Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HBV subtype adr4 target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    adr   adyw   unspecified   ayw   adr4   ayw(patient C)   adw2   wildtype    
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 906 rescords (19 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7b18581877-12.4121
UUGGUGUGUUGGAUGAUGGAGU
| |: | |:|| || :|||||
ATCTCCTCGAC--ACCGCCTCA
11.726NO
2hsa-let-7b21702192-16121
uUGGUGUGUU---GGAUGAUGGAGU
||||| ||| || |||:||:|
gACCAC-CAAATGCC-CCTATCTTA
11.726NO
3hsa-let-7e18481877-17.91121
uGAUAUGUU-----GGAG----GAUGGAGU
|||| |:| |||| | :|||||
tCTATTCGAGATCTCCTCGACACCGCCTCA
6.037NO
4hsa-let-7g276301-13121
uGACAUGU---UUGAUGAU--GGAGU
|| | || :||:||| |||||
cCTCTTCATCCTGCTGCTATGCCTCA
9.988NO
5hsa-miR-10026662690-16.1121
GUGU-UCA-AGCCU-AGAUGCCCAa
|||: ||| | | |||::||||
CACGCAGTGCCTCATTCTGTGGGTc
9.137NO
6hsa-miR-100244265-14.9121
GUGUUCAAGCCUAGAUGCC-CAA
|:| :| | | :|||:||| |||
CGCTGGAT-GTGTCTGCGGCGTT
9.137NO
7hsa-miR-105245268-14121
uGUCCU---CAGAC-UCGUAAAcu
| ||| ||||| :||:|||
gCTGGATGTGTCTGCGGCGTTTta
5.000NO
8hsa-miR-106b250268-14.3121
UAGACGUGACAGUCGUGAAAU
|| ||: ||| |:||::||||
ATGTGT-CTG-CGGCGTTTTA
5.784NO
9hsa-miR-10a13741398-12.7121
guguuuAAGCC--UAGAUGUCCCau
| ||| : | ||:|||
tgccgtTCCGGCCGACCACGGGGcg
7.071NO
10hsa-miR-10b5983-14.5121
uguuuaAGC-CAA-G-AUGUCCCAu
||| ||| | :|:||||
ccctgcTCGTGTTACAGGCGGGGTt
6.727NO
11hsa-miR-124a18761899-15.7121
acCG-UAAGUGGCGC-ACGGAAUu
|| | :|:|| | ||||||
caGCTCTATATCGGGAGGCCTTAg
5.000NO
12hsa-miR-12613101329-14.3121
CGUAAUAAUGAGUGCCAUGCU
||: |: | |:||| ||||
GCGCTGAATCCCGCGG-ACGA
10.720NO
13hsa-miR-12727942816-13.7121
ucGGUUCG-AGUCUGCCUAGGcu
||:| | ||| :||| ||
tcCCGATCACCAGTTGGACCCtg
5.000NO
14hsa-miR-128a18951918-17121
uuuUCUC--UGGCCAAGUGACAcu
|||| |||| ||:|||
cttAGAGTCTCCGGAACATTGTtc
5.472NO
15hsa-miR-128b18951918-17121
cuuUCUC--UGGCCAAGUGACAcu
|||| |||| ||:|||
cttAGAGTCTCCGGAACATTGTtc
5.226NO
16hsa-miR-129160183-12.1121
CGUUCGGGU---CUGG--CGUUUUUc
||| |||| | || || ||||
GCA--CCCACGTGTCCTGGCCAAAAt
5.000NO
17hsa-miR-13414301450-19.1121
GGGAGACCAGUUGGUCAGugu
||:||| || :||:|||
CCTTCTCATCTGCCGGTCcgt
5.000NO
18hsa-miR-13627352759-16.2121
AGGU----AGUAGUUUUGUUUACCUCa
|||| ||: |||::| ||||:|
TCCAAACCTCGACAAGGC--ATGGGGa
7.279NO
19hsa-miR-13821472165-12.5121
CUAAGUGU--UGUGGUCGA
|||||:|| | || |||
GATTCGCACTCCTCCTGCT
5.000NO
20hsa-miR-14114351454-13.9121
gGUAGAAAUGGUCUGUCACAau
|||| |:||:| | ||||
tCATC--TGCCGGTCCGTGTgc
5.100NO
21hsa-miR-145833-16.1121
uuCCCUAAGGAC-CCUUUUG-ACCUg
|||: |||| :||| ||||
ctGGGGACCCTGCACCGAACATGGAg
11.062NO
22hsa-miR-14928592880-12.4121
ccucacUUCU-GUGCCUCGGUCU
|:|| ||: | ||||||
ccaacaAGGATCATTG-GCCAGA
5.000NO
23hsa-miR-15017371763-12.7121
gugaccAUGUUC--C-C--AACCCUCu
| |||| | | ||||| |
caagccTCCAAGCTGTGCCTTGGGTGg
7.336NO
24hsa-miR-15019792005-13.31121
GU-GA-CCAUGUUCC---CAACCCUCU
|| || |||: :| | |||| |||
CACCTGGGTGGGAAGTAATTTGGAAGA
7.336NO
25hsa-miR-18722032228-12.2121
GCC---GACG-UUGUGUUCUG-UGCU
||| || | : ::: |||| ||||
CGGAAACTACTGTTGTTAGACGACGA
5.000NO
26hsa-miR-18830423062-18.1121
uGGGAGGUGGUACGUUCCCUac
|:||||||| | :||| ||
tCTCTCCACC-TCTAAGAGAca
5.000NO
27hsa-miR-188314336-13.4121
ugGGAGG--UGGUACGUUCCCUAC
|:||: ||:| ||||| |||
ttCTTCTGGACTA-CCAAGGTATG
5.000NO
28hsa-miR-193b12781308-16121
uuuCGCCCU----GAAAC---UCCCGGUCAa
|||||| ||||| | | || ||
tgcGCGGGACGTCCTTTGTCTACGTCCCGTc
NONO
29hsa-miR-196a21932215-13.9121
gGUUGU--UGUACUUUGAUGgau
||||| | ||||||||
tCAACACTTCCGGAAACTACtgt
NONO
30hsa-miR-196a31673195-13.6121
gGUUGUU--GUAC----UU--UGAUGGAu
||::|| | || :| |||:|||
aCAGTAAACCCTGTTCCGACTACTGCCTc
NONO
31hsa-miR-199b710732-13.1121
cuugucuaucaGAUUUGUGACCC
| ||||::||||
ccctaataaaaCCAAACGTTGGG
5.000NO
32hsa-miR-200a14351454-12.9121
uGUAGCAAUGGUCUGUCACAau
|||| |:||:| | ||||
tCATC--TGCCGGTCCGTGTgc
6.741NO
33hsa-miR-200b30633087-17.02121
CAGUAGUAAU--GGUCCGUCAuaau
|||||| | | ||| |||||
GTCATCCTCAGGCCATGCAGTggaa
5.000NO
34hsa-miR-21412371256-13121
GACGGACAGACACGGACGAca
|| ||| || || |||||
CT-CCTTTCCATGGCTGCTag
8.407NO
35hsa-miR-214875895-14.2121
gaCGGACAGACAC-GGACGACa
|:|| |:|| | ::|||||
ggGTCT-TTTGGGCTTTGCTGc
8.407NO
36hsa-miR-22410601088-17.9121
auuUGCCUU---GGUGAU---CACUGAAC
||| || |||||: | |:||||
ctgACGCAACCCCCACTGGATGGGGCTTG
7.182NO
37hsa-miR-2529622988-18.1121
AGUCUGGC-U--CUGUU--CACGUUac
||||: || | ||||| |||| |
TCAGGGCGTATTGACAACCGTGCCAgt
9.003NO
38hsa-miR-29615961622-19.16121
ugUCCUAA--CUCC----CCCCCggga
|||| | |||| |||||
taAGGACTGGGAGGAGTTGGGGGagga
7.400NO
39hsa-miR-324-3p28592882-13.2121
GGUCG-UCGUGG-ACCCCGUCACC
||| | || |:| | || ||| ||
CCAACAAGGATCATTGGCCAGAGG
NONO
40hsa-miR-324-5p17411765-17.34121
uGUGGUU----ACGGGAUCCCCUACGc
| |||| ||||:| ||| ||
cCTCCAAGCTGTGCCTT--GGGTGGCt
NONO
41hsa-miR-326151171-14.82121
GACCUCCUUCCCGGGU-CUCc
|| |:||:|| |||| | |
CTAGGGGGAGCACCCACGTGt
NONO
42hsa-miR-33727072732-15121
uUUC-CGUAGU-AUAUCCU-CGACCu
||| || || ||:||| |:|||
cAAGAGCTACAGCATGGGAGGTTGGt
NONO
43hsa-miR-33926232644-17.1121
acucGAGG-ACCUCCUGUCCcu
|||: |||| |:|:||
cataCTCTGTGGAAGGCGGGca
NONO
44hsa-miR-34512891312-13.4121
cGGGACCUGAUCC---UCAGUCGu
||:| | ||| | |||:||
tCCTTTGTCTACGTCCCGTCGGCg
NONO
45hsa-miR-34622142236-14121
ucuCCGUCCGUACGC-CCGUCugu
| :|| |: || |||||
gttGTTAGACG-ACGAGGCAGgtc
NONO
46hsa-miR-34616451665-14.5121
ucUCCGUCCGUACGCCCGUCUgu
||| |||| ||: |||| |
ctAGG-AGGC-TGTAGGCATAaa
NONO
47hsa-miR-34a904924-12.2121
uUGUUG-GUCGAUUCUGUGACGGu
||||: ::|||| | |||||
cACAATGTGGCTA--TC-CTGCCt
7.376NO
48hsa-miR-34b10321052-14121
GUUAGUCGAUUACUGUGACGGau
||| |:| | | | | |||||
CAA-CGG-TCAGGTCTCTGCCaa
7.593NO
49hsa-miR-363*14821506-14.7121
uuuaacGUAGCACU---AGGUGGgc
|| ||||| |||||
ggagacCACCGTGAACGCCCACCag
NONO
50hsa-miR-369-5p27082734-13.9121
cgCUU-AUAUUGUG----CCAGCUAGA
||: || |:||: |||:|:|||
aaGAGCTACAGCATGGGAGGTTGGTCT
NONO
let-7b
Target on HBV subtype adr4 
Binding site 1858-1877
mfe : -12.4
Hybrid sequence
UUGGUGUGUUGGAUGAUGGAGU
ATCTCCTCGAC--ACCGCCTCA let-7b
Target on HBV subtype adr4 
Binding site 2170-2192
mfe : -16
Hybrid sequence
uUGGUGUGUU---GGAUGAUGGAGU
gACCAC-CAAATGCC-CCTATCTTA let-7e
Target on HBV subtype adr4 
Binding site 1848-1877
mfe : -17.91
Hybrid sequence
uGAUAUGUU-----GGAG----GAUGGAGU
tCTATTCGAGATCTCCTCGACACCGCCTCA let-7g
Target on HBV subtype adr4 
Binding site 276-301
mfe : -13
Hybrid sequence
uGACAUGU---UUGAUGAU--GGAGU
cCTCTTCATCCTGCTGCTATGCCTCA miR-100
Target on HBV subtype adr4 
Binding site 2666-2690
mfe : -16.1
Hybrid sequence
GUGU-UCA-AGCCU-AGAUGCCCAa
CACGCAGTGCCTCATTCTGTGGGTc miR-100
Target on HBV subtype adr4 
Binding site 244-265
mfe : -14.9
Hybrid sequence
GUGUUCAAGCCUAGAUGCC-CAA
CGCTGGAT-GTGTCTGCGGCGTT miR-105
Target on HBV subtype adr4 
Binding site 245-268
mfe : -14
Hybrid sequence
uGUCCU---CAGAC-UCGUAAAcu
gCTGGATGTGTCTGCGGCGTTTta miR-106b
Target on HBV subtype adr4 
Binding site 250-268
mfe : -14.3
Hybrid sequence
UAGACGUGACAGUCGUGAAAU
ATGTGT-CTG-CGGCGTTTTA miR-10a
Target on HBV subtype adr4 
Binding site 1374-1398
mfe : -12.7
Hybrid sequence
guguuuAAGCC--UAGAUGUCCCau
tgccgtTCCGGCCGACCACGGGGcg miR-10b
Target on HBV subtype adr4 
Binding site 59-83
mfe : -14.5
Hybrid sequence
uguuuaAGC-CAA-G-AUGUCCCAu
ccctgcTCGTGTTACAGGCGGGGTt miR-124a
Target on HBV subtype adr4 
Binding site 1876-1899
mfe : -15.7
Hybrid sequence
acCG-UAAGUGGCGC-ACGGAAUu
caGCTCTATATCGGGAGGCCTTAg miR-126
Target on HBV subtype adr4 
Binding site 1310-1329
mfe : -14.3
Hybrid sequence
CGUAAUAAUGAGUGCCAUGCU
GCGCTGAATCCCGCGG-ACGA miR-127
Target on HBV subtype adr4 
Binding site 2794-2816
mfe : -13.7
Hybrid sequence
ucGGUUCG-AGUCUGCCUAGGcu
tcCCGATCACCAGTTGGACCCtg miR-128a
Target on HBV subtype adr4 
Binding site 1895-1918
mfe : -17
Hybrid sequence
uuuUCUC--UGGCCAAGUGACAcu
cttAGAGTCTCCGGAACATTGTtc miR-128b
Target on HBV subtype adr4 
Binding site 1895-1918
mfe : -17
Hybrid sequence
cuuUCUC--UGGCCAAGUGACAcu
cttAGAGTCTCCGGAACATTGTtc miR-129
Target on HBV subtype adr4 
Binding site 160-183
mfe : -12.1
Hybrid sequence
CGUUCGGGU---CUGG--CGUUUUUc
GCA--CCCACGTGTCCTGGCCAAAAt miR-134
Target on HBV subtype adr4 
Binding site 1430-1450
mfe : -19.1
Hybrid sequence
GGGAGACCAGUUGGUCAGugu
CCTTCTCATCTGCCGGTCcgt miR-136
Target on HBV subtype adr4 
Binding site 2735-2759
mfe : -16.2
Hybrid sequence
AGGU----AGUAGUUUUGUUUACCUCa
TCCAAACCTCGACAAGGC--ATGGGGa miR-138
Target on HBV subtype adr4 
Binding site 2147-2165
mfe : -12.5
Hybrid sequence
CUAAGUGU--UGUGGUCGA
GATTCGCACTCCTCCTGCT miR-141
Target on HBV subtype adr4 
Binding site 1435-1454
mfe : -13.9
Hybrid sequence
gGUAGAAAUGGUCUGUCACAau
tCATC--TGCCGGTCCGTGTgc miR-145
Target on HBV subtype adr4 
Binding site 8-33
mfe : -16.1
Hybrid sequence
uuCCCUAAGGAC-CCUUUUG-ACCUg
ctGGGGACCCTGCACCGAACATGGAg miR-149
Target on HBV subtype adr4 
Binding site 2859-2880
mfe : -12.4
Hybrid sequence
ccucacUUCU-GUGCCUCGGUCU
ccaacaAGGATCATTG-GCCAGA miR-150
Target on HBV subtype adr4 
Binding site 1737-1763
mfe : -12.7
Hybrid sequence
gugaccAUGUUC--C-C--AACCCUCu
caagccTCCAAGCTGTGCCTTGGGTGg miR-150
Target on HBV subtype adr4 
Binding site 1979-2005
mfe : -13.31
Hybrid sequence
GU-GA-CCAUGUUCC---CAACCCUCU
CACCTGGGTGGGAAGTAATTTGGAAGA miR-187
Target on HBV subtype adr4 
Binding site 2203-2228
mfe : -12.2
Hybrid sequence
GCC---GACG-UUGUGUUCUG-UGCU
CGGAAACTACTGTTGTTAGACGACGA miR-188
Target on HBV subtype adr4 
Binding site 3042-3062
mfe : -18.1
Hybrid sequence
uGGGAGGUGGUACGUUCCCUac
tCTCTCCACC-TCTAAGAGAca miR-188
Target on HBV subtype adr4 
Binding site 314-336
mfe : -13.4
Hybrid sequence
ugGGAGG--UGGUACGUUCCCUAC
ttCTTCTGGACTA-CCAAGGTATG miR-193b
Target on HBV subtype adr4 
Binding site 1278-1308
mfe : -16
Hybrid sequence
uuuCGCCCU----GAAAC---UCCCGGUCAa
tgcGCGGGACGTCCTTTGTCTACGTCCCGTc miR-196a
Target on HBV subtype adr4 
Binding site 2193-2215
mfe : -13.9
Hybrid sequence
gGUUGU--UGUACUUUGAUGgau
tCAACACTTCCGGAAACTACtgt miR-196a
Target on HBV subtype adr4 
Binding site 3167-3195
mfe : -13.6
Hybrid sequence
gGUUGUU--GUAC----UU--UGAUGGAu
aCAGTAAACCCTGTTCCGACTACTGCCTc miR-199b
Target on HBV subtype adr4 
Binding site 710-732
mfe : -13.1
Hybrid sequence
cuugucuaucaGAUUUGUGACCC
ccctaataaaaCCAAACGTTGGG miR-200a
Target on HBV subtype adr4 
Binding site 1435-1454
mfe : -12.9
Hybrid sequence
uGUAGCAAUGGUCUGUCACAau
tCATC--TGCCGGTCCGTGTgc miR-200b
Target on HBV subtype adr4 
Binding site 3063-3087
mfe : -17.02
Hybrid sequence
CAGUAGUAAU--GGUCCGUCAuaau
GTCATCCTCAGGCCATGCAGTggaa miR-214
Target on HBV subtype adr4 
Binding site 1237-1256
mfe : -13
Hybrid sequence
GACGGACAGACACGGACGAca
CT-CCTTTCCATGGCTGCTag miR-214
Target on HBV subtype adr4 
Binding site 875-895
mfe : -14.2
Hybrid sequence
gaCGGACAGACAC-GGACGACa
ggGTCT-TTTGGGCTTTGCTGc miR-224
Target on HBV subtype adr4 
Binding site 1060-1088
mfe : -17.9
Hybrid sequence
auuUGCCUU---GGUGAU---CACUGAAC
ctgACGCAACCCCCACTGGATGGGGCTTG miR-25
Target on HBV subtype adr4 
Binding site 2962-2988
mfe : -18.1
Hybrid sequence
AGUCUGGC-U--CUGUU--CACGUUac
TCAGGGCGTATTGACAACCGTGCCAgt miR-296
Target on HBV subtype adr4 
Binding site 1596-1622
mfe : -19.16
Hybrid sequence
ugUCCUAA--CUCC----CCCCCggga
taAGGACTGGGAGGAGTTGGGGGagga miR-324-3p
Target on HBV subtype adr4 
Binding site 2859-2882
mfe : -13.2
Hybrid sequence
GGUCG-UCGUGG-ACCCCGUCACC
CCAACAAGGATCATTGGCCAGAGG miR-324-5p
Target on HBV subtype adr4 
Binding site 1741-1765
mfe : -17.34
Hybrid sequence
uGUGGUU----ACGGGAUCCCCUACGc
cCTCCAAGCTGTGCCTT--GGGTGGCt miR-326
Target on HBV subtype adr4 
Binding site 151-171
mfe : -14.82
Hybrid sequence
GACCUCCUUCCCGGGU-CUCc
CTAGGGGGAGCACCCACGTGt miR-337
Target on HBV subtype adr4 
Binding site 2707-2732
mfe : -15
Hybrid sequence
uUUC-CGUAGU-AUAUCCU-CGACCu
cAAGAGCTACAGCATGGGAGGTTGGt miR-339
Target on HBV subtype adr4 
Binding site 2623-2644
mfe : -17.1
Hybrid sequence
acucGAGG-ACCUCCUGUCCcu
cataCTCTGTGGAAGGCGGGca miR-345
Target on HBV subtype adr4 
Binding site 1289-1312
mfe : -13.4
Hybrid sequence
cGGGACCUGAUCC---UCAGUCGu
tCCTTTGTCTACGTCCCGTCGGCg miR-346
Target on HBV subtype adr4 
Binding site 2214-2236
mfe : -14
Hybrid sequence
ucuCCGUCCGUACGC-CCGUCugu
gttGTTAGACG-ACGAGGCAGgtc miR-346
Target on HBV subtype adr4 
Binding site 1645-1665
mfe : -14.5
Hybrid sequence
ucUCCGUCCGUACGCCCGUCUgu
ctAGG-AGGC-TGTAGGCATAaa miR-34a
Target on HBV subtype adr4 
Binding site 904-924
mfe : -12.2
Hybrid sequence
uUGUUG-GUCGAUUCUGUGACGGu
cACAATGTGGCTA--TC-CTGCCt miR-34b
Target on HBV subtype adr4 
Binding site 1032-1052
mfe : -14
Hybrid sequence
GUUAGUCGAUUACUGUGACGGau
CAA-CGG-TCAGGTCTCTGCCaa miR-363*
Target on HBV subtype adr4 
Binding site 1482-1506
mfe : -14.7
Hybrid sequence
uuuaacGUAGCACU---AGGUGGgc
ggagacCACCGTGAACGCCCACCag miR-369-5p
Target on HBV subtype adr4 
Binding site 2708-2734
mfe : -13.9
Hybrid sequence
cgCUU-AUAUUGUG----CCAGCUAGA
aaGAGCTACAGCATGGGAGGTTGGTCT