Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HCV wildtype target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    
Subtypes1a  1b  2a  3a  4a  5a  6a  10a  11a 
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 4725 rescords (95 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-miR-346124-15.8131
ucuCCGUCCG-----UACGCCCGUCUGU
| ||| | ||| |||| ||||
---GCCAGCCCCCTGATGGGGGC-GACA
NONO
2hsa-miR-485-5p110-11.1136
cuuaaguagugcCGGUCGGAGa
||||||| |
------------GCCAGCCCCc
NONO
3hsa-miR-510116-10.4123
acacuaaCGGUGAGAGGACUcau
|||| | |||||
-------GCCAGCCCCCTGAtgg
NONO
4hsa-miR-122a229-25156
uGUUUGUGG--UA--ACAG-UGUGAGGU
||: | || || | | ||||||||
cCAGCCCCCTGATGGGGGCGACACTCCA
12.384NO
5hsa-miR-133a223-17.1127
uGUCGACCAACUUCCCCUGGUu
|||| ||| ||||:| |
cCAGCCCCCTGATGGGGGCGAc
5.000NO
6hsa-miR-133b323-17.1121
aUCGACCAACUUCCCCUGGUu
||| ||| ||||:| |
cAGCCCCCTGATGGGGGCGAc
NONO
7hsa-miR-205320-14.9122
GUCUGAGGCCACCUUACUUCCu
||| | || || |||::||
CAGCCCCC--TG--ATGGGGGc
5.000NO
8hsa-miR-296423-17.5129
uguccuaACUCCCCCCCGgga
||| ||||||
agcccccTGA-TGGGGGCgac
7.400NO
9hsa-miR-371525-14.8143
uGUGAGUUUUCUACCGCCGUG
| | | :| |: |||| |||
gCCCCCTGATGGGGGCGACAC
NONO
10hsa-miR-432632-18.24125
GGUGGGUUA---CUG--GAUGAGGUucu
|| ||::|| |:| | ||||||
CCCCCTGATGGGGGCGAC-ACTCCAcca
NONO
11hsa-miR-142-3p729-12.6138
aGGUAUUUCAUCCUUUGUGAUGU
|| |:| | :|| :||||| ||
cCCCTGATGGGGGCGACACTCCA
9.468NO
12hsa-miR-433736-17.3127
uGUGGCU--CCUCG------GGUAGUACUa
| |:|| ||:|| ||| |||||
cCCCTGATGGGGGCGACACTCCACCATGAa
NONO
13hsa-miR-491831-21.8131
aGGAGUACCUUC-CCAAGGGGUGa
||| ||||::| | |:||||
cCCTGATGGGGGCGACACTCCACc
NONO
14hsa-miR-363*1133-11.3135
uuUAACGUAGCACU-AGGUGGgc
|| | : || | ||||||
tgATGGGGGCGACACTCCACCat
NONO
15hsa-miR-34a2145-10.1132
uUGU-UGGUCG-AUUCUGUGACGGu
||| ||| | |:| |||| ||
gACACTCCACCATGAATCACTCCCc
7.376NO
16hsa-miR-302d2243-12.9128
UGUGAGUUUGUACCUUCGUGAau
|||||| | ||| ||| ||||
ACACTCCACCAT-GAATCACTcc
NONO
17hsa-miR-3732243-17.7124
UGUGGGGUUUUAGCUUCGUGAag
||||:||| || ||| ||||
ACACTCCACCAT-GAATCACTcc
NONO
18hsa-miR-27b3051-12.4124
cGU-CUUGAAUCGGUGACACUu
|| |||: || ||||||
cCATGAATCACTCCCCTGTGAg
11.055NO
19hsa-miR-27a3151-11.4122
cgcCUUGAAUCGGUGACACUu
|||: || ||||||
catGAATCACTCCCCTGTGAg
10.858NO
20hsa-miR-5103151-14.4128
acACUAACGGUGAGAGGACUCau
||| | ||||| |||| |
caTGAAT--CACTCCCCTGTGag
NONO
21hsa-miR-5133251-21.1173
UAUUUACUGUGGAGGGACACUu
||:||| |||: ||||||||
ATGAAT--CACTCCCCTGTGAg
NOYes
22hsa-miR-515-3p3757-11121
uGCGAGGUUUUCUUCCGUGAg
| |||| : :||| |||
tCACTCCCCTGTGAGGAACTa
NONO
23hsa-miR-34b3864-11.3132
GUUAGUCG--AUUACU--GUGACGGAu
|| || | |:| || :||||:||
CACTCCCCTGTGAGGAACTACTGTCTt
7.593NO
24hsa-miR-199a*4062-18.3161
uuGGUUACACGUC-UGAUGACAu
|| |||| :| ||||||||
ctCCCCTGTGAGGAACTACTGTc
9.369Yes
25hsa-miR-4504674-14.3141
AUAAUCCUUG-UG-UA-----GCGUUUUU
|:| |||||| || :| ||||:|||
TGTGAGGAACTACTGTCTTCACGCAGAAA
NONO
26hsa-miR-74767-10.8131
guuguuUUAGUGAUCAGAAGgu
|| :||| ||||||
gtgaggAACTACT-GTCTTCac
5.000NO
27hsa-miR-1295175-14127
CGUUCGGGUCUG----GCGUUUUUC
| || : | | | ||||:||||
GGAACTACTGTCTTCACGCAGAAAG
5.000NO
28hsa-miR-2105173-16.7133
agUCGGCGACAG-UGUGCGUGUc
| |: ||||| |||||| |
ggAACTACTGTCTTCACGCAGAa
6.639NO
29hsa-miR-17-3p5472-17134
UGUUCACGGAAGUGACGUCa
|| | ||:|||||| ||||
ACTACTGTCTTCAC-GCAGa
6.278NO
30hsa-miR-245885-12.3121
GAC--AAGGACGACUU-----GACUCGGU
||| ||| || ||| || |||||
CTGTCTTCACGCAGAAAGCGTCT-AGCCA
11.006NO
31hsa-miR-5246182-13129
uGAGGU-UUCCCUUCGCGGAag
||:|| : | |||||:||
tCTTCACGCAGAAAGCGTCTag
NONO
32hsa-miR-1516283-11.6126
GGAGUUCCUCGAAGUCAGAUCa
|:||| | || ||||||
CTTCACGCAGAAAGCGTCTAGc
NONO
33hsa-miR-135a6487-14.1123
AGUGUAUCCUU-AUUUUUCGGUAu
||||: || || : ||||||
TCACGCAGAAAGCGTCTAGCCATg
NONO
34hsa-miR-135b6587-12.5125
GUGUAUCCUU-ACUUUUCGGUAu
|||: || || | ||||||
CACGCAGAAAGCGTCTAGCCATg
NONO
35hsa-miR-181a78104-15.1133
uGAGUGGCUGUCGCA-----ACUUACAa
|| :|| |::|||| |||:|||
tCTAGCC-ATGGCGTTAGTATGAGTGTc
9.523NO
36hsa-miR-181d80104-16.4128
uUGGGUGGCUGUUGU--UACUUACAa
| ||| :|:|: :| ||||:|||
tAGCCA-TGGCGTTAGTATGAGTGTc
NONO
37hsa-miR-181b82104-16.3133
gGGUG--GCUGUCGUUACUUACAa
|||: || :||: ||||:|||
gCCATGGCGTTAGT-ATGAGTGTc
6.484NO
38hsa-miR-181c83104-10.1125
ugagugGCUGUCCAACUUACAa
|| :|| |||:|||
ccatggCGTTAGTATGAGTGTc
8.945NO
39hsa-miR-1689113-15.2126
GCGGUUAUA---AAUGCACGACGau
||::|:||| | ||||| ||
CGTTAGTATGAGTGTCGTGCAGCct
11.196NO
40hsa-miR-36390112-15.8127
augUC-UACCUAUGGCACGUuaa
|| ||| :|::||||||
gttAGTATGAGTGTCGTGCAgcc
NONO
41hsa-miR-43293119-14.5136
ggugggUUACUGGAU----GAGGUUCU
|:|| | |: |||||:||
agtatgAGTGTCGTGCAGCCTCCAGGA
NONO
42hsa-miR-432*97117-15.5121
uCU-GUACCUCCUCGGUAGGUC
|| ::| | | |||| |||||
tGAGTGTCGTGCAGCC-TCCAG
NONO
43hsa-miR-516-5p97120-17.9126
uuUCAC-GAAGAAUGGAGGUCuac
|||| | | :|||||||
tgAGTGTCGTGCAGCCTCCAGgac
NONO
44hsa-miR-485-5p98115-15.7162
CUUAAGUAGUGCCGGUCGGAGa
||:| :||::| |||||||
GAGT--GTCGTG--CAGCCTCc
NOYes
45hsa-miR-49298122-14.49144
uUCUUAGAAC--AGGGCGUCCAGGa
|| :|| || ||: |||| ||
gAGTGTCGTGCAGCCTCCAGGACCc
NONO
46hsa-miR-431101121-16.2127
AC-GUACUGCCGGACGUUCUGu
|| |:|| | |||| ||:|||
TGTCGTG-CAGCCTCCAGGACc
NONO
47hsa-miR-490101121-20.82143
gucGUACCUCAGGAGGUCCaac
|:|| || ||||||||
tgtCGTGCAG-CCTCCAGGacc
NONO
48hsa-miR-518c*115134-17127
GUCUUUCACGAAGGGAGGUCUCU
|||:| | |||||| |:||
CAGGA---CCCCCCCTCCCGGGA
NONO
49hsa-miR-183117142-12.5131
gucacuuaaGAUGG---UCACGGUAU
|| || || ||||||
ggaccccccCTCCCGGGAGAGCCATA
5.000NO
50hsa-miR-149118142-11.5131
ccucacuucuGUGC---CUCGGUcu
| || ||||||
gaccccccctCCCGGGAGAGCCAta
5.000NO
miR-346
Target on hcv wildtype 
Binding site 1-24
mfe : -15.8
Hybrid sequence
ucuCCGUCCG-----UACGCCCGUCUGU
---GCCAGCCCCCTGATGGGGGC-GACA miR-485-5p
Target on hcv wildtype 
Binding site 1-10
mfe : -11.1
Hybrid sequence
cuuaaguagugcCGGUCGGAGa
------------GCCAGCCCCc miR-510
Target on hcv wildtype 
Binding site 1-16
mfe : -10.4
Hybrid sequence
acacuaaCGGUGAGAGGACUcau
-------GCCAGCCCCCTGAtgg miR-122a
Target on hcv wildtype 
Binding site 2-29
mfe : -25
Hybrid sequence
uGUUUGUGG--UA--ACAG-UGUGAGGU
cCAGCCCCCTGATGGGGGCGACACTCCA miR-133a
Target on hcv wildtype 
Binding site 2-23
mfe : -17.1
Hybrid sequence
uGUCGACCAACUUCCCCUGGUu
cCAGCCCCCTGATGGGGGCGAc miR-133b
Target on hcv wildtype 
Binding site 3-23
mfe : -17.1
Hybrid sequence
aUCGACCAACUUCCCCUGGUu
cAGCCCCCTGATGGGGGCGAc miR-205
Target on hcv wildtype 
Binding site 3-20
mfe : -14.9
Hybrid sequence
GUCUGAGGCCACCUUACUUCCu
CAGCCCCC--TG--ATGGGGGc miR-296
Target on hcv wildtype 
Binding site 4-23
mfe : -17.5
Hybrid sequence
uguccuaACUCCCCCCCGgga
agcccccTGA-TGGGGGCgac miR-371
Target on hcv wildtype 
Binding site 5-25
mfe : -14.8
Hybrid sequence
uGUGAGUUUUCUACCGCCGUG
gCCCCCTGATGGGGGCGACAC miR-432
Target on hcv wildtype 
Binding site 6-32
mfe : -18.24
Hybrid sequence
GGUGGGUUA---CUG--GAUGAGGUucu
CCCCCTGATGGGGGCGAC-ACTCCAcca miR-142-3p
Target on hcv wildtype 
Binding site 7-29
mfe : -12.6
Hybrid sequence
aGGUAUUUCAUCCUUUGUGAUGU
cCCCTGATGGGGGCGACACTCCA miR-433
Target on hcv wildtype 
Binding site 7-36
mfe : -17.3
Hybrid sequence
uGUGGCU--CCUCG------GGUAGUACUa
cCCCTGATGGGGGCGACACTCCACCATGAa miR-491
Target on hcv wildtype 
Binding site 8-31
mfe : -21.8
Hybrid sequence
aGGAGUACCUUC-CCAAGGGGUGa
cCCTGATGGGGGCGACACTCCACc miR-363*
Target on hcv wildtype 
Binding site 11-33
mfe : -11.3
Hybrid sequence
uuUAACGUAGCACU-AGGUGGgc
tgATGGGGGCGACACTCCACCat miR-34a
Target on hcv wildtype 
Binding site 21-45
mfe : -10.1
Hybrid sequence
uUGU-UGGUCG-AUUCUGUGACGGu
gACACTCCACCATGAATCACTCCCc miR-302d
Target on hcv wildtype 
Binding site 22-43
mfe : -12.9
Hybrid sequence
UGUGAGUUUGUACCUUCGUGAau
ACACTCCACCAT-GAATCACTcc miR-373
Target on hcv wildtype 
Binding site 22-43
mfe : -17.7
Hybrid sequence
UGUGGGGUUUUAGCUUCGUGAag
ACACTCCACCAT-GAATCACTcc miR-27b
Target on hcv wildtype 
Binding site 30-51
mfe : -12.4
Hybrid sequence
cGU-CUUGAAUCGGUGACACUu
cCATGAATCACTCCCCTGTGAg miR-27a
Target on hcv wildtype 
Binding site 31-51
mfe : -11.4
Hybrid sequence
cgcCUUGAAUCGGUGACACUu
catGAATCACTCCCCTGTGAg miR-510
Target on hcv wildtype 
Binding site 31-51
mfe : -14.4
Hybrid sequence
acACUAACGGUGAGAGGACUCau
caTGAAT--CACTCCCCTGTGag miR-513
Target on hcv wildtype 
Binding site 32-51
mfe : -21.1
Hybrid sequence
UAUUUACUGUGGAGGGACACUu
ATGAAT--CACTCCCCTGTGAg miR-515-3p
Target on hcv wildtype 
Binding site 37-57
mfe : -11
Hybrid sequence
uGCGAGGUUUUCUUCCGUGAg
tCACTCCCCTGTGAGGAACTa miR-34b
Target on hcv wildtype 
Binding site 38-64
mfe : -11.3
Hybrid sequence
GUUAGUCG--AUUACU--GUGACGGAu
CACTCCCCTGTGAGGAACTACTGTCTt miR-199a*
Target on hcv wildtype 
Binding site 40-62
mfe : -18.3
Hybrid sequence
uuGGUUACACGUC-UGAUGACAu
ctCCCCTGTGAGGAACTACTGTc miR-450
Target on hcv wildtype 
Binding site 46-74
mfe : -14.3
Hybrid sequence
AUAAUCCUUG-UG-UA-----GCGUUUUU
TGTGAGGAACTACTGTCTTCACGCAGAAA miR-7
Target on hcv wildtype 
Binding site 47-67
mfe : -10.8
Hybrid sequence
guuguuUUAGUGAUCAGAAGgu
gtgaggAACTACT-GTCTTCac miR-129
Target on hcv wildtype 
Binding site 51-75
mfe : -14
Hybrid sequence
CGUUCGGGUCUG----GCGUUUUUC
GGAACTACTGTCTTCACGCAGAAAG miR-210
Target on hcv wildtype 
Binding site 51-73
mfe : -16.7
Hybrid sequence
agUCGGCGACAG-UGUGCGUGUc
ggAACTACTGTCTTCACGCAGAa miR-17-3p
Target on hcv wildtype 
Binding site 54-72
mfe : -17
Hybrid sequence
UGUUCACGGAAGUGACGUCa
ACTACTGTCTTCAC-GCAGa miR-24
Target on hcv wildtype 
Binding site 58-85
mfe : -12.3
Hybrid sequence
GAC--AAGGACGACUU-----GACUCGGU
CTGTCTTCACGCAGAAAGCGTCT-AGCCA miR-524
Target on hcv wildtype 
Binding site 61-82
mfe : -13
Hybrid sequence
uGAGGU-UUCCCUUCGCGGAag
tCTTCACGCAGAAAGCGTCTag miR-151
Target on hcv wildtype 
Binding site 62-83
mfe : -11.6
Hybrid sequence
GGAGUUCCUCGAAGUCAGAUCa
CTTCACGCAGAAAGCGTCTAGc miR-135a
Target on hcv wildtype 
Binding site 64-87
mfe : -14.1
Hybrid sequence
AGUGUAUCCUU-AUUUUUCGGUAu
TCACGCAGAAAGCGTCTAGCCATg miR-135b
Target on hcv wildtype 
Binding site 65-87
mfe : -12.5
Hybrid sequence
GUGUAUCCUU-ACUUUUCGGUAu
CACGCAGAAAGCGTCTAGCCATg miR-181a
Target on hcv wildtype 
Binding site 78-104
mfe : -15.1
Hybrid sequence
uGAGUGGCUGUCGCA-----ACUUACAa
tCTAGCC-ATGGCGTTAGTATGAGTGTc miR-181d
Target on hcv wildtype 
Binding site 80-104
mfe : -16.4
Hybrid sequence
uUGGGUGGCUGUUGU--UACUUACAa
tAGCCA-TGGCGTTAGTATGAGTGTc miR-181b
Target on hcv wildtype 
Binding site 82-104
mfe : -16.3
Hybrid sequence
gGGUG--GCUGUCGUUACUUACAa
gCCATGGCGTTAGT-ATGAGTGTc miR-181c
Target on hcv wildtype 
Binding site 83-104
mfe : -10.1
Hybrid sequence
ugagugGCUGUCCAACUUACAa
ccatggCGTTAGTATGAGTGTc miR-16
Target on hcv wildtype 
Binding site 89-113
mfe : -15.2
Hybrid sequence
GCGGUUAUA---AAUGCACGACGau
CGTTAGTATGAGTGTCGTGCAGCct miR-363
Target on hcv wildtype 
Binding site 90-112
mfe : -15.8
Hybrid sequence
augUC-UACCUAUGGCACGUuaa
gttAGTATGAGTGTCGTGCAgcc miR-432
Target on hcv wildtype 
Binding site 93-119
mfe : -14.5
Hybrid sequence
ggugggUUACUGGAU----GAGGUUCU
agtatgAGTGTCGTGCAGCCTCCAGGA miR-432*
Target on hcv wildtype 
Binding site 97-117
mfe : -15.5
Hybrid sequence
uCU-GUACCUCCUCGGUAGGUC
tGAGTGTCGTGCAGCC-TCCAG miR-516-5p
Target on hcv wildtype 
Binding site 97-120
mfe : -17.9
Hybrid sequence
uuUCAC-GAAGAAUGGAGGUCuac
tgAGTGTCGTGCAGCCTCCAGgac miR-485-5p
Target on hcv wildtype 
Binding site 98-115
mfe : -15.7
Hybrid sequence
CUUAAGUAGUGCCGGUCGGAGa
GAGT--GTCGTG--CAGCCTCc miR-492
Target on hcv wildtype 
Binding site 98-122
mfe : -14.49
Hybrid sequence
uUCUUAGAAC--AGGGCGUCCAGGa
gAGTGTCGTGCAGCCTCCAGGACCc miR-431
Target on hcv wildtype 
Binding site 101-121
mfe : -16.2
Hybrid sequence
AC-GUACUGCCGGACGUUCUGu
TGTCGTG-CAGCCTCCAGGACc miR-490
Target on hcv wildtype 
Binding site 101-121
mfe : -20.82
Hybrid sequence
gucGUACCUCAGGAGGUCCaac
tgtCGTGCAG-CCTCCAGGacc miR-518c*
Target on hcv wildtype 
Binding site 115-134
mfe : -17
Hybrid sequence
GUCUUUCACGAAGGGAGGUCUCU
CAGGA---CCCCCCCTCCCGGGA miR-183
Target on hcv wildtype 
Binding site 117-142
mfe : -12.5
Hybrid sequence
gucacuuaaGAUGG---UCACGGUAU
ggaccccccCTCCCGGGAGAGCCATA miR-149
Target on hcv wildtype 
Binding site 118-142
mfe : -11.5
Hybrid sequence
ccucacuucuGUGC---CUCGGUcu
gaccccccctCCCGGGAGAGCCAta