Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HBV subtype ayw target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    adr   adyw   unspecified   ayw   adr4   ayw(patient C)   adw2   wildtype    
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 881 rescords (18 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-miR-122a19982018-15.1121
uGUUUGUGGUAACAGUGUGAGGu
||||||| ||| |||| ||
gCAAACAC--TTGGCACAGACCt
12.384NO
2hsa-miR-122a169191-13121
ugUUUGUGGUAACAG---UGUGAGGU
|||| ||| | | |::|||||
tgAAAC-CCA--GCCCGAATGCTCCA
12.384NO
3hsa-miR-124a11011122-12.6121
accguaagUGGCGCACGGAAUu
|::|| ||||| |
agcaaagaATTGCTTGCCTGAg
5.000NO
4hsa-miR-12717981819-16.6121
UCGGUUCGAGUC--UGCCUAGGCU
|||| || ||| |:||| |||
AGCCTAG--CAGCCATGGAAACGA
5.000NO
5hsa-miR-13414411460-12.42121
GGG-AGACCAGUUGGUCAGugu
||| || || ||||||
CCCAACTCCTC--CCAGTCttt
5.000NO
6hsa-miR-13624802502-12.12121
aGGUAGUAGUUUUGUUUACCuca
| | | | :|||||||||
aCGAACCACTGAACAAATGGcac
7.279NO
7hsa-miR-14717611780-12.8121
cGUCUUCGUAAAGGUGUGUg
|| |:| | ||:|:||
aCAAAGGACGTCCCGCGCAg
5.000NO
8hsa-miR-18228612886-12.2121
acACUCAAGAUGGU----AACGGUUu
||:| ||:| | | |||||
gtTGGGGACTGCGAATTTTGGCCAAg
5.000NO
9hsa-miR-193b21332168-14.7121
UUUCGCCC------UGAAAC------UCCCGGUCaa
|| || || || ||| |||| |||
AACGCAGGATAACCACATTGTGTAAAAGGGGCAGca
NONO
10hsa-miR-193b16501674-12.6121
UUUCGCCCUGAAACUC-CCGGUCAa
|:|| || :| | ||:|:||
AGAGAGGTGCGCCCCGTGGTCGGTc
NONO
11hsa-miR-196a4365-17.1121
gguUGUUGUAC--UUUGAUGGAu
|||:|: | |::||:|||
gagACAGCGGGGTAGGCTGCCTt
NONO
12hsa-miR-200a842863-16.2121
UGU-AGCAAUGGUCUGUCACAAu
||| | || || |: ||||||
ACAGTAGTCTCC-GGAAGTGTTg
6.741NO
13hsa-miR-20531603177-20.4121
GUCUGAGGCCACCUUACUUCCu
|||| |::|||| |||||
CAGAGTTTGGTG----GAAGGt
5.000NO
14hsa-miR-2111343-18.8121
uCC-GCUUCCUACU--------GUUUCCcuu
|| | :||||||| ||||||
tGGCCTGAGGATGAGTGTTTCTCAAAGGtgg
5.593NO
15hsa-miR-211796823-23.5121
UCCGCUUCCUAC-------UGUUUCCCUu
||||||:||| | | |:||||
AGGCGAGGGA-GTTCTTCTTCTAGGGGAc
5.593NO
16hsa-miR-21314781499-15121
cCAUGU-UAGUUGCCAGCUACCA
|||:: |||| |||||:| ||
aGTATGCCTCAA-GGTCGGTCGT
5.701NO
17hsa-miR-22217971826-16.53121
cUCUGGGUCAUCGGU-------CUACAUcga
|| ||:|| ||||| ||||||
cAG-CCTAGCAGCCATGGAAACGATGTAtat
5.000NO
18hsa-miR-24195217-17.1121
gacaaGGACGAC--UUGACUCGGU
|:||:|| : ||| ||||
cctacCTTGTTGGCGTCTG-GCCA
11.006NO
19hsa-miR-33712991321-15.3121
uUUCCGUAGUAUAUCCU-CGACCU
|||||| || | ||| ||| ||
cAAGGCA-CAGCTTGGAGGCTTGA
NONO
20hsa-miR-34531053124-17.2121
cgGGACCUGAUCCUCAGUCGU
|||| ||| |||| || ||
ttCCTGAACT-GGAGCCACCA
NONO
21hsa-miR-37317681800-17.6121
UGU-GGG---GUUUUAG------CUUCGUGaag
||: ||| ||::||| | |||||
ACGTCCCGCGCAGGATCCAGTTGGCAGCACagc
NONO
22hsa-miR-7837854-14.5121
gUUGUUUUAGUGAUCAGAAGGu
||||| || ||||| |||
tAACAA---CAGTAGTC-TCCg
5.000NO
23hsa-miR-38224702491-16.1121
gCUUAGGUGGUGCUUGUUGAag
||| | |:|||||| |||
gGAAAGCCCTACGAACCACTga
NONO
24hsa-miR-38331383157-14.4121
uCGGUGUUAGUGGAAGA--CUAGA
||| | |||| ||| |||||
gGCCTC--TCAC--TCTGGGATCT
NONO
25hsa-miR-42514901512-19121
CC-GCCUGU-GCUGUAAGGGCUa
|| ||| |: :|||||| |:||
GGTCGGTCGTTGACATTGCTGAg
NONO
26hsa-miR-45512121233-12.36121
gcUACAUCAGGUUUCCGUGUau
| | |||| :|||||| |
gaAAGAAGTCAGAAGGCAAAaa
NONO
27hsa-miR-50530043024-12.1121
cUCCUUUGGUCGUUCACAACug
||||| || | | ||| ||
tAGGAATCCTG-ATGTGATGtt
NONO
28hsa-miR-50918351857-13121
agaugGGUGUCUGCAUGGUUAGu
| ||||| ||:||:||
taggaCAACAGAGTTATCAGTCc
NONO
29hsa-miR-510972998-12.12121
ACACUAACGGUG-----AGAGGACUcau
||||| |||| |: |||||
TGTGA-AACCACAAGAGTTGCCTGAact
NONO
30hsa-miR-518a24612481-13.8121
agGUCGUUUCCCUUCGCGAaa
|||::::|| |||| ||
aaCAGTGGGGGAAAGCCCTac
NONO
31hsa-miR-518e15811602-13.16121
UGUGAGACUUCCCUUCGCgaaa
||:: | ||:| ||||||
ACGTGCAGAGGTGAAGCGaagt
NONO
32hsa-miR-518f16411664-18.96121
AGGAG-AUUUCUCU--UCGCGaaa
||| | |||||||| ||||
TCCGCGTAAAGAGAGGTGCGCccc
NONO
33hsa-miR-520a*451481-14.2121
uCUUUCAU---GAA--GG-----GAGACCUc
|:||||| || |: :||||||
tGGAAGTAATGATTAACTAGATGTTCTGGAt
NONO
34hsa-miR-526b696721-14.2121
uuGUC-UUUCACGAAG-GGAGUUCUC
||| ||||| | | |||:| |||
ccCAGTAAAGTTCCCCACCTTATGAG
NONO
35hsa-miR-542-5p30093030-16.8121
gAGCACUGUACUACUAGGGGcu
|| |||::||||| ||:||
aTCCTGATGTGATGTTCTCCat
NONO
36hsa-miR-928052825-18.2121
aGUAUGUCGAUCUAUUGGUuucu
||| |||| ||||||||
aCATCCAGC--GATAACCAggac
5.114NO
37hsa-miR-10129272953-14122
gaagUCA-AU---AG-UGUCAUGACAu
||| || || :|:|||:|||
cacgAGTCTAGACTCTGCGGTATTGTg
9.992NO
38hsa-miR-125b20322053-12.4122
agUGUUCAAUCCCAGAGUCCcu
||::| || | :|||||
caACGGGGTAAAGGTTCAGGta
10.846NO
39hsa-miR-132532-13.3122
GCUG--GUACC-GACAU---CUGACAAu
| || ||||| ||| : || ||||
CCACTGCATGGCCTGAGGATGAGTGTTt
5.000NO
40hsa-miR-135b24592483-12.7122
GUGUAUCCUUACUUUUCGGUAU---
|| | || :: |:|||||| ||
CAAACAGTGGGGGAAAGCCCTACGA
NONO
41hsa-miR-145228252-14.9122
uuCCCUAAGGAC-CCUUUUGACCUg
|||||| | || |||||
ttGGGATTGAAGTCCCAATCTGGAt
11.062NO
42hsa-miR-148a15851609-12.32122
uGUUUCAA----GACAUCACGUGacu
||:|| | | | |||||||
gCAGAGGTGAAGC-GAAGTGCACacg
NONO
43hsa-miR-18220092031-16.2122
acacUCAAGA-UGGUAACGGuuu
|| || :||:|||||
gcacAGACCTGGCCGTTGCCggg
5.000NO
44hsa-miR-18311031129-12122
GUCACUUAA--GAUGG--UCACGGUAU
|| ||||| :|:|| ||||| :||
CAAAGAATTGCTTGCCTGAGTGCAGTA
5.000NO
45hsa-miR-184197217-15.8122
ugGGAAUAGUCAAG-AGGCAGGU
||||:|::| | ||:| |||
taCCTTGTTGG--CGTCTGGCCA
5.000NO
46hsa-miR-197864889-13.14122
cgaCCCA-CCUCUU---CCACCAcuu
|| | ||:| | ||||||
ataGGATAGGGGCATTTGGTGGTcta
6.957NO
47hsa-miR-199a*18581885-12.8122
uuggUUAC--AC---GUCU-GAUGACau
|||| || |||| ||:|||
cgatAATGTTTGCTCCAGACCTGCTGcg
9.369NO
48hsa-miR-20426982720-13.3122
uCCGUAUCCUACUGUUU-CCCuu
|| || || |||||| |||
tGGAATTAGAGGACAAACGGGca
5.379NO
49hsa-miR-20430543077-14.7122
uccguaUCCUACUG--UUUCCCUu
|| |||| ||||||
tcgagaAGATTGACGATAAGGGAg
5.379NO
50hsa-miR-20b366389-14.5122
gaUGGACGUGAUACU-CGUGAAAC
||| || |||| ||:|| ||
tgACCCACAAAATGAGGCGCTATG
NONO
miR-122a
Target on HBV subtype ayw 
Binding site 1998-2018
mfe : -15.1
Hybrid sequence
uGUUUGUGGUAACAGUGUGAGGu
gCAAACAC--TTGGCACAGACCt miR-122a
Target on HBV subtype ayw 
Binding site 169-191
mfe : -13
Hybrid sequence
ugUUUGUGGUAACAG---UGUGAGGU
tgAAAC-CCA--GCCCGAATGCTCCA miR-124a
Target on HBV subtype ayw 
Binding site 1101-1122
mfe : -12.6
Hybrid sequence
accguaagUGGCGCACGGAAUu
agcaaagaATTGCTTGCCTGAg miR-127
Target on HBV subtype ayw 
Binding site 1798-1819
mfe : -16.6
Hybrid sequence
UCGGUUCGAGUC--UGCCUAGGCU
AGCCTAG--CAGCCATGGAAACGA miR-134
Target on HBV subtype ayw 
Binding site 1441-1460
mfe : -12.42
Hybrid sequence
GGG-AGACCAGUUGGUCAGugu
CCCAACTCCTC--CCAGTCttt miR-136
Target on HBV subtype ayw 
Binding site 2480-2502
mfe : -12.12
Hybrid sequence
aGGUAGUAGUUUUGUUUACCuca
aCGAACCACTGAACAAATGGcac miR-147
Target on HBV subtype ayw 
Binding site 1761-1780
mfe : -12.8
Hybrid sequence
cGUCUUCGUAAAGGUGUGUg
aCAAAGGACGTCCCGCGCAg miR-182
Target on HBV subtype ayw 
Binding site 2861-2886
mfe : -12.2
Hybrid sequence
acACUCAAGAUGGU----AACGGUUu
gtTGGGGACTGCGAATTTTGGCCAAg miR-193b
Target on HBV subtype ayw 
Binding site 2133-2168
mfe : -14.7
Hybrid sequence
UUUCGCCC------UGAAAC------UCCCGGUCaa
AACGCAGGATAACCACATTGTGTAAAAGGGGCAGca miR-193b
Target on HBV subtype ayw 
Binding site 1650-1674
mfe : -12.6
Hybrid sequence
UUUCGCCCUGAAACUC-CCGGUCAa
AGAGAGGTGCGCCCCGTGGTCGGTc miR-196a
Target on HBV subtype ayw 
Binding site 43-65
mfe : -17.1
Hybrid sequence
gguUGUUGUAC--UUUGAUGGAu
gagACAGCGGGGTAGGCTGCCTt miR-200a
Target on HBV subtype ayw 
Binding site 842-863
mfe : -16.2
Hybrid sequence
UGU-AGCAAUGGUCUGUCACAAu
ACAGTAGTCTCC-GGAAGTGTTg miR-205
Target on HBV subtype ayw 
Binding site 3160-3177
mfe : -20.4
Hybrid sequence
GUCUGAGGCCACCUUACUUCCu
CAGAGTTTGGTG----GAAGGt miR-211
Target on HBV subtype ayw 
Binding site 13-43
mfe : -18.8
Hybrid sequence
uCC-GCUUCCUACU--------GUUUCCcuu
tGGCCTGAGGATGAGTGTTTCTCAAAGGtgg miR-211
Target on HBV subtype ayw 
Binding site 796-823
mfe : -23.5
Hybrid sequence
UCCGCUUCCUAC-------UGUUUCCCUu
AGGCGAGGGA-GTTCTTCTTCTAGGGGAc miR-213
Target on HBV subtype ayw 
Binding site 1478-1499
mfe : -15
Hybrid sequence
cCAUGU-UAGUUGCCAGCUACCA
aGTATGCCTCAA-GGTCGGTCGT miR-222
Target on HBV subtype ayw 
Binding site 1797-1826
mfe : -16.53
Hybrid sequence
cUCUGGGUCAUCGGU-------CUACAUcga
cAG-CCTAGCAGCCATGGAAACGATGTAtat miR-24
Target on HBV subtype ayw 
Binding site 195-217
mfe : -17.1
Hybrid sequence
gacaaGGACGAC--UUGACUCGGU
cctacCTTGTTGGCGTCTG-GCCA miR-337
Target on HBV subtype ayw 
Binding site 1299-1321
mfe : -15.3
Hybrid sequence
uUUCCGUAGUAUAUCCU-CGACCU
cAAGGCA-CAGCTTGGAGGCTTGA miR-345
Target on HBV subtype ayw 
Binding site 3105-3124
mfe : -17.2
Hybrid sequence
cgGGACCUGAUCCUCAGUCGU
ttCCTGAACT-GGAGCCACCA miR-373
Target on HBV subtype ayw 
Binding site 1768-1800
mfe : -17.6
Hybrid sequence
UGU-GGG---GUUUUAG------CUUCGUGaag
ACGTCCCGCGCAGGATCCAGTTGGCAGCACagc miR-7
Target on HBV subtype ayw 
Binding site 837-854
mfe : -14.5
Hybrid sequence
gUUGUUUUAGUGAUCAGAAGGu
tAACAA---CAGTAGTC-TCCg miR-382
Target on HBV subtype ayw 
Binding site 2470-2491
mfe : -16.1
Hybrid sequence
gCUUAGGUGGUGCUUGUUGAag
gGAAAGCCCTACGAACCACTga miR-383
Target on HBV subtype ayw 
Binding site 3138-3157
mfe : -14.4
Hybrid sequence
uCGGUGUUAGUGGAAGA--CUAGA
gGCCTC--TCAC--TCTGGGATCT miR-425
Target on HBV subtype ayw 
Binding site 1490-1512
mfe : -19
Hybrid sequence
CC-GCCUGU-GCUGUAAGGGCUa
GGTCGGTCGTTGACATTGCTGAg miR-455
Target on HBV subtype ayw 
Binding site 1212-1233
mfe : -12.36
Hybrid sequence
gcUACAUCAGGUUUCCGUGUau
gaAAGAAGTCAGAAGGCAAAaa miR-505
Target on HBV subtype ayw 
Binding site 3004-3024
mfe : -12.1
Hybrid sequence
cUCCUUUGGUCGUUCACAACug
tAGGAATCCTG-ATGTGATGtt miR-509
Target on HBV subtype ayw 
Binding site 1835-1857
mfe : -13
Hybrid sequence
agaugGGUGUCUGCAUGGUUAGu
taggaCAACAGAGTTATCAGTCc miR-510
Target on HBV subtype ayw 
Binding site 972-998
mfe : -12.12
Hybrid sequence
ACACUAACGGUG-----AGAGGACUcau
TGTGA-AACCACAAGAGTTGCCTGAact miR-518a
Target on HBV subtype ayw 
Binding site 2461-2481
mfe : -13.8
Hybrid sequence
agGUCGUUUCCCUUCGCGAaa
aaCAGTGGGGGAAAGCCCTac miR-518e
Target on HBV subtype ayw 
Binding site 1581-1602
mfe : -13.16
Hybrid sequence
UGUGAGACUUCCCUUCGCgaaa
ACGTGCAGAGGTGAAGCGaagt miR-518f
Target on HBV subtype ayw 
Binding site 1641-1664
mfe : -18.96
Hybrid sequence
AGGAG-AUUUCUCU--UCGCGaaa
TCCGCGTAAAGAGAGGTGCGCccc miR-520a*
Target on HBV subtype ayw 
Binding site 451-481
mfe : -14.2
Hybrid sequence
uCUUUCAU---GAA--GG-----GAGACCUc
tGGAAGTAATGATTAACTAGATGTTCTGGAt miR-526b
Target on HBV subtype ayw 
Binding site 696-721
mfe : -14.2
Hybrid sequence
uuGUC-UUUCACGAAG-GGAGUUCUC
ccCAGTAAAGTTCCCCACCTTATGAG miR-542-5p
Target on HBV subtype ayw 
Binding site 3009-3030
mfe : -16.8
Hybrid sequence
gAGCACUGUACUACUAGGGGcu
aTCCTGATGTGATGTTCTCCat miR-9
Target on HBV subtype ayw 
Binding site 2805-2825
mfe : -18.2
Hybrid sequence
aGUAUGUCGAUCUAUUGGUuucu
aCATCCAGC--GATAACCAggac miR-101
Target on HBV subtype ayw 
Binding site 2927-2953
mfe : -14
Hybrid sequence
gaagUCA-AU---AG-UGUCAUGACAu
cacgAGTCTAGACTCTGCGGTATTGTg miR-125b
Target on HBV subtype ayw 
Binding site 2032-2053
mfe : -12.4
Hybrid sequence
agUGUUCAAUCCCAGAGUCCcu
caACGGGGTAAAGGTTCAGGta miR-132
Target on HBV subtype ayw 
Binding site 5-32
mfe : -13.3
Hybrid sequence
GCUG--GUACC-GACAU---CUGACAAu
CCACTGCATGGCCTGAGGATGAGTGTTt miR-135b
Target on HBV subtype ayw 
Binding site 2459-2483
mfe : -12.7
Hybrid sequence
GUGUAUCCUUACUUUUCGGUAU---
CAAACAGTGGGGGAAAGCCCTACGA miR-145
Target on HBV subtype ayw 
Binding site 228-252
mfe : -14.9
Hybrid sequence
uuCCCUAAGGAC-CCUUUUGACCUg
ttGGGATTGAAGTCCCAATCTGGAt miR-148a
Target on HBV subtype ayw 
Binding site 1585-1609
mfe : -12.32
Hybrid sequence
uGUUUCAA----GACAUCACGUGacu
gCAGAGGTGAAGC-GAAGTGCACacg miR-182
Target on HBV subtype ayw 
Binding site 2009-2031
mfe : -16.2
Hybrid sequence
acacUCAAGA-UGGUAACGGuuu
gcacAGACCTGGCCGTTGCCggg miR-183
Target on HBV subtype ayw 
Binding site 1103-1129
mfe : -12
Hybrid sequence
GUCACUUAA--GAUGG--UCACGGUAU
CAAAGAATTGCTTGCCTGAGTGCAGTA miR-184
Target on HBV subtype ayw 
Binding site 197-217
mfe : -15.8
Hybrid sequence
ugGGAAUAGUCAAG-AGGCAGGU
taCCTTGTTGG--CGTCTGGCCA miR-197
Target on HBV subtype ayw 
Binding site 864-889
mfe : -13.14
Hybrid sequence
cgaCCCA-CCUCUU---CCACCAcuu
ataGGATAGGGGCATTTGGTGGTcta miR-199a*
Target on HBV subtype ayw 
Binding site 1858-1885
mfe : -12.8
Hybrid sequence
uuggUUAC--AC---GUCU-GAUGACau
cgatAATGTTTGCTCCAGACCTGCTGcg miR-204
Target on HBV subtype ayw 
Binding site 2698-2720
mfe : -13.3
Hybrid sequence
uCCGUAUCCUACUGUUU-CCCuu
tGGAATTAGAGGACAAACGGGca miR-204
Target on HBV subtype ayw 
Binding site 3054-3077
mfe : -14.7
Hybrid sequence
uccguaUCCUACUG--UUUCCCUu
tcgagaAGATTGACGATAAGGGAg miR-20b
Target on HBV subtype ayw 
Binding site 366-389
mfe : -14.5
Hybrid sequence
gaUGGACGUGAUACU-CGUGAAAC
tgACCCACAAAATGAGGCGCTATG