-miR-100373394-14.9121
GUGUUCAAGCCUAGAUGCC-CAA
|:| :| | | :|||:||| |||
CGCTGGAT-GTGTCTGCGGCGTT
9.137NO
9hsa-miR-1009941017-19.8121
gUGUUCAA-GCCUAG-AUGCCCAA
||:| || :||:|| | :|||||
aACGAATTGTGGGTCTTTTGGGTT
9.137NO
10hsa-miR-105374397-14121
uGUCCU---CAGAC-UCGUAAAcu
| ||| ||||| :||:|||
gCTGGATGTGTCTGCGGCGTTTta
5.000NO
11hsa-miR-106b379397-14.3121
UAGACGUGACAGUCGUGAAAU
|| ||: ||| |:||::||||
ATGTGT-CTG-CGGCGTTTTA
5.784NO
12hsa-miR-10b188212-14.5121
uguuuaAGC-CAA-G-AUGUCCCAu
||| ||| | :|:||||
cccttcTCGTGTTACAGGCGGGGTt
6.727NO
13hsa-miR-12614401459-14.3121
CGUAAUAAUGAGUGCCAUGCU
||: |: | |:||| ||||
GCGCTGAATCCCGCGG-ACGA
10.720NO
14hsa-miR-13425882608-13.6121
gggAGAC--CAGUUGGUCAGUGU
|:|| | | ||| |||||
cagTTTGTAGGC--CCACTCACA
5.000NO
15hsa-miR-141189213-13.6121
GGUAGA----AAUGGUCUGUCACAAu
|| ||| ||| |||:|:| |||
CCTTCTCGTGTTA-CAGGCGGGGTTt
5.100NO
16hsa-miR-15018671893-12.7121
gugaccAUGUUC--C-C--AACCCUCu
| |||| | | ||||| |
caagccTCCAAGCTGTGCCTTGGGTGg
7.336NO
17hsa-miR-185341357-12.4121
cUUGACGGAAAGAGAGGU
||| ||| || |||||
cAACCTCCTGTC-CTCCA
6.327NO
18hsa-miR-18723332358-12.2121
GCC---GACG-UUGUGUUCUG-UGCU
||| || | : ::: |||| ||||
CGGAGACTACTGTTGTTAGACGACGA
5.000NO
19hsa-miR-18821322152-14.8121
ugggAGGUGGUACGUUCCCUac
|||| ||| | |||||
aagaTCCAGCAT-CTAGGGAcc
5.000NO
20hsa-miR-193a5976-15.11121
GACCCUGAAACAUCC--GGUCAA
||| | | || || ||||||
CTG---C-TGGT-GGCTCCAGTT
NONO
21hsa-miR-193b14081438-16121
uuuCGCCCU----GAAAC---UCCCGGUCAa
|||||| ||||| | | || ||
tgcGCGGGACGTCCTTTGTTTACGTCCCGTc
NONO
22hsa-miR-196a82110-13.6121
gGUUGUU--GUAC----UU--UGAUGGAu
||::|| | || :| |||:|||
aCAGTAAACCCTGTTCCGACTACTGCCTc
NONO
23hsa-miR-196b19201940-12.9121
ggUUGUUGUCCUUUGAUGGau
|| ||: |:|:|||||
taAAGAATTTGGAGCTACCgt
NONO
24hsa-miR-19828692886-15.1121
GGAUAGAGGGGAGACCugg
|| | | :|||||||
CC-AGCAATCCTCTGGgat
5.000NO
25hsa-miR-21410041024-13.1121
gaCGGACAGACAC-GGACGACa
|:|| |:|| | ::|||||
ggGTCT-TTTGGGTTTTGCTGc
8.407NO
26hsa-miR-22411891217-17.9121
auuUGCCUU---GGUGAU---CACUGAAC
||| || |||||: | |:||||
ctgACGCAACCCCCACTGGCTGGGGCTTG
7.182NO
27hsa-miR-30e-3p13871406-13.4121
CGACAUUUGUAGGCUGACUUuc
||||| :| || ||||:|
GCTGT--GCTGCCAACTGGAtc
NONO
28hsa-miR-31450470-14.8121
gucGAUACGGUCGUAGAACGG
|||| :|:|| |||||
ggaCTATCAAGGTATGTTGCC
5.000NO
29hsa-miR-324-3p29943014-17.6121
gGUCGUCGUGGACCCCGUCACc
| | |||| :| |||| | |
gCTGGAGCA-TTCGGGCTGGGt
NONO
30hsa-miR-324-5p15081530-13.5121
uguGGUU-ACGGGAUCCCCUACGc
||:| | || | |||: ||
gttCCGACCGACC-ACGGGGCGCa
NONO
31hsa-miR-324-5p18711895-17.34121
uGUGGUU----ACGGGAUCCCCUACGc
| |||| ||||:| ||| ||
cCTCCAAGCTGTGCCTT--GGGTGGCt
NONO
32hsa-miR-32521372159-12.2121
uGU-GAAUGACCUGUGGAUGAUCc
|| | | || |: ||||| |||
cCAGCAT-CTAGGGACCTAGTAGt
NONO
33hsa-miR-32529652988-17.3121
UGU-GAAUGACCUGUGGAUGAUCC
||| || :| |||:|| || |||
ACACCTGGCCAGACGCCAACAAGG
NONO
34hsa-miR-3282551-14.6121
ugCCUUC--CCGUCU--CUC-CCGGuc
| ||| |||| ||| ||||
ctGCAAGATCCCAGAGTGAGAGGCCtg
NONO
35hsa-miR-330277305-19.4121
AGAGA-CGUCC-----GGCACACGAAACg
|:||| | :|| |||||||: |||
TTTCTAGGGGGAACTACCGTGTGTCTTGg
NONO
36hsa-miR-33120782092-12.6121
AAGAUCCUAUCCGGGUCCCCg
|||| | | |::||||
TTCT----TTG--CTGGGGGg
NONO
37hsa-miR-33927532774-17.2121
acucGAGG-ACCUCCUGUCCcu
|||: |||| |:|:||
cacaCTCTATGGAAGGCGGGta
NONO
38hsa-miR-33930463065-20.1121
aCUCGAGGACCUCC-UGUCCCu
|||| ||| ||| |||||
gGAGC-CCT-CAGGCTCAGGGc
NONO
39hsa-miR-340568591-13.8121
cCGAUAUUUCAUUGA--CUCUGCCU
|||:|| | || | ||||||
tGCTGTACCAAACCTTCG-GACGGA
NONO
40hsa-miR-34623442366-14121
ucuCCGUCCGUACGC-CCGUCugu
| :|| |: || |||||
gttGTTAGACG-ACGAGGCAGgtc
NONO
41hsa-miR-34617751795-14.5121
ucUCCGUCCGUACGCCCGUCUgu
||| |||| ||: |||| |
ctAGG-AGGC-TGTAGGCATAaa
NONO
42hsa-miR-363*16121636-14.7121
uuuaacGUAGCACU---AGGUGGgc
|| ||||| |||||
ggagacCACCGTGAACGCCCACCaa
NONO
43hsa-miR-37030403064-18.2121
gguCCAAGGUGGG-GUC---GUCCg
||| :||| ||| ||||
tggGGTGGAGCCCTCAGGCTCAGGg
NONO
44hsa-miR-373317339-14.3121
uguGGGGUUUUAGCUUCGUGAag
|||||| || || ||||
agtCCCCAACCTCCAATCACTca
NONO
45hsa-miR-37711091130-12.42121
ugUUUUCAACGGAA--ACACACUa
| ||| ||||| ||||| |
ttACAAG--GCCTTTCTGTGTAAa
NONO
46hsa-miR-37911621180-13.6121
aUGCAAGGUAUCAGAU--GGU
||| ||| :||||| |||
aACG-GCCA-GGTCTATGCCA
NONO
47hsa-miR-409-3p283315-18.8121
uCCCCAAG-UGGCUC---------GUUGUAAGC
|||| | |||| | ||| |||||
gGGGGAACTACCGTGTGTCTTGGCCAAAATTCG
NONO
48hsa-miR-43118821909-15.8121
ACGUA--CUGCCGGA----CGU-UCUGU
||| | |::|||:| ||| :||||
TGCCTTGGGTGGCTTTGGGGCATGGACA
NONO
49hsa-miR-43211631183-19.4121
gGUGGGUUACUGGAUGAGGUUCu
|: ||| |::|||: |||||
aCGGCCA--GGTCTATGCCAAGt
NONO
50hsa-miR-449502521-18.8121
UGGUCGAUUGUUAUGUGACGGu
|||||| ||:: || ||||
ACCAGC--ACGGGACCATGCCg
NONO
let-7a
Target on HBV subtype ayw (patient C) 
Binding site 3119-3137
mfe : -13.1
Hybrid sequence
uugaUAUGUUGGAUGAUGGAGu
aggaAGGCAGC---CTACCCCt let-7a
Target on HBV subtype ayw (patient C) 
Binding site 2041-2068
mfe : -14.8
Hybrid sequence
uUGAUAUGU----UGG-AUGAUG-GAGU
cATTGTTCACCTCACCATACTGCACTCA let-7b
Target on HBV subtype ayw (patient C) 
Binding site 1129-1152
mfe : -12.6
Hybrid sequence
UUGGUGUG---UUGGAUGAUGGAGu
AACAATACCTGAACCT-TTACCCCg let-7b
Target on HBV subtype ayw (patient C) 
Binding site 3119-3137
mfe : -13.4
Hybrid sequence
uuggUGUGUUGGAUGAUGGAGu
aggaAGGCAGC---CTACCCCt let-7g
Target on HBV subtype ayw (patient C) 
Binding site 405-430
mfe : -13
Hybrid sequence
uGACAUGU---UUGAUGAU--GGAGU
cCTCTTCATCCTGCTGCTATGCCTCA miR-1
Target on HBV subtype ayw (patient C) 
Binding site 1415-1436
mfe : -14.1
Hybrid sequence
aUGUAUGAAG-AAAUGUAAGGu
gACGTCCTTTGTTTACGTCCCg miR-100
Target on HBV subtype ayw (patient C) 
Binding site 2982-3010
mfe : -16.21
Hybrid sequence
gUGUUCAAGCCUAG-------AUGCCCaa
aACAAGGTAGGAGCTGGAGCATTCGGGct miR-100
Target on HBV subtype ayw (patient C) 
Binding site 373-394
mfe : -14.9
Hybrid sequence
GUGUUCAAGCCUAGAUGCC-CAA
CGCTGGAT-GTGTCTGCGGCGTT miR-100
Target on HBV subtype ayw (patient C) 
Binding site 994-1017
mfe : -19.8
Hybrid sequence
gUGUUCAA-GCCUAG-AUGCCCAA
aACGAATTGTGGGTCTTTTGGGTT miR-105
Target on HBV subtype ayw (patient C) 
Binding site 374-397
mfe : -14
Hybrid sequence
uGUCCU---CAGAC-UCGUAAAcu
gCTGGATGTGTCTGCGGCGTTTta miR-106b
Target on HBV subtype ayw (patient C) 
Binding site 379-397
mfe : -14.3
Hybrid sequence
UAGACGUGACAGUCGUGAAAU
ATGTGT-CTG-CGGCGTTTTA miR-10b
Target on HBV subtype ayw (patient C) 
Binding site 188-212
mfe : -14.5
Hybrid sequence
uguuuaAGC-CAA-G-AUGUCCCAu
cccttcTCGTGTTACAGGCGGGGTt miR-126
Target on HBV subtype ayw (patient C) 
Binding site 1440-1459
mfe : -14.3
Hybrid sequence
CGUAAUAAUGAGUGCCAUGCU
GCGCTGAATCCCGCGG-ACGA miR-134
Target on HBV subtype ayw (patient C) 
Binding site 2588-2608
mfe : -13.6
Hybrid sequence
gggAGAC--CAGUUGGUCAGUGU
cagTTTGTAGGC--CCACTCACA miR-141
Target on HBV subtype ayw (patient C) 
Binding site 189-213
mfe : -13.6
Hybrid sequence
GGUAGA----AAUGGUCUGUCACAAu
CCTTCTCGTGTTA-CAGGCGGGGTTt miR-150
Target on HBV subtype ayw (patient C) 
Binding site 1867-1893
mfe : -12.7
Hybrid sequence
gugaccAUGUUC--C-C--AACCCUCu
caagccTCCAAGCTGTGCCTTGGGTGg miR-185
Target on HBV subtype ayw (patient C) 
Binding site 341-357
mfe : -12.4
Hybrid sequence
cUUGACGGAAAGAGAGGU
cAACCTCCTGTC-CTCCA miR-187
Target on HBV subtype ayw (patient C) 
Binding site 2333-2358
mfe : -12.2
Hybrid sequence
GCC---GACG-UUGUGUUCUG-UGCU
CGGAGACTACTGTTGTTAGACGACGA miR-188
Target on HBV subtype ayw (patient C) 
Binding site 2132-2152
mfe : -14.8
Hybrid sequence
ugggAGGUGGUACGUUCCCUac
aagaTCCAGCAT-CTAGGGAcc miR-193a
Target on HBV subtype ayw (patient C) 
Binding site 59-76
mfe : -15.11
Hybrid sequence
GACCCUGAAACAUCC--GGUCAA
CTG---C-TGGT-GGCTCCAGTT miR-193b
Target on HBV subtype ayw (patient C) 
Binding site 1408-1438
mfe : -16
Hybrid sequence
uuuCGCCCU----GAAAC---UCCCGGUCAa
tgcGCGGGACGTCCTTTGTTTACGTCCCGTc miR-196a
Target on HBV subtype ayw (patient C) 
Binding site 82-110
mfe : -13.6
Hybrid sequence
gGUUGUU--GUAC----UU--UGAUGGAu
aCAGTAAACCCTGTTCCGACTACTGCCTc miR-196b
Target on HBV subtype ayw (patient C) 
Binding site 1920-1940
mfe : -12.9
Hybrid sequence
ggUUGUUGUCCUUUGAUGGau
taAAGAATTTGGAGCTACCgt miR-198
Target on HBV subtype ayw (patient C) 
Binding site 2869-2886
mfe : -15.1
Hybrid sequence
GGAUAGAGGGGAGACCugg
CC-AGCAATCCTCTGGgat miR-214
Target on HBV subtype ayw (patient C) 
Binding site 1004-1024
mfe : -13.1
Hybrid sequence
gaCGGACAGACAC-GGACGACa
ggGTCT-TTTGGGTTTTGCTGc miR-224
Target on HBV subtype ayw (patient C) 
Binding site 1189-1217
mfe : -17.9
Hybrid sequence
auuUGCCUU---GGUGAU---CACUGAAC
ctgACGCAACCCCCACTGGCTGGGGCTTG miR-30e-3p
Target on HBV subtype ayw (patient C) 
Binding site 1387-1406
mfe : -13.4
Hybrid sequence
CGACAUUUGUAGGCUGACUUuc
GCTGT--GCTGCCAACTGGAtc miR-31
Target on HBV subtype ayw (patient C) 
Binding site 450-470
mfe : -14.8
Hybrid sequence
gucGAUACGGUCGUAGAACGG
ggaCTATCAAGGTATGTTGCC miR-324-3p
Target on HBV subtype ayw (patient C) 
Binding site 2994-3014
mfe : -17.6
Hybrid sequence
gGUCGUCGUGGACCCCGUCACc
gCTGGAGCA-TTCGGGCTGGGt miR-324-5p
Target on HBV subtype ayw (patient C) 
Binding site 1508-1530
mfe : -13.5
Hybrid sequence
uguGGUU-ACGGGAUCCCCUACGc
gttCCGACCGACC-ACGGGGCGCa miR-324-5p
Target on HBV subtype ayw (patient C) 
Binding site 1871-1895
mfe : -17.34
Hybrid sequence
uGUGGUU----ACGGGAUCCCCUACGc
cCTCCAAGCTGTGCCTT--GGGTGGCt miR-325
Target on HBV subtype ayw (patient C) 
Binding site 2137-2159
mfe : -12.2
Hybrid sequence
uGU-GAAUGACCUGUGGAUGAUCc
cCAGCAT-CTAGGGACCTAGTAGt miR-325
Target on HBV subtype ayw (patient C) 
Binding site 2965-2988
mfe : -17.3
Hybrid sequence
UGU-GAAUGACCUGUGGAUGAUCC
ACACCTGGCCAGACGCCAACAAGG miR-328
Target on HBV subtype ayw (patient C) 
Binding site 25-51
mfe : -14.6
Hybrid sequence
ugCCUUC--CCGUCU--CUC-CCGGuc
ctGCAAGATCCCAGAGTGAGAGGCCtg miR-330
Target on HBV subtype ayw (patient C) 
Binding site 277-305
mfe : -19.4
Hybrid sequence
AGAGA-CGUCC-----GGCACACGAAACg
TTTCTAGGGGGAACTACCGTGTGTCTTGg miR-331
Target on HBV subtype ayw (patient C) 
Binding site 2078-2092
mfe : -12.6
Hybrid sequence
AAGAUCCUAUCCGGGUCCCCg
TTCT----TTG--CTGGGGGg miR-339
Target on HBV subtype ayw (patient C) 
Binding site 2753-2774
mfe : -17.2
Hybrid sequence
acucGAGG-ACCUCCUGUCCcu
cacaCTCTATGGAAGGCGGGta miR-339
Target on HBV subtype ayw (patient C) 
Binding site 3046-3065
mfe : -20.1
Hybrid sequence
aCUCGAGGACCUCC-UGUCCCu
gGAGC-CCT-CAGGCTCAGGGc miR-340
Target on HBV subtype ayw (patient C) 
Binding site 568-591
mfe : -13.8
Hybrid sequence
cCGAUAUUUCAUUGA--CUCUGCCU
tGCTGTACCAAACCTTCG-GACGGA miR-346
Target on HBV subtype ayw (patient C) 
Binding site 2344-2366
mfe : -14
Hybrid sequence
ucuCCGUCCGUACGC-CCGUCugu
gttGTTAGACG-ACGAGGCAGgtc miR-346
Target on HBV subtype ayw (patient C) 
Binding site 1775-1795
mfe : -14.5
Hybrid sequence
ucUCCGUCCGUACGCCCGUCUgu
ctAGG-AGGC-TGTAGGCATAaa miR-363*
Target on HBV subtype ayw (patient C) 
Binding site 1612-1636
mfe : -14.7
Hybrid sequence
uuuaacGUAGCACU---AGGUGGgc
ggagacCACCGTGAACGCCCACCaa miR-370
Target on HBV subtype ayw (patient C) 
Binding site 3040-3064
mfe : -18.2
Hybrid sequence
gguCCAAGGUGGG-GUC---GUCCg
tggGGTGGAGCCCTCAGGCTCAGGg miR-373
Target on HBV subtype ayw (patient C) 
Binding site 317-339
mfe : -14.3
Hybrid sequence
uguGGGGUUUUAGCUUCGUGAag
agtCCCCAACCTCCAATCACTca miR-377
Target on HBV subtype ayw (patient C) 
Binding site 1109-1130
mfe : -12.42
Hybrid sequence
ugUUUUCAACGGAA--ACACACUa
ttACAAG--GCCTTTCTGTGTAAa miR-379
Target on HBV subtype ayw (patient C) 
Binding site 1162-1180
mfe : -13.6
Hybrid sequence
aUGCAAGGUAUCAGAU--GGU
aACG-GCCA-GGTCTATGCCA miR-409-3p
Target on HBV subtype ayw (patient C) 
Binding site 283-315
mfe : -18.8
Hybrid sequence
uCCCCAAG-UGGCUC---------GUUGUAAGC
gGGGGAACTACCGTGTGTCTTGGCCAAAATTCG miR-431
Target on HBV subtype ayw (patient C) 
Binding site 1882-1909
mfe : -15.8
Hybrid sequence
ACGUA--CUGCCGGA----CGU-UCUGU
TGCCTTGGGTGGCTTTGGGGCATGGACA miR-432
Target on HBV subtype ayw (patient C) 
Binding site 1163-1183
mfe : -19.4
Hybrid sequence
gGUGGGUUACUGGAUGAGGUUCu
aCGGCCA--GGTCTATGCCAAGt miR-449
Target on HBV subtype ayw (patient C) 
Binding site 502-521
mfe : -18.8
Hybrid sequence
UGGUCGAUUGUUAUGUGACGGu
ACCAGC--ACGGGACCATGCCg