Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HDV target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
 Browse    HDV RNA genome   HDVJS   
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 707 rescords (15 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-miR-2418-12132
gacaaggacgacuugACUCGGU
|||||||
--------------aTGAGCCA
11.006NO
2hsa-miR-362125-13.5151
ugaguguGGAUCCAAG---GUUCCUAA
|| || | | ||||||||
--atgagCCAAGTTCCGAACAAGGATT
NONO
3hsa-miR-375121-17153
agugcgCUCGGCUU---GCUUGUUu
||||| |: |||||||
----atGAGCCAAGTTCCGAACAAg
NONO
4hsa-miR-502124-11.6127
auCGUGGGUCUA---UCGUUCCUA
| :|| || | | |||||||
atGAGCCAAGTTCCGAACAAGGAT
NONO
5hsa-miR-125b433-16.41129
aguGUUCAA-------UCC-CAGAGUCCCU
|||||| ||| || |:||||
agcCAAGTTCCGAACAAGGATTCGCGGGGA
10.846NO
6hsa-miR-127428-25.6169
UCGGUUCGAGUC-UG--CCUAGGCu
|||||||:|| | || ||||:||
AGCCAAGTTCCGAACAAGGATTCGc
5.000NO
7hsa-miR-10a534-17.51121
guGUUUAAG-------CCUAGAUGUCCCau
|||:||| ||||: :|:|||
gcCAAGTTCCGAACAAGGATTCGCGGGGag
7.071NO
8hsa-miR-125a533-13.2128
guGUCCAA----U-UUCC-CAGAGUCCCU
|| ||| | |||| || |:||||
gcCAAGTTCCGAACAAGGATTCGCGGGGA
10.086NO
9hsa-miR-5242351-17.52132
UGAG-GUUUC-CCU------UCGCGGaag
|:|| |:::| ||| ||||||
ATTCGCGGGGAGGATAGATCAGCGCCcga
NONO
10hsa-miR-518e2450-13.82122
ugugagaCUUCC---CU--UCGCGaaa
|:||| || |||||
ttcgcggGGAGGATAGATCAGCGCccg
NONO
11hsa-miR-3452546-15126
cGGGACCUGAUCC--UC-AGUCGu
| | ||: ||| || |||||
tCGCGGGG--AGGATAGATCAGCg
NONO
12hsa-miR-518a2550-14.72123
AGGUCGUUUCC---CU--UCGCGaaa
|| | ::||| || |||||
TCGCGGGGAGGATAGATCAGCGCccg
NONO
13hsa-miR-525*2651-13.4128
cgagauuUCC---CU--UCGCGGaag
||| || ||||||
cgcggggAGGATAGATCAGCGCCcga
NONO
14hsa-miR-542-5p2651-16.8123
GAGCACUGUACUA-CUAG----GGGCU
| || |: | ||| |||| |||||
CGCG-GGGAGGATAGATCAGCGCCCGA
NONO
15hsa-miR-1972761-21.5132
CGACCCACC--UCU----------UC-CACCACUu
|| ||| || ||| || | |||||
GCGGGGAGGATAGATCAGCGCCCGAGAGGGGTGAg
6.957NO
16hsa-miR-3282850-17.9128
ugCCUUCCCGUCU-CUCCCGGuc
||:||| :||| || |||
cgGGGAGGATAGATCAGCGCCcg
NONO
17hsa-miR-191*2950-17.12141
CCCCUGC--UUUAGGUUCGCGucg
||||| | |:||| |||||
GGGGAGGATAGATC--AGCGCccg
NONO
18hsa-miR-3262955-24.8153
gaCCUCCU------UCCCGGG-UCUCC
|||||| || |||| |||||
ggGGAGGATAGATCAGCGCCCGAGAGG
NONO
19hsa-miR-3312958-22.3140
aagaUCCUAUC------CGGG---UCCCCg
||||||| |||| |||||
ggggAGGATAGATCAGCGCCCGAGAGGGGt
NONO
20hsa-miR-5233050-10.22121
gggagaUAUCCCUUCGCGcaa
|||| |||||
gggaggATAGATCAGCGCccg
NONO
21hsa-miR-1493151-12.5125
CCUCACU-UCUGUGCCUCGGUCU
|||| || |||: | | ||| ||
GGAG-GATAGAT-CAGCGCCCGA
5.000NO
22hsa-miR-4833460-20.8155
uCU-UCUGCCCUC---CUCUCCUCACU
|| |||: | | ||||||:||||
gGATAGATCAGCGCCCGAGAGGGGTGA
NONO
23hsa-miR-324-5p3861-24.2147
UGUGGUUACGGGAUC-CCCUACgc
| |:||: |||| || |||:||
AGATCAGCGCCCGAGAGGGGTGag
NONO
24hsa-miR-512-5p4063-19.8135
cuuUCACGGG-AGUUCCGACUCAc
|| |||| |:|| |||||
atcAGCGCCCGAGAGGGGTGAGTc
NONO
25hsa-miR-3394157-12.6125
ACUCGAGGACCUCCUGUCCCu
| ||| || || ||||
TCAGCGCC----CGAGAGGGg
NONO
26hsa-miR-3404566-13.6134
cCGAUAUUUCAUUGACUCUGCCu
|| |:|| :: |||| |||
cGCCCGAGAG-GGGTGAGTCGGt
NONO
27hsa-miR-3454667-21.7134
CGGGACCUGAUC-CUCAGUCGU
|||| || :| |||||:|:|
GCCCGAGAGGGGTGAGTCGGTA
NONO
28hsa-miR-4844766-22.2137
uaGCCCUCCCCUGACUCGGACu
|| |||||| ||||:| |
ccCGAGAGGGG--TGAGTCGGt
NONO
29hsa-miR-3294963-10.59122
uuUCUCCAAUUGGUCCACACAa
||||| |||| ||
cgAGAGG-------GGTGAGTc
NONO
30hsa-miR-199a5079-18127
CU-UGUCCA-UCAG--A---CUUGUGACCc
|| | :||| |||| | ||:||:|||
GAGAGGGGTGAGTCGGTAAAGAGCATTGGa
10.003NO
31hsa-miR-199b5279-13.7121
CUUGUCUAUCAG--AU---UUGUGACCc
||: :| |||| || |:||:|||
GAGGGGTGAGTCGGTAAAGAGCATTGGa
5.000NO
32hsa-miR-4125271-10.5121
ugCCGAUCACCUGGUCCACUUCa
|| :||| ::| ||| |||
gaGG--GGTGAGTC-GGTAAAGa
NONO
33hsa-miR-3375379-13.5125
UUUCCG--UAG-UAUAUCCUCG--ACCU
|::||: :|| :|| | |||| ||||
AGGGGTGAGTCGGTA-AAGAGCATTGGA
NONO
34hsa-miR-1055579-13.7130
ugucCUCAG--A---CUCGUAAACU
||||| | ||||||| ||
gggtGAGTCGGTAAAGAGCATTGGA
5.000NO
35hsa-miR-122a7699-15.2129
uguUUGUGGUAACAGUG-UGAGGu
|||::|: | :|| |||||
tggAACGTCGGAGATACAACTCCc
12.384NO
36hsa-miR-3827698-12.1121
gCUUAGGUGGUGCU-UGUUGAag
|:| | | : || ||||||
tGGAACGTCGGAGATACAACTcc
NONO
37hsa-miR-43278103-15.3130
ggUG-GGUUACUG-GAUGA-GGUUCU
|| :|:: ||: | ||| ||||||
gaACGTCGGAGATACAACTCCCAAGA
NONO
38hsa-miR-526b82104-11.4127
uuGUCUUUCACGAAGGGAGUUCUc
|:||:| | | |:| |||||
gtCGGAGA-TACAACTCCCAAGAa
NONO
39hsa-miR-20592107-10.8121
GUCUGAGGCCACCUUACUUCCU
|| ||||| | ||||||
CA-ACTCC-----CAAGAAGGA
5.000NO
40hsa-miR-21198117-10.5125
uccgCUUCCUACUGUUUCCCUU
|||||| | |||| |||
ccaaGAAGGA--AAAAAGAGAA
5.593NO
41hsa-miR-129109126-11.7128
cgUUCGGGUCUGGCGUUUUUC
||| ||| ||||:|||
aaAAG---AGAAAGCAAGAAG
5.000NO
42hsa-miR-491115144-14.2138
aggaguacCUUC-CC------AAGGGGUga
|||| || |||||||
gaaagcaaGAAGCGGATGAATTTCCCCAta
NONO
43hsa-miR-539117141-11.8125
UGUGUGGUU--CCUA-UUAAAGAGG
| :|| || |||| |||||| ||
AAGCAAGAAGCGGATGAATTTCCCC
NONO
44hsa-miR-193b123153-14.8139
uUUCGCC--CUGAAA-----CUCCCGGUCAa
|||||| || ||| | ||||||
gAAGCGGATGAATTTCCCCATAACGCCAGTg
NONO
45hsa-miR-299-3p124144-16.74132
UUCGCCAAAUGGUAGGGUGUAU
|||||| | | : |||| ||||
AAGCGGATGAATTTCCC-CATA
NONO
46hsa-miR-425125143-14.8134
cCGCCUGUGCUGUAAGGGCUA
|||| |:|| ||||| ||
aGCGG--ATGAATTTCCCCAT
NONO
47hsa-miR-147126145-14.5130
CGUCUUCGUAAAGGUGUGUg
||:|| | |||||| ||:|
GCGGATGAATTTCCCCATAa
5.000NO
48hsa-miR-513130155-10.4133
UAUUUACUGUGG-A--G-GGACACUU
||:||| | || | | || |||||
ATGAATTTCCCCATAACGCCAGTGAA
NONO
49hsa-miR-138137153-15.7130
cuaaGUGUUGUGGUCga
||:|||:||||
tcccCATAACGCCAGtg
5.000NO
50hsa-miR-526c139164-13.6128
uuGUCUUUCG--CGAAGGGAGAUCuc
|| || || |: ||||||
ccCATAACGCCAGTGAAACTCTAGga
NONO
miR-24
Target on HDV 
Binding site 1-8
mfe : -12
Hybrid sequence
gacaaggacgacuugACUCGGU
--------------aTGAGCCA miR-362
Target on HDV 
Binding site 1-25
mfe : -13.5
Hybrid sequence
ugaguguGGAUCCAAG---GUUCCUAA
--atgagCCAAGTTCCGAACAAGGATT miR-375
Target on HDV 
Binding site 1-21
mfe : -17
Hybrid sequence
agugcgCUCGGCUU---GCUUGUUu
----atGAGCCAAGTTCCGAACAAg miR-502
Target on HDV 
Binding site 1-24
mfe : -11.6
Hybrid sequence
auCGUGGGUCUA---UCGUUCCUA
atGAGCCAAGTTCCGAACAAGGAT miR-125b
Target on HDV 
Binding site 4-33
mfe : -16.41
Hybrid sequence
aguGUUCAA-------UCC-CAGAGUCCCU
agcCAAGTTCCGAACAAGGATTCGCGGGGA miR-127
Target on HDV 
Binding site 4-28
mfe : -25.6
Hybrid sequence
UCGGUUCGAGUC-UG--CCUAGGCu
AGCCAAGTTCCGAACAAGGATTCGc miR-10a
Target on HDV 
Binding site 5-34
mfe : -17.51
Hybrid sequence
guGUUUAAG-------CCUAGAUGUCCCau
gcCAAGTTCCGAACAAGGATTCGCGGGGag miR-125a
Target on HDV 
Binding site 5-33
mfe : -13.2
Hybrid sequence
guGUCCAA----U-UUCC-CAGAGUCCCU
gcCAAGTTCCGAACAAGGATTCGCGGGGA miR-524
Target on HDV 
Binding site 23-51
mfe : -17.52
Hybrid sequence
UGAG-GUUUC-CCU------UCGCGGaag
ATTCGCGGGGAGGATAGATCAGCGCCcga miR-518e
Target on HDV 
Binding site 24-50
mfe : -13.82
Hybrid sequence
ugugagaCUUCC---CU--UCGCGaaa
ttcgcggGGAGGATAGATCAGCGCccg miR-345
Target on HDV 
Binding site 25-46
mfe : -15
Hybrid sequence
cGGGACCUGAUCC--UC-AGUCGu
tCGCGGGG--AGGATAGATCAGCg miR-518a
Target on HDV 
Binding site 25-50
mfe : -14.72
Hybrid sequence
AGGUCGUUUCC---CU--UCGCGaaa
TCGCGGGGAGGATAGATCAGCGCccg miR-525*
Target on HDV 
Binding site 26-51
mfe : -13.4
Hybrid sequence
cgagauuUCC---CU--UCGCGGaag
cgcggggAGGATAGATCAGCGCCcga miR-542-5p
Target on HDV 
Binding site 26-51
mfe : -16.8
Hybrid sequence
GAGCACUGUACUA-CUAG----GGGCU
CGCG-GGGAGGATAGATCAGCGCCCGA miR-197
Target on HDV 
Binding site 27-61
mfe : -21.5
Hybrid sequence
CGACCCACC--UCU----------UC-CACCACUu
GCGGGGAGGATAGATCAGCGCCCGAGAGGGGTGAg miR-328
Target on HDV 
Binding site 28-50
mfe : -17.9
Hybrid sequence
ugCCUUCCCGUCU-CUCCCGGuc
cgGGGAGGATAGATCAGCGCCcg miR-191*
Target on HDV 
Binding site 29-50
mfe : -17.12
Hybrid sequence
CCCCUGC--UUUAGGUUCGCGucg
GGGGAGGATAGATC--AGCGCccg miR-326
Target on HDV 
Binding site 29-55
mfe : -24.8
Hybrid sequence
gaCCUCCU------UCCCGGG-UCUCC
ggGGAGGATAGATCAGCGCCCGAGAGG miR-331
Target on HDV 
Binding site 29-58
mfe : -22.3
Hybrid sequence
aagaUCCUAUC------CGGG---UCCCCg
ggggAGGATAGATCAGCGCCCGAGAGGGGt miR-523
Target on HDV 
Binding site 30-50
mfe : -10.22
Hybrid sequence
gggagaUAUCCCUUCGCGcaa
gggaggATAGATCAGCGCccg miR-149
Target on HDV 
Binding site 31-51
mfe : -12.5
Hybrid sequence
CCUCACU-UCUGUGCCUCGGUCU
GGAG-GATAGAT-CAGCGCCCGA miR-483
Target on HDV 
Binding site 34-60
mfe : -20.8
Hybrid sequence
uCU-UCUGCCCUC---CUCUCCUCACU
gGATAGATCAGCGCCCGAGAGGGGTGA miR-324-5p
Target on HDV 
Binding site 38-61
mfe : -24.2
Hybrid sequence
UGUGGUUACGGGAUC-CCCUACgc
AGATCAGCGCCCGAGAGGGGTGag miR-512-5p
Target on HDV 
Binding site 40-63
mfe : -19.8
Hybrid sequence
cuuUCACGGG-AGUUCCGACUCAc
atcAGCGCCCGAGAGGGGTGAGTc miR-339
Target on HDV 
Binding site 41-57
mfe : -12.6
Hybrid sequence
ACUCGAGGACCUCCUGUCCCu
TCAGCGCC----CGAGAGGGg miR-340
Target on HDV 
Binding site 45-66
mfe : -13.6
Hybrid sequence
cCGAUAUUUCAUUGACUCUGCCu
cGCCCGAGAG-GGGTGAGTCGGt miR-345
Target on HDV 
Binding site 46-67
mfe : -21.7
Hybrid sequence
CGGGACCUGAUC-CUCAGUCGU
GCCCGAGAGGGGTGAGTCGGTA miR-484
Target on HDV 
Binding site 47-66
mfe : -22.2
Hybrid sequence
uaGCCCUCCCCUGACUCGGACu
ccCGAGAGGGG--TGAGTCGGt miR-329
Target on HDV 
Binding site 49-63
mfe : -10.59
Hybrid sequence
uuUCUCCAAUUGGUCCACACAa
cgAGAGG-------GGTGAGTc miR-199a
Target on HDV 
Binding site 50-79
mfe : -18
Hybrid sequence
CU-UGUCCA-UCAG--A---CUUGUGACCc
GAGAGGGGTGAGTCGGTAAAGAGCATTGGa miR-199b
Target on HDV 
Binding site 52-79
mfe : -13.7
Hybrid sequence
CUUGUCUAUCAG--AU---UUGUGACCc
GAGGGGTGAGTCGGTAAAGAGCATTGGa miR-412
Target on HDV 
Binding site 52-71
mfe : -10.5
Hybrid sequence
ugCCGAUCACCUGGUCCACUUCa
gaGG--GGTGAGTC-GGTAAAGa miR-337
Target on HDV 
Binding site 53-79
mfe : -13.5
Hybrid sequence
UUUCCG--UAG-UAUAUCCUCG--ACCU
AGGGGTGAGTCGGTA-AAGAGCATTGGA miR-105
Target on HDV 
Binding site 55-79
mfe : -13.7
Hybrid sequence
ugucCUCAG--A---CUCGUAAACU
gggtGAGTCGGTAAAGAGCATTGGA miR-122a
Target on HDV 
Binding site 76-99
mfe : -15.2
Hybrid sequence
uguUUGUGGUAACAGUG-UGAGGu
tggAACGTCGGAGATACAACTCCc miR-382
Target on HDV 
Binding site 76-98
mfe : -12.1
Hybrid sequence
gCUUAGGUGGUGCU-UGUUGAag
tGGAACGTCGGAGATACAACTcc miR-432
Target on HDV 
Binding site 78-103
mfe : -15.3
Hybrid sequence
ggUG-GGUUACUG-GAUGA-GGUUCU
gaACGTCGGAGATACAACTCCCAAGA miR-526b
Target on HDV 
Binding site 82-104
mfe : -11.4
Hybrid sequence
uuGUCUUUCACGAAGGGAGUUCUc
gtCGGAGA-TACAACTCCCAAGAa miR-205
Target on HDV 
Binding site 92-107
mfe : -10.8
Hybrid sequence
GUCUGAGGCCACCUUACUUCCU
CA-ACTCC-----CAAGAAGGA miR-211
Target on HDV 
Binding site 98-117
mfe : -10.5
Hybrid sequence
uccgCUUCCUACUGUUUCCCUU
ccaaGAAGGA--AAAAAGAGAA miR-129
Target on HDV 
Binding site 109-126
mfe : -11.7
Hybrid sequence
cgUUCGGGUCUGGCGUUUUUC
aaAAG---AGAAAGCAAGAAG miR-491
Target on HDV 
Binding site 115-144
mfe : -14.2
Hybrid sequence
aggaguacCUUC-CC------AAGGGGUga
gaaagcaaGAAGCGGATGAATTTCCCCAta miR-539
Target on HDV 
Binding site 117-141
mfe : -11.8
Hybrid sequence
UGUGUGGUU--CCUA-UUAAAGAGG
AAGCAAGAAGCGGATGAATTTCCCC miR-193b
Target on HDV 
Binding site 123-153
mfe : -14.8
Hybrid sequence
uUUCGCC--CUGAAA-----CUCCCGGUCAa
gAAGCGGATGAATTTCCCCATAACGCCAGTg miR-299-3p
Target on HDV 
Binding site 124-144
mfe : -16.74
Hybrid sequence
UUCGCCAAAUGGUAGGGUGUAU
AAGCGGATGAATTTCCC-CATA miR-425
Target on HDV 
Binding site 125-143
mfe : -14.8
Hybrid sequence
cCGCCUGUGCUGUAAGGGCUA
aGCGG--ATGAATTTCCCCAT miR-147
Target on HDV 
Binding site 126-145
mfe : -14.5
Hybrid sequence
CGUCUUCGUAAAGGUGUGUg
GCGGATGAATTTCCCCATAa miR-513
Target on HDV 
Binding site 130-155
mfe : -10.4
Hybrid sequence
UAUUUACUGUGG-A--G-GGACACUU
ATGAATTTCCCCATAACGCCAGTGAA miR-138
Target on HDV 
Binding site 137-153
mfe : -15.7
Hybrid sequence
cuaaGUGUUGUGGUCga
tcccCATAACGCCAGtg miR-526c
Target on HDV 
Binding site 139-164
mfe : -13.6
Hybrid sequence
uuGUCUUUCG--CGAAGGGAGAUCuc
ccCATAACGCCAGTGAAACTCTAGga