Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HBV wildtype target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    adr   adyw   unspecified   ayw   adr4   ayw(patient C)   adw2   wildtype    
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 1075 rescords (22 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-miR-491110-11.1124
aggaguaccuucccaAGG-GGUGA
||| |||||
--------------cTCCACCACT
NONO
2hsa-miR-4321330-16.8145
GGUGGGUUACUGGAUGAGGUUCU
||||| || || ||:|||||
CCACCAAA----CT-CTTCAAGA
NONO
3hsa-miR-542-5p1637-10.7131
gagcacuGUACUACUAGGGGCU
| | | |||||| ||
ccaaactCTTCAAGATCCCAGA
NONO
4hsa-miR-4921747-11.5138
uUCUUAGAA---C-AGGG---C-GUCCAGGa
| | |||| | |||| | |||| ||
cAAACTCTTCAAGATCCCAGAGTCAGGGCCc
NONO
5hsa-miR-518c*1739-12.4128
gucuuucacgaagggaGGUCUCu
||||||
caaactcttcaagatcCCAGAGt
NONO
6hsa-miR-3701944-14.8121
gguccAAG--GUGGGGUC---GUCCg
||| |:||||| ||||
aactcTTCAAGATCCCAGAGTCAGGg
NONO
7hsa-miR-3262039-12.3160
gaccuccUUCCCGGGUCUCc
||| |||||||
actcttcAAGATCCCAGAGt
NONO
8hsa-miR-1492143-12.3145
ccucACUUCU-GUGCCUCGGUCu
| |||| | | |||:|||
ctctTCAAGATCCCAGAGTCAGg
5.000NO
9hsa-miR-125b2345-10.73134
aguGUUCAA---UCCCAGAGUCCCu
|||| | || | ||||||
cttCAAGATCCCAGAG--TCAGGGc
10.846NO
10hsa-miR-3782345-17.7153
uguGUCCU-GGACCUCAGUCCuc
|| || || ||||||||
cttCAAGATCCCAGAGTCAGGgc
NONO
11hsa-miR-3312446-15125
AAGAUCCUA---UCCGGGUCCCcg
||| | ||| || :|||||
TTC-AAGATCCCAGAGTCAGGGcc
NONO
12hsa-miR-3452444-11.4126
cgggaccugaucCUCAGUCgu
|||||||
ttcaagatcccaGAGTCAGgg
NONO
13hsa-miR-2962548-16.5152
uGUCCUA---ACUCCCCCCCGGGA
|| ||| ||| |||||||
tCAAGATCCCAGAGTCAGGGCCCT
7.400NO
14hsa-miR-3282548-16152
ugccuucccGUCUC--UCCCGGuc
||||| ||||||
tcaagatccCAGAGTCAGGGCCct
NONO
15hsa-miR-3392645-15.6143
acUCGAGGACCUCCUGUCCCu
|| ||| || | |||||
caAGATCCCAGA-GTCAGGGc
NONO
16hsa-miR-5042647-14.32141
uaUCUCACGUCU-GGUCCCAGa
||| |||| :||||| |
caAGATCCCAGAGTCAGGGCCc
NONO
17hsa-miR-515-3p2749-10.2125
UGCGAGGUUUUC--UUCCGUGAg
| | ||| |:|| |:||| ||
AAGATCCCAGAGTCAGGGCCCTg
NONO
18hsa-miR-2022856-24.9128
aaaAGGGU---A----CGGGAUAUGGAga
||||| | |||||:|||||
agaTCCCAGAGTCAGGGCCCTGTACCTtc
NONO
19hsa-miR-2063358-10.79121
GGUGU--GU---GAAGGA-AUGUAAGGu
||| | || | ||| ||| ||||
CCAGAGTCAGGGC--CCTGTACCTTCCt
5.000NO
20hsa-miR-5033762-19121
gacGUCUU--GACAAGG--GCGACGAu
|||:: |||| || | |||||
agtCAGGGCCCTGTACCTTC-CTGCTg
NONO
21hsa-miR-4243862-12.1128
aAGUUUU-GUACUU--AACGACGAC
|||::: | || | || ||||||
gTCAGGGCCCTGTACCTTCCTGCTG
NONO
22hsa-miR-4253861-12123
CCG-CCUGUG-C-UGUAAGGGCua
| | ||:| | | || ||||:|
GTCAGGGCCCTGTACCTTCCTGct
NONO
23hsa-miR-1033961-25.2140
AGUAUCGGGACAUGUUACGACGA
||| :||||||||| | |||||
TCAGGGCCCTGTACCTTCCTGCT
9.493NO
24hsa-miR-1073961-23.6131
ACUAUCGGGACAUGUUACGACGA
| | :||||||||| | |||||
TCAGGGCCCTGTACCTTCCTGCT
9.255NO
25hsa-miR-4973962-11.7122
uGUUUGGUGUCA---CACGACGAC
||:: | | || | ||||||
tCAGGGCCCTGTACCTTCCTGCTG
NONO
26hsa-miR-493-3p4057-10.9127
GACCGUGUGUCAUCUGGAAGu
| || :| | || ||||||
CAGG-GCCCTGT--ACCTTCc
NONO
27hsa-miR-2144363-18.9170
gacGGACAGACACGGACGACa
||||| | |||||||
ggcCCTGTACCTTCCTGCTGg
8.407NO
28hsa-miR-520a*4465-16.1123
ucuuuCAUGAAGGGA-GACCuc
|||| |:||| ||||
gccctGTACCTTCCTGCTGGtg
NONO
29hsa-miR-224669-14.5133
uGUCA-AGAA-GUUGACCGUCGAa
| || ||| | :||||::|||
cCTGTACCTTCCTGCTGGTGGCTc
10.264NO
30hsa-miR-193a4774-15.11125
GACCCUGAA-----ACAUCC--GGUCAA
||| ||| || || ||||||
CTGTACCTTCCTGCTGGTGGCTCCAGTT
NONO
31hsa-miR-193b4974-11.51123
uuucgcccugaaACUCCC--GGUCAA
||: || ||||||
gtaccttcctgcTGGTGGCTCCAGTT
NONO
32hsa-miR-3715169-12.2128
UGUGAGUUUUCUACCGCCGug
|| :|| | |||:|||
ACCTTC--CTGCTGGTGGCtc
NONO
33hsa-miR-516-5p5175-15.42123
uuucACGAAGA--AUGGAGGUCUAc
| || || |: |||||| |
acctTCCTGCTGGTGGCTCCAGTTc
NONO
34hsa-miR-3785780-15.1124
uguGUCC-UGGACCUC-AGUCCUc
| || : || || ||||||
ctgCTGGTGGCTCCAGTTCAGGAa
NONO
35hsa-miR-4865779-20.1151
GAGCCCCGUCGA-GUCAUGUCCU
|| ||::||| |||| |||||
CTGCTGGTGGCTCCAGTTCAGGA
NONO
36hsa-miR-3705979-18.6130
gGUCCAAGGUGGGGUC--GUCCg
| ||| :|:|||| ||||
gCTGGT--GGCTCCAGTTCAGGa
NONO
37hsa-miR-2036077-11.6121
GAUCACCAGGAUUUGUAAAGUg
||:|||| :| || ||||
CTGGTGGCTC----CAGTTCAg
5.000NO
38hsa-miR-324-3p6086-14.7133
GGUCGUCGUGGAC---CCC--GUCACc
|::|::|| || | || |||||
CTGGTGGCTCCAGTTCAGGAACAGTGa
NONO
39hsa-miR-246490-14.4140
gaCAAGGACGA---CUUG--ACUCGGu
| ||| |:| |||| ||||||
tgGCTCCAGTTCAGGAACAGTGAGCCc
11.006NO
40hsa-miR-2146796-10.8136
GACGGACA-------GACAC---GGACGAca
|| || || | ||| ||||||
CT-CCAGTTCAGGAACAGTGAGCCCTGCTca
8.407NO
41hsa-miR-1496992-11.1128
ccUCACUUC--UGUGCCUCGGucu
||| || ||| |||||
ccAGTTCAGGAACAGTGAGCCctg
5.000NO
42hsa-miR-5037295-13.2137
gACGU-CUUGACAAGGGCGACGAu
| || |||| || | |||||
gTTCAGGAACAGTGAGCCCTGCTc
NONO
43hsa-miR-287392-15.4126
gAGUUAUCUGACACUCGAGGAa
|||: | || |||||| |||
tTCAGGA-ACAGTGAGC-CCTg
8.778NO
44hsa-miR-4847393-11.4134
uAGCCCUCCCCUGACUC-GGACu
|| ||| | |||| ||||
tTCAGGAACAG--TGAGCCCTGc
NONO
45hsa-miR-199a78106-15.6129
CUUGUCCAUC------AGACUUGUGACcc
|||||| || || |||:||||
GAACAGTGAGCCCTGCTCAGAATACTGtc
10.003NO
46hsa-miR-199b78106-13.9123
CUUGUCUAUC------AGAUUUGUGACcc
|||||| || || :||:||||
GAACAGTGAGCCCTGCTCAGAATACTGtc
5.000NO
47hsa-miR-34a79113-18.3146
UUGUU-----GGUCGAUUCU-------GUGACGGU
||||: || ||| ||| | ||||||
AACAGTGAGCCCTGCTCAGAATACTGTCTCTGCCA
7.376NO
48hsa-let-7c86109-14.1123
UUGGUAU--GUUGGAUGAUGGAGu
|:|| |: ||: ||||::|||
AGCCCTGCTCAGAATACTGTCTCt
11.774NO
49hsa-miR-199a*86106-11.8129
UUGGUUACACGUCUGAUGACAu
|:|| || |||| ||||||
AGCC-CTGCTCAGAATACTGTc
9.369NO
50hsa-miR-34b86108-12.1138
guuaGUCGAUUACUGUGACGGAu
| ||| | |:||||:||
agccCTGCTCAGAATACTGTCTc
7.593NO
miR-491
Target on HBV wildtype 
Binding site 1-10
mfe : -11.1
Hybrid sequence
aggaguaccuucccaAGG-GGUGA
--------------cTCCACCACT miR-432
Target on HBV wildtype 
Binding site 13-30
mfe : -16.8
Hybrid sequence
GGUGGGUUACUGGAUGAGGUUCU
CCACCAAA----CT-CTTCAAGA miR-542-5p
Target on HBV wildtype 
Binding site 16-37
mfe : -10.7
Hybrid sequence
gagcacuGUACUACUAGGGGCU
ccaaactCTTCAAGATCCCAGA miR-492
Target on HBV wildtype 
Binding site 17-47
mfe : -11.5
Hybrid sequence
uUCUUAGAA---C-AGGG---C-GUCCAGGa
cAAACTCTTCAAGATCCCAGAGTCAGGGCCc miR-518c*
Target on HBV wildtype 
Binding site 17-39
mfe : -12.4
Hybrid sequence
gucuuucacgaagggaGGUCUCu
caaactcttcaagatcCCAGAGt miR-370
Target on HBV wildtype 
Binding site 19-44
mfe : -14.8
Hybrid sequence
gguccAAG--GUGGGGUC---GUCCg
aactcTTCAAGATCCCAGAGTCAGGg miR-326
Target on HBV wildtype 
Binding site 20-39
mfe : -12.3
Hybrid sequence
gaccuccUUCCCGGGUCUCc
actcttcAAGATCCCAGAGt miR-149
Target on HBV wildtype 
Binding site 21-43
mfe : -12.3
Hybrid sequence
ccucACUUCU-GUGCCUCGGUCu
ctctTCAAGATCCCAGAGTCAGg miR-125b
Target on HBV wildtype 
Binding site 23-45
mfe : -10.73
Hybrid sequence
aguGUUCAA---UCCCAGAGUCCCu
cttCAAGATCCCAGAG--TCAGGGc miR-378
Target on HBV wildtype 
Binding site 23-45
mfe : -17.7
Hybrid sequence
uguGUCCU-GGACCUCAGUCCuc
cttCAAGATCCCAGAGTCAGGgc miR-331
Target on HBV wildtype 
Binding site 24-46
mfe : -15
Hybrid sequence
AAGAUCCUA---UCCGGGUCCCcg
TTC-AAGATCCCAGAGTCAGGGcc miR-345
Target on HBV wildtype 
Binding site 24-44
mfe : -11.4
Hybrid sequence
cgggaccugaucCUCAGUCgu
ttcaagatcccaGAGTCAGgg miR-296
Target on HBV wildtype 
Binding site 25-48
mfe : -16.5
Hybrid sequence
uGUCCUA---ACUCCCCCCCGGGA
tCAAGATCCCAGAGTCAGGGCCCT miR-328
Target on HBV wildtype 
Binding site 25-48
mfe : -16
Hybrid sequence
ugccuucccGUCUC--UCCCGGuc
tcaagatccCAGAGTCAGGGCCct miR-339
Target on HBV wildtype 
Binding site 26-45
mfe : -15.6
Hybrid sequence
acUCGAGGACCUCCUGUCCCu
caAGATCCCAGA-GTCAGGGc miR-504
Target on HBV wildtype 
Binding site 26-47
mfe : -14.32
Hybrid sequence
uaUCUCACGUCU-GGUCCCAGa
caAGATCCCAGAGTCAGGGCCc miR-515-3p
Target on HBV wildtype 
Binding site 27-49
mfe : -10.2
Hybrid sequence
UGCGAGGUUUUC--UUCCGUGAg
AAGATCCCAGAGTCAGGGCCCTg miR-202
Target on HBV wildtype 
Binding site 28-56
mfe : -24.9
Hybrid sequence
aaaAGGGU---A----CGGGAUAUGGAga
agaTCCCAGAGTCAGGGCCCTGTACCTtc miR-206
Target on HBV wildtype 
Binding site 33-58
mfe : -10.79
Hybrid sequence
GGUGU--GU---GAAGGA-AUGUAAGGu
CCAGAGTCAGGGC--CCTGTACCTTCCt miR-503
Target on HBV wildtype 
Binding site 37-62
mfe : -19
Hybrid sequence
gacGUCUU--GACAAGG--GCGACGAu
agtCAGGGCCCTGTACCTTC-CTGCTg miR-424
Target on HBV wildtype 
Binding site 38-62
mfe : -12.1
Hybrid sequence
aAGUUUU-GUACUU--AACGACGAC
gTCAGGGCCCTGTACCTTCCTGCTG miR-425
Target on HBV wildtype 
Binding site 38-61
mfe : -12
Hybrid sequence
CCG-CCUGUG-C-UGUAAGGGCua
GTCAGGGCCCTGTACCTTCCTGct miR-103
Target on HBV wildtype 
Binding site 39-61
mfe : -25.2
Hybrid sequence
AGUAUCGGGACAUGUUACGACGA
TCAGGGCCCTGTACCTTCCTGCT miR-107
Target on HBV wildtype 
Binding site 39-61
mfe : -23.6
Hybrid sequence
ACUAUCGGGACAUGUUACGACGA
TCAGGGCCCTGTACCTTCCTGCT miR-497
Target on HBV wildtype 
Binding site 39-62
mfe : -11.7
Hybrid sequence
uGUUUGGUGUCA---CACGACGAC
tCAGGGCCCTGTACCTTCCTGCTG miR-493-3p
Target on HBV wildtype 
Binding site 40-57
mfe : -10.9
Hybrid sequence
GACCGUGUGUCAUCUGGAAGu
CAGG-GCCCTGT--ACCTTCc miR-214
Target on HBV wildtype 
Binding site 43-63
mfe : -18.9
Hybrid sequence
gacGGACAGACACGGACGACa
ggcCCTGTACCTTCCTGCTGg miR-520a*
Target on HBV wildtype 
Binding site 44-65
mfe : -16.1
Hybrid sequence
ucuuuCAUGAAGGGA-GACCuc
gccctGTACCTTCCTGCTGGtg miR-22
Target on HBV wildtype 
Binding site 46-69
mfe : -14.5
Hybrid sequence
uGUCA-AGAA-GUUGACCGUCGAa
cCTGTACCTTCCTGCTGGTGGCTc miR-193a
Target on HBV wildtype 
Binding site 47-74
mfe : -15.11
Hybrid sequence
GACCCUGAA-----ACAUCC--GGUCAA
CTGTACCTTCCTGCTGGTGGCTCCAGTT miR-193b
Target on HBV wildtype 
Binding site 49-74
mfe : -11.51
Hybrid sequence
uuucgcccugaaACUCCC--GGUCAA
gtaccttcctgcTGGTGGCTCCAGTT miR-371
Target on HBV wildtype 
Binding site 51-69
mfe : -12.2
Hybrid sequence
UGUGAGUUUUCUACCGCCGug
ACCTTC--CTGCTGGTGGCtc miR-516-5p
Target on HBV wildtype 
Binding site 51-75
mfe : -15.42
Hybrid sequence
uuucACGAAGA--AUGGAGGUCUAc
acctTCCTGCTGGTGGCTCCAGTTc miR-378
Target on HBV wildtype 
Binding site 57-80
mfe : -15.1
Hybrid sequence
uguGUCC-UGGACCUC-AGUCCUc
ctgCTGGTGGCTCCAGTTCAGGAa miR-486
Target on HBV wildtype 
Binding site 57-79
mfe : -20.1
Hybrid sequence
GAGCCCCGUCGA-GUCAUGUCCU
CTGCTGGTGGCTCCAGTTCAGGA miR-370
Target on HBV wildtype 
Binding site 59-79
mfe : -18.6
Hybrid sequence
gGUCCAAGGUGGGGUC--GUCCg
gCTGGT--GGCTCCAGTTCAGGa miR-203
Target on HBV wildtype 
Binding site 60-77
mfe : -11.6
Hybrid sequence
GAUCACCAGGAUUUGUAAAGUg
CTGGTGGCTC----CAGTTCAg miR-324-3p
Target on HBV wildtype 
Binding site 60-86
mfe : -14.7
Hybrid sequence
GGUCGUCGUGGAC---CCC--GUCACc
CTGGTGGCTCCAGTTCAGGAACAGTGa miR-24
Target on HBV wildtype 
Binding site 64-90
mfe : -14.4
Hybrid sequence
gaCAAGGACGA---CUUG--ACUCGGu
tgGCTCCAGTTCAGGAACAGTGAGCCc miR-214
Target on HBV wildtype 
Binding site 67-96
mfe : -10.8
Hybrid sequence
GACGGACA-------GACAC---GGACGAca
CT-CCAGTTCAGGAACAGTGAGCCCTGCTca miR-149
Target on HBV wildtype 
Binding site 69-92
mfe : -11.1
Hybrid sequence
ccUCACUUC--UGUGCCUCGGucu
ccAGTTCAGGAACAGTGAGCCctg miR-503
Target on HBV wildtype 
Binding site 72-95
mfe : -13.2
Hybrid sequence
gACGU-CUUGACAAGGGCGACGAu
gTTCAGGAACAGTGAGCCCTGCTc miR-28
Target on HBV wildtype 
Binding site 73-92
mfe : -15.4
Hybrid sequence
gAGUUAUCUGACACUCGAGGAa
tTCAGGA-ACAGTGAGC-CCTg miR-484
Target on HBV wildtype 
Binding site 73-93
mfe : -11.4
Hybrid sequence
uAGCCCUCCCCUGACUC-GGACu
tTCAGGAACAG--TGAGCCCTGc miR-199a
Target on HBV wildtype 
Binding site 78-106
mfe : -15.6
Hybrid sequence
CUUGUCCAUC------AGACUUGUGACcc
GAACAGTGAGCCCTGCTCAGAATACTGtc miR-199b
Target on HBV wildtype 
Binding site 78-106
mfe : -13.9
Hybrid sequence
CUUGUCUAUC------AGAUUUGUGACcc
GAACAGTGAGCCCTGCTCAGAATACTGtc miR-34a
Target on HBV wildtype 
Binding site 79-113
mfe : -18.3
Hybrid sequence
UUGUU-----GGUCGAUUCU-------GUGACGGU
AACAGTGAGCCCTGCTCAGAATACTGTCTCTGCCA let-7c
Target on HBV wildtype 
Binding site 86-109
mfe : -14.1
Hybrid sequence
UUGGUAU--GUUGGAUGAUGGAGu
AGCCCTGCTCAGAATACTGTCTCt miR-199a*
Target on HBV wildtype 
Binding site 86-106
mfe : -11.8
Hybrid sequence
UUGGUUACACGUCUGAUGACAu
AGCC-CTGCTCAGAATACTGTc miR-34b
Target on HBV wildtype 
Binding site 86-108
mfe : -12.1
Hybrid sequence
guuaGUCGAUUACUGUGACGGAu
agccCTGCTCAGAATACTGTCTc