Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HEV target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
 Browse   Structural and nonstructural protein mRNA, complete cds   Complete cds   mexican strain) structural proteins and a nonstructural polyprotein genes, complete cds   nonstructural polyprotein and putative capsid protein genes, complete cds   
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 3298 rescords (66 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-miR-296114-10.9138
uguccuaacuccCCCCCGGGa
|| |||||
-------gccatGGAGGCCCa
7.400NO
2hsa-miR-432*119-20.9138
uCUGUACCUCCUCGGUAGguc
| |||||||| |||||
-GCCATGGAGG-CCCATCagt
NONO
3hsa-miR-281434-12.4134
gAGUUAUCUGACACUCGAGGAa
|||:| |:| :||||||
aTCAGTTTATT-AAGGCTCCTg
8.778NO
4hsa-miR-221541-12127
uGUCAAGAAGUU-----GACCGUCGaa
|||||: |:|| |||||| |
tCAGTTTATTAAGGCTCCTGGCATCac
10.264NO
5hsa-miR-512-3p2143-10.5123
cuggaguCGA-UACUGUCGUGAa
||| ||:|| ||||
tattaagGCTCCTGGCATCACTa
NONO
6hsa-miR-199a*2948-11133
uuGGUUACACGU-CUGAUGACau
|| || ||| |||||||
ctCC--TG-GCATCACTACTGct
9.369NO
7hsa-miR-3373159-13.9144
uuuCCGUAGU-AUAUC-----CUCGACCu
||||||| || | |||| ||
cctGGCATCACTACTGCTATTGAGCAGGc
NONO
8hsa-miR-243257-14.5125
GAC--AAG-GACGAC-UUGACUCGgu
||| || || ||| |:|||||
CTGGCATCACTACTGCTATTGAGCag
11.006NO
9hsa-miR-1033863-13.2133
AGU-AU--CGG-GACAUGUUACGACGA
||| || ||: :|| :| | ||||||
TCACTACTGCTATTGAGC-AGGCTGCT
9.493NO
10hsa-miR-15a3964-14.7134
GUGUU--UGGUAAUAC--ACGACGAu
||| | :|:|||: | ||||||
CACTACTGCTATTGAGCAGGCTGCTc
9.991NO
11hsa-miR-34b3966-13.1125
GUUA-GUCGAUUACU-G--UGACG-GAU
|| | | |||| ||| | :|||| |||
CACTACTGCTATTGAGCAGGCTGCTCTA
7.593NO
12hsa-miR-1074163-13.2129
acuauCGG-GACAUGUUACGACGA
||: :|| :| | ||||||
ctactGCTATTGAGC-AGGCTGCT
9.255NO
13hsa-miR-164264-14.1131
gcGGUUAUAAAU-GCACGACGAu
|:: |||| | | ||||||
taCTGCTATTGAGCAGGCTGCTc
11.196NO
14hsa-miR-15b4364-12.8128
acauuugguacuacaCGACGAu
||||||
actgctattgagcagGCTGCTc
9.090NO
15hsa-miR-224364-10.9147
UGUCAAGAAGUUGACCGUCGAa
|| | | || |:| ||| |||
ACTGCTATTGAGCAGGCTGCTc
10.264NO
16hsa-miR-4244364-13.3128
aaguuuuguacuuaaCGACGAc
||||||
actgctattgagcagGCTGCTc
NONO
17hsa-miR-1954464-11.1128
cgguuauaaagacaCGACGAu
||||||
ctgctattgagcagGCTGCTc
9.451NO
18hsa-miR-4974464-11128
uguuuggugucacaCGACGAc
||||||
ctgctattgagcagGCTGCTc
NONO
19hsa-miR-5034464-15.8136
GACGUCUUGACAAGGGCGACGAu
|||| |:|| | ||||||
CTGC--TATTGAGCAGGCTGCTc
NONO
20hsa-miR-526c4669-12.1129
uugucuuUCG--CGAAGGGAGAUCuc
||| ||| ||||||
gctattgAGCAGGCT--GCTCTAGca
NONO
21hsa-miR-133a5177-15121
ugUCGACCAAC---UUC--CCCUGGUU
||| || || || | |:||||
tgAGCAGGCTGCTCTAGCAGCGGCCAA
5.000NO
22hsa-miR-193b5179-14.12130
uuUCGCCC--UGA-AAC-UC-CCGGUcaa
||| || :|| | | || |||||
tgAGCAGGCTGCTCTAGCAGCGGCCAact
NONO
23hsa-miR-3285177-16.2129
ugcCUUCC--CG-UCUC-UC-CCGGUc
| ||| || || || |||||
tgaGCAGGCTGCTCTAGCAGCGGCCAa
NONO
24hsa-miR-517*5171-11123
uCU-GUCACGAAGGUAGAUC-UCc
|| ||| ||| | ||||| ||
tGAGCAG-GCTGC--TCTAGCAGc
NONO
25hsa-miR-518f*5169-11.8130
uCUCUUUCACGAAGGGAGAUCuc
||| || ||| ||||||
tGAG-CAG-GCT--GCTCTAGca
NONO
26hsa-miR-526a5169-10.5127
uCUU-UCACGAAGGGAGAUCuc
||: || ||| ||||||
tGAGCAG-GCT--GCTCTAGca
NONO
27hsa-miR-133b5277-15121
aUCGACCAAC---UUC--CCCUGGUU
||| || || || | |:||||
gAGCAGGCTGCTCTAGCAGCGGCCAA
NONO
28hsa-miR-3705472-20.6134
gGUCCAAGGUGGGGUCGUCcg
|||| |::|:|:|||||
gCAGG--CTGCTCTAGCAGcg
NONO
29hsa-miR-34c6385-17151
cGUUAGUCGAUUGAUGUGACGGa
| | |||| : | || |||||
tCTAGCAGCGGCCAACTCTGCCc
6.403NO
30hsa-miR-34a6685-14.5143
UUGUUGGUCGAUUCUGUGACGGu
|:||: |:|| | || |||||
AGCAG-CGGCCA--ACTCTGCCc
7.376NO
31hsa-miR-4496685-13.6145
UGGUCGAUUGUUAUGUGACGGu
| |||| : || || |||||
AGCAGCGGCCA--ACTCTGCCc
NONO
32hsa-miR-27a70101-17.4124
CGCC--UUGAAUCGG---------UGACACuu
|||| |||| ||| :|||||
GCGGCCAACTCTGCCCTTGCGAATGCTGTGgt
10.858NO
33hsa-miR-324-5p7196-15.72123
uguGGUU---ACGGGAUCCCCUACGc
|||| |||||| | | ||||
cggCCAACTCTGCCCTTGCGAATGCt
NONO
34hsa-miR-1672100-11.9123
gCGGUU-AUA----AAUGC--ACGACgau
||||| | | ||:|| |||||
gGCCAACTCTGCCCTTGCGAATGCTGtgg
11.196NO
35hsa-miR-1827293-11.2123
acacucaAGAUGGUAACGGUUu
|||:|| |||| ||
ggccaacTCTGCCCTTGCGAAt
5.000NO
36hsa-miR-2177299-12.9131
uaGGUU-AGUCAAGGAC---UACGUCAu
|||| || | |:|| |||| ||
ggCCAACTCTGCCCTTGCGAATGCTGTg
5.000NO
37hsa-miR-512-5p76101-15.2125
cuuucACGGGA--G-UUCCGACUCac
|||||| | || |||| |
aactcTGCCCTTGCGAATGCTGTGgt
NONO
38hsa-miR-1037799-17.7146
aguauCGGGACAUG-UUACGACga
||||| |:| |||||||
actctGCCCT-TGCGAATGCTGtg
9.493NO
39hsa-miR-1077799-17.1146
acuauCGGGACAUG-UUACGACga
||||| |:| |||||||
actctGCCCT-TGCGAATGCTGtg
9.255NO
40hsa-miR-33077100-14.6133
aGAGACGUCCGGCAC----ACGAAACg
|||||| || || |||| ||
aCTCTGC---CCTTGCGAATGCTGTGg
NONO
41hsa-miR-324-3p85106-11123
GGUCGUCGUG-GACCCCGUCAcc
|: || | |: ||| ||:|||
CTTGC-GAATGCTGTGGTAGTta
NONO
42hsa-miR-185103121-15.1138
cuugaCGG-AAAGAGAGgu
||| ||||||||
gttagGCCTTTTCTCTCtc
6.327NO
43hsa-miR-370104131-15144
ggUCC----AAG---GUGGGGUCGUCcg
||| ||| | | |||||||
ttAGGCCTTTTCTCTCTCACCAGCAGat
NONO
44hsa-miR-138111128-11.5155
cuAAGUG-UUGUGGUCGa
||| | |||||||
ttTTCTCTCTCACCAGCa
5.000Yes
45hsa-miR-320111131-17.46125
AAGCGGGAGAGUUGGGUCGaaaa
||: |:|||||| |||||
TTTTCTCTCTCA--CCAGCagat
10.314NO
46hsa-miR-216115139-12.2127
GUGUCAACGGUCG----ACUCUAau
| | | ||||| ||||||
CTCTCTCACCAGCAGATTGAGATcc
5.000NO
47hsa-miR-28119141-14137
GAGUUAUCUGAC--ACUCGAGGAA
|||| || | | |||| |||||
CTCACCAG-CAGATTGAGATCCTT
8.778NO
48hsa-let-7b136161-16.5138
UUGGUGU-GUUGGAU---GAUGGAGu
| || :| :|||||| | |||||
ATCCTTATTAACCTAATGCAACCTCg
11.726NO
49hsa-let-7c136161-16.5142
UUGGUAU-GUUGGAU---GAUGGAGu
| || || :|||||| | |||||
ATCCTTATTAACCTAATGCAACCTCg
11.774NO
50hsa-let-7a138161-15.2136
uugAUAUGUUGGAU---GAUGGAGu
||| :|||||| | |||||
cctTAT-TAACCTAATGCAACCTCg
11.678NO
miR-296
Target on HEV 
Binding site 1-14
mfe : -10.9
Hybrid sequence
uguccuaacuccCCCCCGGGa
-------gccatGGAGGCCCa miR-432*
Target on HEV 
Binding site 1-19
mfe : -20.9
Hybrid sequence
uCUGUACCUCCUCGGUAGguc
-GCCATGGAGG-CCCATCagt miR-28
Target on HEV 
Binding site 14-34
mfe : -12.4
Hybrid sequence
gAGUUAUCUGACACUCGAGGAa
aTCAGTTTATT-AAGGCTCCTg miR-22
Target on HEV 
Binding site 15-41
mfe : -12
Hybrid sequence
uGUCAAGAAGUU-----GACCGUCGaa
tCAGTTTATTAAGGCTCCTGGCATCac miR-512-3p
Target on HEV 
Binding site 21-43
mfe : -10.5
Hybrid sequence
cuggaguCGA-UACUGUCGUGAa
tattaagGCTCCTGGCATCACTa miR-199a*
Target on HEV 
Binding site 29-48
mfe : -11
Hybrid sequence
uuGGUUACACGU-CUGAUGACau
ctCC--TG-GCATCACTACTGct miR-337
Target on HEV 
Binding site 31-59
mfe : -13.9
Hybrid sequence
uuuCCGUAGU-AUAUC-----CUCGACCu
cctGGCATCACTACTGCTATTGAGCAGGc miR-24
Target on HEV 
Binding site 32-57
mfe : -14.5
Hybrid sequence
GAC--AAG-GACGAC-UUGACUCGgu
CTGGCATCACTACTGCTATTGAGCag miR-103
Target on HEV 
Binding site 38-63
mfe : -13.2
Hybrid sequence
AGU-AU--CGG-GACAUGUUACGACGA
TCACTACTGCTATTGAGC-AGGCTGCT miR-15a
Target on HEV 
Binding site 39-64
mfe : -14.7
Hybrid sequence
GUGUU--UGGUAAUAC--ACGACGAu
CACTACTGCTATTGAGCAGGCTGCTc miR-34b
Target on HEV 
Binding site 39-66
mfe : -13.1
Hybrid sequence
GUUA-GUCGAUUACU-G--UGACG-GAU
CACTACTGCTATTGAGCAGGCTGCTCTA miR-107
Target on HEV 
Binding site 41-63
mfe : -13.2
Hybrid sequence
acuauCGG-GACAUGUUACGACGA
ctactGCTATTGAGC-AGGCTGCT miR-16
Target on HEV 
Binding site 42-64
mfe : -14.1
Hybrid sequence
gcGGUUAUAAAU-GCACGACGAu
taCTGCTATTGAGCAGGCTGCTc miR-15b
Target on HEV 
Binding site 43-64
mfe : -12.8
Hybrid sequence
acauuugguacuacaCGACGAu
actgctattgagcagGCTGCTc miR-22
Target on HEV 
Binding site 43-64
mfe : -10.9
Hybrid sequence
UGUCAAGAAGUUGACCGUCGAa
ACTGCTATTGAGCAGGCTGCTc miR-424
Target on HEV 
Binding site 43-64
mfe : -13.3
Hybrid sequence
aaguuuuguacuuaaCGACGAc
actgctattgagcagGCTGCTc miR-195
Target on HEV 
Binding site 44-64
mfe : -11.1
Hybrid sequence
cgguuauaaagacaCGACGAu
ctgctattgagcagGCTGCTc miR-497
Target on HEV 
Binding site 44-64
mfe : -11
Hybrid sequence
uguuuggugucacaCGACGAc
ctgctattgagcagGCTGCTc miR-503
Target on HEV 
Binding site 44-64
mfe : -15.8
Hybrid sequence
GACGUCUUGACAAGGGCGACGAu
CTGC--TATTGAGCAGGCTGCTc miR-526c
Target on HEV 
Binding site 46-69
mfe : -12.1
Hybrid sequence
uugucuuUCG--CGAAGGGAGAUCuc
gctattgAGCAGGCT--GCTCTAGca miR-133a
Target on HEV 
Binding site 51-77
mfe : -15
Hybrid sequence
ugUCGACCAAC---UUC--CCCUGGUU
tgAGCAGGCTGCTCTAGCAGCGGCCAA miR-193b
Target on HEV 
Binding site 51-79
mfe : -14.12
Hybrid sequence
uuUCGCCC--UGA-AAC-UC-CCGGUcaa
tgAGCAGGCTGCTCTAGCAGCGGCCAact miR-328
Target on HEV 
Binding site 51-77
mfe : -16.2
Hybrid sequence
ugcCUUCC--CG-UCUC-UC-CCGGUc
tgaGCAGGCTGCTCTAGCAGCGGCCAa miR-517*
Target on HEV 
Binding site 51-71
mfe : -11
Hybrid sequence
uCU-GUCACGAAGGUAGAUC-UCc
tGAGCAG-GCTGC--TCTAGCAGc miR-518f*
Target on HEV 
Binding site 51-69
mfe : -11.8
Hybrid sequence
uCUCUUUCACGAAGGGAGAUCuc
tGAG-CAG-GCT--GCTCTAGca miR-526a
Target on HEV 
Binding site 51-69
mfe : -10.5
Hybrid sequence
uCUU-UCACGAAGGGAGAUCuc
tGAGCAG-GCT--GCTCTAGca miR-133b
Target on HEV 
Binding site 52-77
mfe : -15
Hybrid sequence
aUCGACCAAC---UUC--CCCUGGUU
gAGCAGGCTGCTCTAGCAGCGGCCAA miR-370
Target on HEV 
Binding site 54-72
mfe : -20.6
Hybrid sequence
gGUCCAAGGUGGGGUCGUCcg
gCAGG--CTGCTCTAGCAGcg miR-34c
Target on HEV 
Binding site 63-85
mfe : -17
Hybrid sequence
cGUUAGUCGAUUGAUGUGACGGa
tCTAGCAGCGGCCAACTCTGCCc miR-34a
Target on HEV 
Binding site 66-85
mfe : -14.5
Hybrid sequence
UUGUUGGUCGAUUCUGUGACGGu
AGCAG-CGGCCA--ACTCTGCCc miR-449
Target on HEV 
Binding site 66-85
mfe : -13.6
Hybrid sequence
UGGUCGAUUGUUAUGUGACGGu
AGCAGCGGCCA--ACTCTGCCc miR-27a
Target on HEV 
Binding site 70-101
mfe : -17.4
Hybrid sequence
CGCC--UUGAAUCGG---------UGACACuu
GCGGCCAACTCTGCCCTTGCGAATGCTGTGgt miR-324-5p
Target on HEV 
Binding site 71-96
mfe : -15.72
Hybrid sequence
uguGGUU---ACGGGAUCCCCUACGc
cggCCAACTCTGCCCTTGCGAATGCt miR-16
Target on HEV 
Binding site 72-100
mfe : -11.9
Hybrid sequence
gCGGUU-AUA----AAUGC--ACGACgau
gGCCAACTCTGCCCTTGCGAATGCTGtgg miR-182
Target on HEV 
Binding site 72-93
mfe : -11.2
Hybrid sequence
acacucaAGAUGGUAACGGUUu
ggccaacTCTGCCCTTGCGAAt miR-217
Target on HEV 
Binding site 72-99
mfe : -12.9
Hybrid sequence
uaGGUU-AGUCAAGGAC---UACGUCAu
ggCCAACTCTGCCCTTGCGAATGCTGTg miR-512-5p
Target on HEV 
Binding site 76-101
mfe : -15.2
Hybrid sequence
cuuucACGGGA--G-UUCCGACUCac
aactcTGCCCTTGCGAATGCTGTGgt miR-103
Target on HEV 
Binding site 77-99
mfe : -17.7
Hybrid sequence
aguauCGGGACAUG-UUACGACga
actctGCCCT-TGCGAATGCTGtg miR-107
Target on HEV 
Binding site 77-99
mfe : -17.1
Hybrid sequence
acuauCGGGACAUG-UUACGACga
actctGCCCT-TGCGAATGCTGtg miR-330
Target on HEV 
Binding site 77-100
mfe : -14.6
Hybrid sequence
aGAGACGUCCGGCAC----ACGAAACg
aCTCTGC---CCTTGCGAATGCTGTGg miR-324-3p
Target on HEV 
Binding site 85-106
mfe : -11
Hybrid sequence
GGUCGUCGUG-GACCCCGUCAcc
CTTGC-GAATGCTGTGGTAGTta miR-185
Target on HEV 
Binding site 103-121
mfe : -15.1
Hybrid sequence
cuugaCGG-AAAGAGAGgu
gttagGCCTTTTCTCTCtc miR-370
Target on HEV 
Binding site 104-131
mfe : -15
Hybrid sequence
ggUCC----AAG---GUGGGGUCGUCcg
ttAGGCCTTTTCTCTCTCACCAGCAGat miR-138
Target on HEV 
Binding site 111-128
mfe : -11.5
Hybrid sequence
cuAAGUG-UUGUGGUCGa
ttTTCTCTCTCACCAGCa miR-320
Target on HEV 
Binding site 111-131
mfe : -17.46
Hybrid sequence
AAGCGGGAGAGUUGGGUCGaaaa
TTTTCTCTCTCA--CCAGCagat miR-216
Target on HEV 
Binding site 115-139
mfe : -12.2
Hybrid sequence
GUGUCAACGGUCG----ACUCUAau
CTCTCTCACCAGCAGATTGAGATcc miR-28
Target on HEV 
Binding site 119-141
mfe : -14
Hybrid sequence
GAGUUAUCUGAC--ACUCGAGGAA
CTCACCAG-CAGATTGAGATCCTT let-7b
Target on HEV 
Binding site 136-161
mfe : -16.5
Hybrid sequence
UUGGUGU-GUUGGAU---GAUGGAGu
ATCCTTATTAACCTAATGCAACCTCg let-7c
Target on HEV 
Binding site 136-161
mfe : -16.5
Hybrid sequence
UUGGUAU-GUUGGAU---GAUGGAGu
ATCCTTATTAACCTAATGCAACCTCg let-7a
Target on HEV 
Binding site 138-161
mfe : -15.2
Hybrid sequence
uugAUAUGUUGGAU---GAUGGAGu
cctTAT-TAACCTAATGCAACCTCg