Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HBV subtype adw2 target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    adr   adyw   unspecified   ayw   adr4   ayw(patient C)   adw2   wildtype    
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 856 rescords (18 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7a25362559-12.7121
UUGAUAUG---UUGGAUGAUGGAGu
||| :||| ||||| :|||| |
AACAGTACATGAACCT-TTACCCCg
11.678NO
2hsa-let-7b626-12.4121
UUGGUGUGUUGGAUGAUGGAgu
|||: : : |||| ||:|||
AACTTTTTCACCT-CTGCCTaa
11.726NO
3hsa-let-7b486508-16121
uUGGUGUGUU---GGAUGAUGGAGU
||||| ||| || |||:||:|
gACCAC-CAAATGCC-CCTATCTTA
11.726NO
4hsa-let-7c25362559-13.3121
UUGGUAUG---UUGGAUGAUGGAGu
||| :||| ||||| :|||| |
AACAGTACATGAACCT-TTACCCCg
11.774NO
5hsa-let-7d14011422-12121
uGAUACGUU-GGAUGAUGGAga
| :|| || :| |||:|||
gCAGTGGAATTCCACTGCCTtc
7.888NO
6hsa-let-7g18121837-13121
uGACAUGU---UUGAUGAU--GGAGU
|| | || :||:||| |||||
cCTCTTCATCCTGCTGCTATGCCTCA
9.988NO
7hsa-let-7i14011422-13.7121
uGUCGUGUU-UGAUGAUGGAgu
|||:: || | |||:|||
gCAGTGGAATTCCACTGCCTtc
7.883NO
8hsa-miR-128222843-14.1121
aUGUAUGAAG-AAAUGUAAGGu
||:| |||: |||||:| ||
gACGTCCTTTGTTTACGTCCCg
5.340NO
9hsa-miR-10017801801-14.9121
GUGUUCAAGCCUAGAUGCC-CAA
|:| :| | | :|||:||| |||
CGCTGGAT-GTGTCTGCGGCGTT
9.137NO
10hsa-miR-10517811804-14121
uGUCCU---CAGAC-UCGUAAAcu
| ||| ||||| :||:|||
gCTGGATGTGTCTGCGGCGTTTta
5.000NO
11hsa-miR-106b17861804-14.3121
UAGACGUGACAGUCGUGAAAU
|| ||: ||| |:||::||||
ATGTGT-CTG-CGGCGTTTTA
5.784NO
12hsa-miR-10b15951619-14.5121
uguuuaAGC-CAA-G-AUGUCCCAu
||| ||| | :|:||||
ccctgcTCGTGTTACAGGCGGGGTt
6.727NO
13hsa-miR-124a192215-14.3121
acCG-UAAGUGGCGC-ACGGAAUu
|| | :|:|| | ||||||
caGCTCTGTATCGAGAAGCCTTAg
5.000NO
14hsa-miR-125a31323156-18121
gugUCC--AAUUUCCCAGAGUCCCU
||| | ::||| || :||||
ttaAGGACTGGGAGGAGCTGGGGGA
10.086NO
15hsa-miR-12628472866-14.3121
CGUAAUAAUGAGUGCCAUGCU
||: |: | |:||| ||||
GCGCTGAATCCCGCGG-ACGA
10.720NO
16hsa-miR-12715261555-14121
uCGGUUCGAG-----UCUG---CCUAGGcu
|:||| ||| :||| ||| ||
cGTCAATCTCCGCGAGGACTGGGGACCCtg
5.000NO
17hsa-miR-133a22952316-13.26121
UGUCGACCAACUUCCCCUGGuu
|:| :||| | ||||| |
ATAATTGGAAGTTGGGGAACtt
5.000NO
18hsa-miR-133b22962316-12.66121
AUCGACCAACUUCCCCUGGuu
|| :||| | ||||| |
TAATTGGAAGTTGGGGAACtt
NONO
19hsa-miR-13429672987-19.1121
GGGAGACCAGUUGGUCAGugu
||:||| || :||:|||
CCTTCTCATCTGCCGGTCcgt
5.000NO
20hsa-miR-13819311947-14.8121
cuAAGUGUUGUGGUCGA
| |||:|| || |||
ccTGCACGACTCCTGCT
5.000NO
21hsa-miR-14129722991-13.9121
gGUAGAAAUGGUCUGUCACAau
|||| |:||:| | ||||
tCATC--TGCCGGTCCGTGTgc
5.100NO
22hsa-miR-18314021422-14.72121
GUCA-CUUAAGAUGGUCACGGUAu
|||| |||||| || |||| |
CAGTGGAATTCCAC---TGCCTTc
5.000NO
23hsa-miR-18517481764-12.4121
cUUGACGGAAAGAGAGGU
||| ||| || |||||
cAACCTCCTGTC-CTCCA
6.327NO
24hsa-miR-18813641384-18.1121
uGGGAGGUGGUACGUUCCCUac
|:||||||| | :||| ||
tCTCTCCACC-TCTAAGAGAca
5.000NO
25hsa-miR-193b30943116-13.16121
UUUCGCCCUGAAACUCCCGGucaa
|| | ||| |||| ||||
AACGACCGACCTTGA-GGCCtact
NONO
26hsa-miR-193b28152845-16121
uuuCGCCCU----GAAAC---UCCCGGUCAa
|||||| ||||| | | || ||
ttcGCGGGACGTCCTTTGTTTACGTCCCGTc
NONO
27hsa-miR-196a509531-13.9121
gGUUGU--UGUACUUUGAUGgau
||||| | ||||||||
tCAACACTTCCGGAAACTACtgt
NONO
28hsa-miR-19822122235-14.4121
GGAUAGAGG-----GGAGACCugg
|| ||:|:| :||||||
CCAATTTTCTTTTGTCTCTGGgta
5.000NO
29hsa-miR-200a29722991-12.9121
uGUAGCAAUGGUCUGUCACAau
|||| |:||:| | ||||
tCATC--TGCCGGTCCGTGTgc
6.741NO
30hsa-miR-200b13851409-17.02121
CAGUAGUAAU--GGUCCGUCAuaau
|||||| | | ||| |||||
GTCATCCTCAGGCCATGCAGTggaa
5.000NO
31hsa-miR-21015461565-12.5121
aguCGGCGACAGUGUGCGUGUc
| | |||| ||| |||
gggGACCCTGT--GACGAACAt
6.639NO
32hsa-miR-21424112431-14.2121
gaCGGACAGACAC-GGACGACa
|:|| |:|| | ::|||||
ggGTCT-TTTGGGCTTTGCTGc
8.407NO
33hsa-miR-22425962624-17.9121
auuUGCCUU---GGUGAU---CACUGAAC
||| || |||||: | |:||||
ctgACGCAACCCCCACTGGCTGGGGCTTG
7.182NO
34hsa-miR-2420412062-15.7121
gacAAGGACGACUUGACUCGGu
| ||| : |:| ||:|||
aaaTACCTATGGGAGTGGGCCt
11.006NO
35hsa-miR-2414261450-12.9121
gacaagGACGACUU---GACUCGGU
|||| |:| | |||:||
caaactCTGCAGGATCCCAGAGTCA
11.006NO
36hsa-miR-2426062628-15.6121
gacaaGGACGA-CUUGACUCGGU
|: ||| |::|| :||||
ccccaCTGGCTGGGGCTTGGCCA
11.006NO
37hsa-miR-29631333159-19.46121
ugUCCUAA--CUCC----CCCCCggga
|||| | |||| |||||
taAGGACTGGGAGGAGCTGGGGGagga
7.400NO
38hsa-miR-30a-3p27942813-12.7121
CGACGUUUGUAGGCUGACUUuc
||||: || || ||||:|
GCTGT--ACTGCCAACTGGAtc
NONO
39hsa-miR-32029022926-16.46121
AAGCGGGAGA--GUUGGGUCGaaaa
||| || ||| |: :|||||
TTCTCCGTCTGCCGTTCCAGCcgac
10.314NO
40hsa-miR-324-5p20362059-16.7121
uGUGGUUACGGGAUCCCCU-ACgc
|:| || |||| |||| ||
tCGCAAAATACCTATGGGAGTGgg
NONO
41hsa-miR-324-5p5781-17.34121
uGUGGUU----ACGGGAUCCCCUACGc
| |||| ||||:| ||| ||
cCTCCAAGCTGTGCCTT--GGGTGGCt
NONO
42hsa-miR-32812561293-23.62121
uGCCUU-----CCCGUCUC-----------UCCCGguc
||| | |||::||| |||||
gCGGTATTTTGGGGTGGAGCCCTCAGGCTCAGGGCata
NONO
43hsa-miR-33016841712-19.4121
AGAGA-CGUCC-----GGCACACGAAACg
|:||| | :|| |||||||: |||
TTTCTAGGGGGATCTCCCGTGTGTCTTGg
NONO
44hsa-miR-33710291054-15121
uUUC-CGUAGU-AUAUCCU-CGACCu
||| || || ||:||| |:|||
cAAGAGCTACAGCATGGGAGGTTGGt
NONO
45hsa-miR-33720382060-15.4121
uuuccguaGUAUAUCCUCGACCu
| |||:||||: ||
gcaaaataCCTATGGGAGTGGGc
NONO
46hsa-miR-33912711290-20.1121
aCUCGAGGACCUCC-UGUCCCu
|||| ||| ||| |||||
gGAGC-CCT-CAGGCTCAGGGc
NONO
47hsa-miR-34027932827-15.3121
CCGAUAUUUC-AUUGA-----------CUCUGCcu
||||:|| | |||| |:||||
GGCTGTACTGCCAACTGGATCCTTCGCGGGACGtc
NONO
48hsa-miR-34631823202-15.2121
ucUCCGUCCGUACGCCCGUCUgu
||| |||| ||: |||| |
ttAGG-AGGC-TGTAGGCACAaa
NONO
49hsa-miR-34612711299-17.9121
uCUC---CGUCCGUACGCCCGU----CUGu
||| ||||| | ||||| |||
gGAGCCCTCAGGC-TCAGGGCATATTGACc
NONO
50hsa-miR-34a213234-14.9121
uUGUUGGUCGAUUCUGUGACGgu
| |::| ||:|| ||:|||
tAGAGTCTCCTGAG-CATTGCtc
7.376NO
let-7a
Target on HBV subtype adw2 
Binding site 2536-2559
mfe : -12.7
Hybrid sequence
UUGAUAUG---UUGGAUGAUGGAGu
AACAGTACATGAACCT-TTACCCCg let-7b
Target on HBV subtype adw2 
Binding site 6-26
mfe : -12.4
Hybrid sequence
UUGGUGUGUUGGAUGAUGGAgu
AACTTTTTCACCT-CTGCCTaa let-7b
Target on HBV subtype adw2 
Binding site 486-508
mfe : -16
Hybrid sequence
uUGGUGUGUU---GGAUGAUGGAGU
gACCAC-CAAATGCC-CCTATCTTA let-7c
Target on HBV subtype adw2 
Binding site 2536-2559
mfe : -13.3
Hybrid sequence
UUGGUAUG---UUGGAUGAUGGAGu
AACAGTACATGAACCT-TTACCCCg let-7d
Target on HBV subtype adw2 
Binding site 1401-1422
mfe : -12
Hybrid sequence
uGAUACGUU-GGAUGAUGGAga
gCAGTGGAATTCCACTGCCTtc let-7g
Target on HBV subtype adw2 
Binding site 1812-1837
mfe : -13
Hybrid sequence
uGACAUGU---UUGAUGAU--GGAGU
cCTCTTCATCCTGCTGCTATGCCTCA let-7i
Target on HBV subtype adw2 
Binding site 1401-1422
mfe : -13.7
Hybrid sequence
uGUCGUGUU-UGAUGAUGGAgu
gCAGTGGAATTCCACTGCCTtc miR-1
Target on HBV subtype adw2 
Binding site 2822-2843
mfe : -14.1
Hybrid sequence
aUGUAUGAAG-AAAUGUAAGGu
gACGTCCTTTGTTTACGTCCCg miR-100
Target on HBV subtype adw2 
Binding site 1780-1801
mfe : -14.9
Hybrid sequence
GUGUUCAAGCCUAGAUGCC-CAA
CGCTGGAT-GTGTCTGCGGCGTT miR-105
Target on HBV subtype adw2 
Binding site 1781-1804
mfe : -14
Hybrid sequence
uGUCCU---CAGAC-UCGUAAAcu
gCTGGATGTGTCTGCGGCGTTTta miR-106b
Target on HBV subtype adw2 
Binding site 1786-1804
mfe : -14.3
Hybrid sequence
UAGACGUGACAGUCGUGAAAU
ATGTGT-CTG-CGGCGTTTTA miR-10b
Target on HBV subtype adw2 
Binding site 1595-1619
mfe : -14.5
Hybrid sequence
uguuuaAGC-CAA-G-AUGUCCCAu
ccctgcTCGTGTTACAGGCGGGGTt miR-124a
Target on HBV subtype adw2 
Binding site 192-215
mfe : -14.3
Hybrid sequence
acCG-UAAGUGGCGC-ACGGAAUu
caGCTCTGTATCGAGAAGCCTTAg miR-125a
Target on HBV subtype adw2 
Binding site 3132-3156
mfe : -18
Hybrid sequence
gugUCC--AAUUUCCCAGAGUCCCU
ttaAGGACTGGGAGGAGCTGGGGGA miR-126
Target on HBV subtype adw2 
Binding site 2847-2866
mfe : -14.3
Hybrid sequence
CGUAAUAAUGAGUGCCAUGCU
GCGCTGAATCCCGCGG-ACGA miR-127
Target on HBV subtype adw2 
Binding site 1526-1555
mfe : -14
Hybrid sequence
uCGGUUCGAG-----UCUG---CCUAGGcu
cGTCAATCTCCGCGAGGACTGGGGACCCtg miR-133a
Target on HBV subtype adw2 
Binding site 2295-2316
mfe : -13.26
Hybrid sequence
UGUCGACCAACUUCCCCUGGuu
ATAATTGGAAGTTGGGGAACtt miR-133b
Target on HBV subtype adw2 
Binding site 2296-2316
mfe : -12.66
Hybrid sequence
AUCGACCAACUUCCCCUGGuu
TAATTGGAAGTTGGGGAACtt miR-134
Target on HBV subtype adw2 
Binding site 2967-2987
mfe : -19.1
Hybrid sequence
GGGAGACCAGUUGGUCAGugu
CCTTCTCATCTGCCGGTCcgt miR-138
Target on HBV subtype adw2 
Binding site 1931-1947
mfe : -14.8
Hybrid sequence
cuAAGUGUUGUGGUCGA
ccTGCACGACTCCTGCT miR-141
Target on HBV subtype adw2 
Binding site 2972-2991
mfe : -13.9
Hybrid sequence
gGUAGAAAUGGUCUGUCACAau
tCATC--TGCCGGTCCGTGTgc miR-183
Target on HBV subtype adw2 
Binding site 1402-1422
mfe : -14.72
Hybrid sequence
GUCA-CUUAAGAUGGUCACGGUAu
CAGTGGAATTCCAC---TGCCTTc miR-185
Target on HBV subtype adw2 
Binding site 1748-1764
mfe : -12.4
Hybrid sequence
cUUGACGGAAAGAGAGGU
cAACCTCCTGTC-CTCCA miR-188
Target on HBV subtype adw2 
Binding site 1364-1384
mfe : -18.1
Hybrid sequence
uGGGAGGUGGUACGUUCCCUac
tCTCTCCACC-TCTAAGAGAca miR-193b
Target on HBV subtype adw2 
Binding site 3094-3116
mfe : -13.16
Hybrid sequence
UUUCGCCCUGAAACUCCCGGucaa
AACGACCGACCTTGA-GGCCtact miR-193b
Target on HBV subtype adw2 
Binding site 2815-2845
mfe : -16
Hybrid sequence
uuuCGCCCU----GAAAC---UCCCGGUCAa
ttcGCGGGACGTCCTTTGTTTACGTCCCGTc miR-196a
Target on HBV subtype adw2 
Binding site 509-531
mfe : -13.9
Hybrid sequence
gGUUGU--UGUACUUUGAUGgau
tCAACACTTCCGGAAACTACtgt miR-198
Target on HBV subtype adw2 
Binding site 2212-2235
mfe : -14.4
Hybrid sequence
GGAUAGAGG-----GGAGACCugg
CCAATTTTCTTTTGTCTCTGGgta miR-200a
Target on HBV subtype adw2 
Binding site 2972-2991
mfe : -12.9
Hybrid sequence
uGUAGCAAUGGUCUGUCACAau
tCATC--TGCCGGTCCGTGTgc miR-200b
Target on HBV subtype adw2 
Binding site 1385-1409
mfe : -17.02
Hybrid sequence
CAGUAGUAAU--GGUCCGUCAuaau
GTCATCCTCAGGCCATGCAGTggaa miR-210
Target on HBV subtype adw2 
Binding site 1546-1565
mfe : -12.5
Hybrid sequence
aguCGGCGACAGUGUGCGUGUc
gggGACCCTGT--GACGAACAt miR-214
Target on HBV subtype adw2 
Binding site 2411-2431
mfe : -14.2
Hybrid sequence
gaCGGACAGACAC-GGACGACa
ggGTCT-TTTGGGCTTTGCTGc miR-224
Target on HBV subtype adw2 
Binding site 2596-2624
mfe : -17.9
Hybrid sequence
auuUGCCUU---GGUGAU---CACUGAAC
ctgACGCAACCCCCACTGGCTGGGGCTTG miR-24
Target on HBV subtype adw2 
Binding site 2041-2062
mfe : -15.7
Hybrid sequence
gacAAGGACGACUUGACUCGGu
aaaTACCTATGGGAGTGGGCCt miR-24
Target on HBV subtype adw2 
Binding site 1426-1450
mfe : -12.9
Hybrid sequence
gacaagGACGACUU---GACUCGGU
caaactCTGCAGGATCCCAGAGTCA miR-24
Target on HBV subtype adw2 
Binding site 2606-2628
mfe : -15.6
Hybrid sequence
gacaaGGACGA-CUUGACUCGGU
ccccaCTGGCTGGGGCTTGGCCA miR-296
Target on HBV subtype adw2 
Binding site 3133-3159
mfe : -19.46
Hybrid sequence
ugUCCUAA--CUCC----CCCCCggga
taAGGACTGGGAGGAGCTGGGGGagga miR-30a-3p
Target on HBV subtype adw2 
Binding site 2794-2813
mfe : -12.7
Hybrid sequence
CGACGUUUGUAGGCUGACUUuc
GCTGT--ACTGCCAACTGGAtc miR-320
Target on HBV subtype adw2 
Binding site 2902-2926
mfe : -16.46
Hybrid sequence
AAGCGGGAGA--GUUGGGUCGaaaa
TTCTCCGTCTGCCGTTCCAGCcgac miR-324-5p
Target on HBV subtype adw2 
Binding site 2036-2059
mfe : -16.7
Hybrid sequence
uGUGGUUACGGGAUCCCCU-ACgc
tCGCAAAATACCTATGGGAGTGgg miR-324-5p
Target on HBV subtype adw2 
Binding site 57-81
mfe : -17.34
Hybrid sequence
uGUGGUU----ACGGGAUCCCCUACGc
cCTCCAAGCTGTGCCTT--GGGTGGCt miR-328
Target on HBV subtype adw2 
Binding site 1256-1293
mfe : -23.62
Hybrid sequence
uGCCUU-----CCCGUCUC-----------UCCCGguc
gCGGTATTTTGGGGTGGAGCCCTCAGGCTCAGGGCata miR-330
Target on HBV subtype adw2 
Binding site 1684-1712
mfe : -19.4
Hybrid sequence
AGAGA-CGUCC-----GGCACACGAAACg
TTTCTAGGGGGATCTCCCGTGTGTCTTGg miR-337
Target on HBV subtype adw2 
Binding site 1029-1054
mfe : -15
Hybrid sequence
uUUC-CGUAGU-AUAUCCU-CGACCu
cAAGAGCTACAGCATGGGAGGTTGGt miR-337
Target on HBV subtype adw2 
Binding site 2038-2060
mfe : -15.4
Hybrid sequence
uuuccguaGUAUAUCCUCGACCu
gcaaaataCCTATGGGAGTGGGc miR-339
Target on HBV subtype adw2 
Binding site 1271-1290
mfe : -20.1
Hybrid sequence
aCUCGAGGACCUCC-UGUCCCu
gGAGC-CCT-CAGGCTCAGGGc miR-340
Target on HBV subtype adw2 
Binding site 2793-2827
mfe : -15.3
Hybrid sequence
CCGAUAUUUC-AUUGA-----------CUCUGCcu
GGCTGTACTGCCAACTGGATCCTTCGCGGGACGtc miR-346
Target on HBV subtype adw2 
Binding site 3182-3202
mfe : -15.2
Hybrid sequence
ucUCCGUCCGUACGCCCGUCUgu
ttAGG-AGGC-TGTAGGCACAaa miR-346
Target on HBV subtype adw2 
Binding site 1271-1299
mfe : -17.9
Hybrid sequence
uCUC---CGUCCGUACGCCCGU----CUGu
gGAGCCCTCAGGC-TCAGGGCATATTGACc miR-34a
Target on HBV subtype adw2 
Binding site 213-234
mfe : -14.9
Hybrid sequence
uUGUUGGUCGAUUCUGUGACGgu
tAGAGTCTCCTGAG-CATTGCtc