Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HGV target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
 Browse   strain Iowan, complete genome   wildtype(complete genome)   
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 4939 rescords (99 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-miR-491123-19.2147
aggaGUACCUUCCCA---AGGGGUGa
|:|||::| || ||||| |
---aCGTGGGGGAGTTGATCCCCCCc
NONO
2hsa-miR-542-5p122-21.5149
gaGCA-CUGUACUACUAGGGGcu
||| |: : | ||||||||
-aCGTGGGGGAGTTGATCCCCcc
NONO
3hsa-miR-363*223-14.9138
uuuaacguagcACUAGGUGGGc
|||||| |||
cgtgggggagtTGATCCCCCCc
NONO
4hsa-miR-148a1435-10.3128
uguuucaagacaucaCGUGACu
||||||
gatcccccccccccgGCACTGg
NONO
5hsa-miR-148b1435-10.2128
uguuucaagacacuaCGUGACu
||||||
gatcccccccccccgGCACTGg
NONO
6hsa-miR-1521435-12.2128
ggguucaagacaguaCGUGACu
||||||
gatcccccccccccgGCACTGg
7.093NO
7hsa-miR-199b1436-13.3134
cuugucuaucagauuuGUGACCC
|||||||
gatcccccccccccggCACTGGG
5.000NO
8hsa-miR-3701436-18.1123
gguccaaGGUGGGGUCGU--CCg
|| ||||:||| ||
gatccccCCCCCCCGGCACTGGg
NONO
9hsa-miR-199a1536-14.1135
cuuguccaucaGACUUGUGACCC
| | :|||||||
atcccccccccCCG-GCACTGGG
10.003NO
10hsa-miR-324-3p1735-14.56131
GGUCGUCGUGGACCCCGUCACC
|| | | || |||| |||
CCCCCCCCCCC---GGCACTGG
NONO
11hsa-miR-128a1837-13.6130
uuuucucuGGCCAAGUGACACu
|||| ||||| |
ccccccccCCGG--CACTGGGt
5.472NO
12hsa-miR-128b1837-13.6130
cuuucucuGGCCAAGUGACACu
|||| ||||| |
ccccccccCCGG--CACTGGGt
5.226NO
13hsa-miR-10a1938-11122
guguuuaaGCCUAGAUGUCCCAu
||| | || ||||
ccccccccCGG--C-ACTGGGTg
7.071NO
14hsa-miR-5001941-17.4144
gucuuaGGAACG-GGUCCACGUa
|| || |::||||||
ccccccCCCGGCACTGGGTGCAa
NONO
15hsa-miR-10b2038-11122
uguuuaaGCCAAGAUGUCCCAu
||| | || ||||
cccccccCGG--C-ACTGGGTg
6.727NO
16hsa-miR-252143-15.5137
agucuGGCUCUG-UUCACGUUac
|||: || ::||||||
cccccCCGGCACTGGGTGCAAgc
9.003NO
17hsa-miR-922243-16.6143
guccGGCCCUG-UUCACGUUau
|||| || ::||||||
ccccCCGGCACTGGGTGCAAgc
9.883NO
18hsa-miR-3672343-10.8128
aGUGGUAACGAUUUCACGUUaa
| ||: || ::||||||
cCCCCGGCACT-GGGTGCAAgc
NONO
19hsa-miR-5072343-13.2133
aaGUGAGGUUUUCCACGUUuu
| | || :|||||||
ccCCCGGCACTGGGTGCAAgc
NONO
20hsa-miR-4122643-15.5128
uGCCGAUCACCUGGUCCAC-UUCa
|||| ||::|||| |||
cCGGC------ACTGGGTGCAAGc
NONO
21hsa-miR-4312845-10.32130
aCGU-ACUGCCGGACGUUCUGu
||| || || |||||| |
gGCACTG--GG--TGCAAGCCc
NONO
22hsa-miR-3263251-15.5154
GACCUCCUUCCCGGGUCUcc
||||: | | | ||||||
CTGGGTGCAAGCCCCAGAaa
NONO
23hsa-miR-4233259-21.5154
GACUCCC---CGGAGUC--UGGCU-CGa
|||:| | ||| ||| ||||| ||
CTGGGTGCAAGCCCCAGAAACCGACGCc
NONO
24hsa-miR-1895176-10.4125
UGACUAUAG-UCGAGUCAUC--CGUg
|| || : | | || ||||| |||
ACCGACGCCTATCTAAGTAGACGCAa
5.126NO
25hsa-miR-525*6091-11.2123
cgAGAUU--UC--CCUU-------CGCGGaag
||||| || | || |||||
taTCTAAGTAGACGCAATGACTCGGCGCCgac
NONO
26hsa-miR-191*6790-11.8132
cccCUGCUUUA--GGUUCGCGUCg
|||| ||| |: :|||| |
gtaGACGCAATGACTCGGCGCCGa
NONO
27hsa-miR-3466992-11.6121
UCUCCGUCCGUAC---GCC-CGUCUGu
||| ||| ||| ||| || |||
AGACGCA---ATGACTCGGCGCCGACt
NONO
28hsa-miR-3257395-18.1123
uGUGAAUGACCUGUGGAUGAUCC
|| | ||| |:|:|| ||| ||
gCAATGACTCGGCGCCGACTCGG
NONO
29hsa-miR-42376104-21.7127
gACU---CCCCG---GAGU--CUGGCUCGa
||| || || |||: ||||| ||
aTGACTCGGCGCCGACTCGGCGACCG-GCc
NONO
30hsa-miR-193b81108-16.72130
uuuCGC-CCUGAAACUC---CCGGUcaa
||| |||| | | |||||
tcgGCGCCGACTCGGCGACCGGCCAaaa
NONO
31hsa-miR-37581107-16.1122
AG-UGC-GCU---CGGCUUGCUUGUUU
|| :|| ||| | ||| ||: ||||
TCGGCGCCGACTCGGCGACCGGCCAAA
NONO
32hsa-miR-12986109-15.7128
CGUUCGGGU--CUGG-CGUUUUUC
|| : |:|: |||| || |||||
GCCGACTCGGCGACCGGCCAAAAG
5.000NO
33hsa-miR-324-3p89116-19.7130
ggucGUCGUGGACC------CCGUCACC
|:||: | || ||::||||
gactCGGCGACCGGCCAAAAGGTGGTGG
NONO
34hsa-miR-181a90121-20.7123
UGAG----UGGCUG-----UCGCAACUUACaa
|||| ||||:| :|:| ||:|||
ACTCGGCGACCGGCCAAAAGGTGGTGGATGgg
9.523NO
35hsa-miR-181c90121-21.3126
UGAG----UGGCUG----UCCA--ACUUACaa
|||| ||||:| |||| ||:|||
ACTCGGCGACCGGCCAAAAGGTGGTGGATGgg
8.945NO
36hsa-miR-19790117-19.4151
cGACCC----ACC--UCUUCCACCACUU
|| || || | |||||||||:|
aCTCGGCGACCGGCCAAAAGGTGGTGGA
6.957NO
37hsa-miR-37199119-20.52128
ugugaGUUUUCUACCGCCgug
||||||:|||:||
ccggcCAAAAGGTGGTGGatg
NONO
38hsa-miR-213101121-16.9129
CCAUGUUAGUUGCCAGCUACCa
|| ||| :::||| |||||
GG-CCAAAAGGTGGTGGATGGg
5.701NO
39hsa-miR-377103125-11.4130
uGUUUU-CAACGGAAACACACUA
||||| || |: || |||||
cCAAAAGGTGGTGGATGGGTGAT
NONO
40hsa-miR-10a104134-16.2149
GUGUUUAA--GCCUA------GAUGUCCCAu
|| ||: | :|||| : |||||||
CAAAAGGTGGTGGATGGGTGATGACAGGGTt
7.071Yes
41hsa-miR-412107127-16.62143
UGCCGAUCACCUGGUCCACUUCa
| || |:||||| ::||||| |
AAGG-TGGTGGA-TGGGTGATGa
NONO
42hsa-miR-505107128-12.8121
cUCCUUUGGUCGUUCACAACUG
||| ::: : :::||| ||||
aAGGTGGTGGATGGGTGATGAC
NONO
43hsa-miR-211111134-21.7124
uCCGCUU-CCUACUG-UUUCCCuu
||:|:| ||:|||: | ||||
tGGTGGATGGGTGATGACAGGGtt
5.593NO
44hsa-miR-10b112134-15.1151
uguuuaAGCCAAGA-UGUCCCAu
| ||| | |||||||
ggtggaTGGGTGATGACAGGGTt
6.727Yes
45hsa-miR-483112136-16.9123
uCUUCUGCCCUC--CUCUCCUCACu
| :||:||| | || |||: ||
gGTGGATGGGTGATGACAGGGTTGg
NONO
46hsa-miR-328113136-21.1122
ugCCUUCCCGU--CUCUCCCGGUC
||| |||:: || ||||:::|
gtGGATGGGTGATGACAGGGTTGG
NONO
47hsa-miR-339113133-15.2159
acucgaggacCUCCUGUCCCu
|| |||||||
gtggatgggtGATGACAGGGt
NOYes
48hsa-miR-504116135-15.9146
uauCUCACGUCUGGUCCCAga
|:||| || ||||||
gatGGGTGATGA-CAGGGTtg
NONO
49hsa-miR-150119140-19.9135
gugACCAUGUUCCCAACCCUCu
|| |: |||||||| ||
gggTGATGACAGGGTTGGTAGg
7.336NO
50hsa-miR-189120143-15.1128
ugACUAUAGU-CGAGUCAUCCgug
||||: || | |::|||||
ggTGATGACAGGGTTGGTAGGtcg
5.126NO
miR-491
Target on HGV 
Binding site 1-23
mfe : -19.2
Hybrid sequence
aggaGUACCUUCCCA---AGGGGUGa
---aCGTGGGGGAGTTGATCCCCCCc miR-542-5p
Target on HGV 
Binding site 1-22
mfe : -21.5
Hybrid sequence
gaGCA-CUGUACUACUAGGGGcu
-aCGTGGGGGAGTTGATCCCCcc miR-363*
Target on HGV 
Binding site 2-23
mfe : -14.9
Hybrid sequence
uuuaacguagcACUAGGUGGGc
cgtgggggagtTGATCCCCCCc miR-148a
Target on HGV 
Binding site 14-35
mfe : -10.3
Hybrid sequence
uguuucaagacaucaCGUGACu
gatcccccccccccgGCACTGg miR-148b
Target on HGV 
Binding site 14-35
mfe : -10.2
Hybrid sequence
uguuucaagacacuaCGUGACu
gatcccccccccccgGCACTGg miR-152
Target on HGV 
Binding site 14-35
mfe : -12.2
Hybrid sequence
ggguucaagacaguaCGUGACu
gatcccccccccccgGCACTGg miR-199b
Target on HGV 
Binding site 14-36
mfe : -13.3
Hybrid sequence
cuugucuaucagauuuGUGACCC
gatcccccccccccggCACTGGG miR-370
Target on HGV 
Binding site 14-36
mfe : -18.1
Hybrid sequence
gguccaaGGUGGGGUCGU--CCg
gatccccCCCCCCCGGCACTGGg miR-199a
Target on HGV 
Binding site 15-36
mfe : -14.1
Hybrid sequence
cuuguccaucaGACUUGUGACCC
atcccccccccCCG-GCACTGGG miR-324-3p
Target on HGV 
Binding site 17-35
mfe : -14.56
Hybrid sequence
GGUCGUCGUGGACCCCGUCACC
CCCCCCCCCCC---GGCACTGG miR-128a
Target on HGV 
Binding site 18-37
mfe : -13.6
Hybrid sequence
uuuucucuGGCCAAGUGACACu
ccccccccCCGG--CACTGGGt miR-128b
Target on HGV 
Binding site 18-37
mfe : -13.6
Hybrid sequence
cuuucucuGGCCAAGUGACACu
ccccccccCCGG--CACTGGGt miR-10a
Target on HGV 
Binding site 19-38
mfe : -11
Hybrid sequence
guguuuaaGCCUAGAUGUCCCAu
ccccccccCGG--C-ACTGGGTg miR-500
Target on HGV 
Binding site 19-41
mfe : -17.4
Hybrid sequence
gucuuaGGAACG-GGUCCACGUa
ccccccCCCGGCACTGGGTGCAa miR-10b
Target on HGV 
Binding site 20-38
mfe : -11
Hybrid sequence
uguuuaaGCCAAGAUGUCCCAu
cccccccCGG--C-ACTGGGTg miR-25
Target on HGV 
Binding site 21-43
mfe : -15.5
Hybrid sequence
agucuGGCUCUG-UUCACGUUac
cccccCCGGCACTGGGTGCAAgc miR-92
Target on HGV 
Binding site 22-43
mfe : -16.6
Hybrid sequence
guccGGCCCUG-UUCACGUUau
ccccCCGGCACTGGGTGCAAgc miR-367
Target on HGV 
Binding site 23-43
mfe : -10.8
Hybrid sequence
aGUGGUAACGAUUUCACGUUaa
cCCCCGGCACT-GGGTGCAAgc miR-507
Target on HGV 
Binding site 23-43
mfe : -13.2
Hybrid sequence
aaGUGAGGUUUUCCACGUUuu
ccCCCGGCACTGGGTGCAAgc miR-412
Target on HGV 
Binding site 26-43
mfe : -15.5
Hybrid sequence
uGCCGAUCACCUGGUCCAC-UUCa
cCGGC------ACTGGGTGCAAGc miR-431
Target on HGV 
Binding site 28-45
mfe : -10.32
Hybrid sequence
aCGU-ACUGCCGGACGUUCUGu
gGCACTG--GG--TGCAAGCCc miR-326
Target on HGV 
Binding site 32-51
mfe : -15.5
Hybrid sequence
GACCUCCUUCCCGGGUCUcc
CTGGGTGCAAGCCCCAGAaa miR-423
Target on HGV 
Binding site 32-59
mfe : -21.5
Hybrid sequence
GACUCCC---CGGAGUC--UGGCU-CGa
CTGGGTGCAAGCCCCAGAAACCGACGCc miR-189
Target on HGV 
Binding site 51-76
mfe : -10.4
Hybrid sequence
UGACUAUAG-UCGAGUCAUC--CGUg
ACCGACGCCTATCTAAGTAGACGCAa miR-525*
Target on HGV 
Binding site 60-91
mfe : -11.2
Hybrid sequence
cgAGAUU--UC--CCUU-------CGCGGaag
taTCTAAGTAGACGCAATGACTCGGCGCCgac miR-191*
Target on HGV 
Binding site 67-90
mfe : -11.8
Hybrid sequence
cccCUGCUUUA--GGUUCGCGUCg
gtaGACGCAATGACTCGGCGCCGa miR-346
Target on HGV 
Binding site 69-92
mfe : -11.6
Hybrid sequence
UCUCCGUCCGUAC---GCC-CGUCUGu
AGACGCA---ATGACTCGGCGCCGACt miR-325
Target on HGV 
Binding site 73-95
mfe : -18.1
Hybrid sequence
uGUGAAUGACCUGUGGAUGAUCC
gCAATGACTCGGCGCCGACTCGG miR-423
Target on HGV 
Binding site 76-104
mfe : -21.7
Hybrid sequence
gACU---CCCCG---GAGU--CUGGCUCGa
aTGACTCGGCGCCGACTCGGCGACCG-GCc miR-193b
Target on HGV 
Binding site 81-108
mfe : -16.72
Hybrid sequence
uuuCGC-CCUGAAACUC---CCGGUcaa
tcgGCGCCGACTCGGCGACCGGCCAaaa miR-375
Target on HGV 
Binding site 81-107
mfe : -16.1
Hybrid sequence
AG-UGC-GCU---CGGCUUGCUUGUUU
TCGGCGCCGACTCGGCGACCGGCCAAA miR-129
Target on HGV 
Binding site 86-109
mfe : -15.7
Hybrid sequence
CGUUCGGGU--CUGG-CGUUUUUC
GCCGACTCGGCGACCGGCCAAAAG miR-324-3p
Target on HGV 
Binding site 89-116
mfe : -19.7
Hybrid sequence
ggucGUCGUGGACC------CCGUCACC
gactCGGCGACCGGCCAAAAGGTGGTGG miR-181a
Target on HGV 
Binding site 90-121
mfe : -20.7
Hybrid sequence
UGAG----UGGCUG-----UCGCAACUUACaa
ACTCGGCGACCGGCCAAAAGGTGGTGGATGgg miR-181c
Target on HGV 
Binding site 90-121
mfe : -21.3
Hybrid sequence
UGAG----UGGCUG----UCCA--ACUUACaa
ACTCGGCGACCGGCCAAAAGGTGGTGGATGgg miR-197
Target on HGV 
Binding site 90-117
mfe : -19.4
Hybrid sequence
cGACCC----ACC--UCUUCCACCACUU
aCTCGGCGACCGGCCAAAAGGTGGTGGA miR-371
Target on HGV 
Binding site 99-119
mfe : -20.52
Hybrid sequence
ugugaGUUUUCUACCGCCgug
ccggcCAAAAGGTGGTGGatg miR-213
Target on HGV 
Binding site 101-121
mfe : -16.9
Hybrid sequence
CCAUGUUAGUUGCCAGCUACCa
GG-CCAAAAGGTGGTGGATGGg miR-377
Target on HGV 
Binding site 103-125
mfe : -11.4
Hybrid sequence
uGUUUU-CAACGGAAACACACUA
cCAAAAGGTGGTGGATGGGTGAT miR-10a
Target on HGV 
Binding site 104-134
mfe : -16.2
Hybrid sequence
GUGUUUAA--GCCUA------GAUGUCCCAu
CAAAAGGTGGTGGATGGGTGATGACAGGGTt miR-412
Target on HGV 
Binding site 107-127
mfe : -16.62
Hybrid sequence
UGCCGAUCACCUGGUCCACUUCa
AAGG-TGGTGGA-TGGGTGATGa miR-505
Target on HGV 
Binding site 107-128
mfe : -12.8
Hybrid sequence
cUCCUUUGGUCGUUCACAACUG
aAGGTGGTGGATGGGTGATGAC miR-211
Target on HGV 
Binding site 111-134
mfe : -21.7
Hybrid sequence
uCCGCUU-CCUACUG-UUUCCCuu
tGGTGGATGGGTGATGACAGGGtt miR-10b
Target on HGV 
Binding site 112-134
mfe : -15.1
Hybrid sequence
uguuuaAGCCAAGA-UGUCCCAu
ggtggaTGGGTGATGACAGGGTt miR-483
Target on HGV 
Binding site 112-136
mfe : -16.9
Hybrid sequence
uCUUCUGCCCUC--CUCUCCUCACu
gGTGGATGGGTGATGACAGGGTTGg miR-328
Target on HGV 
Binding site 113-136
mfe : -21.1
Hybrid sequence
ugCCUUCCCGU--CUCUCCCGGUC
gtGGATGGGTGATGACAGGGTTGG miR-339
Target on HGV 
Binding site 113-133
mfe : -15.2
Hybrid sequence
acucgaggacCUCCUGUCCCu
gtggatgggtGATGACAGGGt miR-504
Target on HGV 
Binding site 116-135
mfe : -15.9
Hybrid sequence
uauCUCACGUCUGGUCCCAga
gatGGGTGATGA-CAGGGTtg miR-150
Target on HGV 
Binding site 119-140
mfe : -19.9
Hybrid sequence
gugACCAUGUUCCCAACCCUCu
gggTGATGACAGGGTTGGTAGg miR-189
Target on HGV 
Binding site 120-143
mfe : -15.1
Hybrid sequence
ugACUAUAGU-CGAGUCAUCCgug
ggTGATGACAGGGTTGGTAGGtcg