Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HGV target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
 Browse   strain Iowan, complete genome   wildtype(complete genome)   
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 4148 rescords (83 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-miR-917801802-14.9121
aguaugucGAUCUAUUGGUUUCu
||:|: |||||::|
gggggcccCTGGGCAACCAGGGc
5.114NO
2hsa-miR-989969023-16.3121
aGUAUGUCGAUCUA------UUGGUUUCu
||| || :|:||| |:|||:||
aCAT-CAATTGGATTTCACAAGCCAGAGg
5.114NO
3hsa-let-7b66876706-16.1121
uUGGUG-UGUUGGAUGAUGGAGU
| |:| || ||| :|:|||||
gAGCGCTAC-ACC--TTGCCTCA
11.726NO
4hsa-let-7e66866706-13.9121
ugauauGUUGGAGGAUGGAGU
| || |:|:|||||
ggagcgCTACACCTTGCCTCA
6.037NO
5hsa-let-7e78317851-13.8121
ugaUAUGUUGGAGGAUGGAGU
| | ::|| || :|||||
aggAGAAGGCCCCCCGCCTCA
6.037NO
6hsa-let-7g41874210-12.6121
uGACAUGU-UUGAUGA--UGGAGu
|| |||: || :|| |||||
gCTCTACGCCACCGCTACACCTCc
9.988NO
7hsa-let-7i32743293-14.4121
ugucGUGUUUGAUGAUGGAgu
|||||| :||:|||
gggtCACAAA-GGCTGCCTtg
7.883NO
8hsa-miR-10042634285-14.7121
guGUUC-AAGCCUAGAUGCCCaa
|:|| ||| |:||:|||
ggCGAGATTCCCTTTTATGGGca
9.137NO
9hsa-miR-10384428468-13.2121
aGUAUCGG--GA--CAUGUUACGACga
| |:||: || ||:|||||| |
aCTTGGCTTGCTGAGTGCAATGCAGat
9.493NO
10hsa-miR-106a92259251-13.25121
cgauGGAC-GUGAC-AUU-CGUGAaaa
|||| :: || ||| |||||
aaagCCTGATGGTGCTAATGCACTgcc
8.618NO
11hsa-miR-106a12221251-14.2121
CGAUGGACG-------UGACAUUCGUGAAAA
||| |:||| || || ||::||||
GCT-CTTGCAGGGCCAACGGTTCGCGTTTTT
8.618NO
12hsa-miR-125a52595285-12121
GU-GUCCA--AUUUCCCA-GAGUCCcu
|| | ||| |: ||| | ||| ||
CAGCCGGTGGTGCAGGTTCCTCCGGta
10.086NO
13hsa-miR-125a21092132-15.8121
gUGUCC-AAU-UUCCCAGAGUCCCu
|::|| ||| | ||| |||||
gATGGGTTTATACATGTC-CAGGGt
10.086NO
14hsa-miR-125a75337564-14.2121
gUG-UCC-----AAUUUCCCA-GAG--UCCCu
|| ||| || :| || ||| ||||
gACAAGGTGACCTTCTGGCGTGCTCCTAGGGt
10.086NO
15hsa-miR-125b89368961-12.3121
aGUGUUCAAUC--CC--AGAGUCCCu
| ::|| | | || || |:|||
cCCTGAGATTGCTGGTATCCCGGGGg
10.846NO
16hsa-miR-125b60976124-19.9121
aGUGU--UCAAU---CCCAG-AGUCCCU
|||| :|||: |||| ||||||
gCACAGTGGTTGCCCTGGTCAACAGGGA
10.846NO
17hsa-miR-12623582377-13121
cguaauaaUGAGUGCCAUGCu
|||| |||| ||
tgtctgggACTCCCGGT-CGt
10.720NO
18hsa-miR-12692449264-12.9121
CGUAAUAAUGAGUGCCA-UGCu
||| |: |||: |||| :||
GCACTGCCACTT-CGGTGGCGg
10.720NO
19hsa-miR-12761076129-14.71121
uCGGUUCGAGUCUG--CCUAGGcu
||| | ||| || ||| ||
tGCCCTGGTCA-ACAGGGAGCCta
5.000NO
20hsa-miR-12791649184-14.2121
uCGGUUCGAGUCUGCCUAGGCu
||:::| | | | ||: |||
cGCTGGG-TAAAAAGGGCCCGg
5.000NO
21hsa-miR-128a91739202-18.1121
UUUUCUCUGGCC--AA------GUGACACu
|||||:| |||| || ||: |||
AAAAGGGCCCGGCCTTGGGAGGCATGGTGg
5.472NO
22hsa-miR-128b50945113-12.9121
CUUUCUCUGGCCAAGUGACACU
||::| || || |:||| ||
GAGGGTTAC--GTCCGCTGCGA
5.226NO
23hsa-miR-130b90499071-18.1121
uaCGGGA-AAGUAGUAACGUGAc
||||| |||||:| || ||
taGCCCTGCTCATCGTAGCCCTc
5.095NO
24hsa-miR-13255195541-14.6121
GCUGGUACCGACAU-CUGACAau
|| | : || || : |:||||
CGCCGGAGGGTGGGCGGCTGTgg
5.000NO
25hsa-miR-133a23192346-12.9121
uguCGACCAACUUC-------CCCUGGuu
|| || |||:| ||| ||
gtgGCAGG-TGAGGTCTTCGCGGGCCCtg
5.000NO
26hsa-miR-133a66716692-13.8121
ugucgaccAACUUCCCCUGGuu
|||| ||||| |
tgttaccaTTGACGGGGAGCgc
5.000NO
27hsa-miR-133a50065027-15.72121
UGUCGACCAACUUC-CCCUGGUu
|| || | |||:| |||:| |
ACTCCT-GCTGAGGTGGGGCAAt
5.000NO
28hsa-miR-133b24812506-18.4121
auCGACC-----AACUUCCCCUgguu
||||| |||| |||||
ccGCTGGCCCTCTTGATGGGGAtttc
NONO
29hsa-miR-133b13421364-12.8121
aUCG--A-CCAACUUCCC-CUGGuu
||| | || || ||| ||||
aAGCAATCGGCTG--GGGTGACCcc
NONO
30hsa-miR-133b65196541-15121
aucgACCA--ACUUCCCCUGGuu
|||| | |:| |||||
cacgTGGTAATCAGGAGGACCtc
NONO
31hsa-miR-133b66726692-13.8121
aucgaccAACUUCCCCUGGuu
|||| ||||| |
gttaccaTTGACGGGGAGCgc
NONO
32hsa-miR-135a46494673-15.62121
agUGUAUCCUUAUU--UUUCGGuau
||: :||::|:: ||||||
ctACGCGGGGGTGGGCAAAGCCcct
NONO
33hsa-miR-13642364260-14.3121
AGGUAGUAGUUUUG--UUUACCUca
||||| ||::|:|| || ||||
TCCATAATTGAGACAAAATTGGAcg
7.279NO
34hsa-miR-13637883808-13121
AGGUAGUAGUUUUGUUUACCUCA
|||: :: | ::| || |||||
TCCGGTGCC--GGCCAAAGGAGT
7.279NO
35hsa-miR-142-3p25582579-12121
AGGUA--UUUCAUCCUUUGUGAUGu
| ||| :|:|| || ||||| |
TACATTCGAGGT-GG--ACACTTCg
9.468NO
36hsa-miR-14383848410-12.5121
ACUCGAUGU-CAC-----GAAGUAGAGU
||:| |||: ||| | |||| |||
TGGG-TACGCGTGCGAGCCCTCATATCA
10.136NO
37hsa-miR-14517791802-23.8121
UUCCCUAAGGACCCUUUUGACCUG
|:|||: |||||| || | ||:|
AGGGGGCCCCTGGGCAACCAGGGC
11.062NO
38hsa-miR-14744584478-15.76121
cGUCUUCGU-AAAGGUGugug
|||| ||: |||||||
aCAGACGCGCTTTCCACtggg
5.000NO
39hsa-miR-14935433569-18.02121
cCUCACU--UCU--G-UGCCUCGGucu
|:|| | ||| | ||||:|||
tGGGTCATCAGATCCGACGGGGCCcta
5.000NO
40hsa-miR-149474495-14.8121
ccuCACUUCUGUGCCUCGGUCu
| |: |:| :| ||||:|
tccGCGGCGGCCTGCAGCCGGg
5.000NO
41hsa-miR-14943464371-15.9121
cCUCAC-UUC-UG---UGCCUCGGUCu
||||| :|| :| :| | |||||
tGAGTGCGAGCGCCTTGCTG-GCCAGt
5.000NO
42hsa-miR-14946114634-16.4121
cCUCACUUCUGUGC----CUCGGUCu
||| || | |||| |:| |||
cGAG-GACG-CACGGGTAGGGGCAGg
5.000NO
43hsa-miR-14966236646-16.7121
CCU-CACUUCUGUGC-CUCGGUCu
||| | |:| :| || | ||| |
GGACGCGGACGCTCGTGCGCCCGc
5.000NO
44hsa-miR-14967736805-18.3121
CCUC--ACUUCUG---------UGCCUCGGUCU
|||| ||||||| || ||| | ||
GGAGACTGAAGACTCAGAACTGACTGAGGCCGA
5.000NO
45hsa-miR-15025602590-15.32121
GUGA---CCA--UGU----UCCCAACCCucu
||:| ||| ||| :| ||||||
CATTCGAGGTGGACACTTCGGTGTTGGGctg
7.336NO
46hsa-miR-15059065928-14.1121
GUGACCAUGUUCCCAAC-CCUCU
| | || :|::| ||| ||:||
CCCGGGGGCGGGCCTTGCGGGGA
7.336NO
47hsa-miR-15219471967-12.9121
GGGUUCAAGACAGUACGUGAcu
|:||| ||| ||||| ||
CTCAACAACTG-CATGCTCTtg
7.093NO
48hsa-miR-15447084729-18121
GCUUCCGUUGUGCCUAUUGGAu
||: || |:| | :|:||||
CGGTGGAAGCTGGAGTGACCTg
5.000NO
49hsa-miR-15418511871-12.8121
gcuUCCGUUGUGC-CUAUUGGAU
||| |: || |||| ||||
accAGG--ATCCGAGATACCCTA
5.000NO
50hsa-miR-15580328056-13.6121
GG-GGAUAGUGC--UAAUCGUAAUu
|| |||: : || | |||||| |
CCACCTGCTTCGACAGTAGCATAAc
5.000NO
miR-9
Target on HGV 
Binding site 1780-1802
mfe : -14.9
Hybrid sequence
aguaugucGAUCUAUUGGUUUCu
gggggcccCTGGGCAACCAGGGc miR-9
Target on HGV 
Binding site 8996-9023
mfe : -16.3
Hybrid sequence
aGUAUGUCGAUCUA------UUGGUUUCu
aCAT-CAATTGGATTTCACAAGCCAGAGg let-7b
Target on HGV 
Binding site 6687-6706
mfe : -16.1
Hybrid sequence
uUGGUG-UGUUGGAUGAUGGAGU
gAGCGCTAC-ACC--TTGCCTCA let-7e
Target on HGV 
Binding site 6686-6706
mfe : -13.9
Hybrid sequence
ugauauGUUGGAGGAUGGAGU
ggagcgCTACACCTTGCCTCA let-7e
Target on HGV 
Binding site 7831-7851
mfe : -13.8
Hybrid sequence
ugaUAUGUUGGAGGAUGGAGU
aggAGAAGGCCCCCCGCCTCA let-7g
Target on HGV 
Binding site 4187-4210
mfe : -12.6
Hybrid sequence
uGACAUGU-UUGAUGA--UGGAGu
gCTCTACGCCACCGCTACACCTCc let-7i
Target on HGV 
Binding site 3274-3293
mfe : -14.4
Hybrid sequence
ugucGUGUUUGAUGAUGGAgu
gggtCACAAA-GGCTGCCTtg miR-100
Target on HGV 
Binding site 4263-4285
mfe : -14.7
Hybrid sequence
guGUUC-AAGCCUAGAUGCCCaa
ggCGAGATTCCCTTTTATGGGca miR-103
Target on HGV 
Binding site 8442-8468
mfe : -13.2
Hybrid sequence
aGUAUCGG--GA--CAUGUUACGACga
aCTTGGCTTGCTGAGTGCAATGCAGat miR-106a
Target on HGV 
Binding site 9225-9251
mfe : -13.25
Hybrid sequence
cgauGGAC-GUGAC-AUU-CGUGAaaa
aaagCCTGATGGTGCTAATGCACTgcc miR-106a
Target on HGV 
Binding site 1222-1251
mfe : -14.2
Hybrid sequence
CGAUGGACG-------UGACAUUCGUGAAAA
GCT-CTTGCAGGGCCAACGGTTCGCGTTTTT miR-125a
Target on HGV 
Binding site 5259-5285
mfe : -12
Hybrid sequence
GU-GUCCA--AUUUCCCA-GAGUCCcu
CAGCCGGTGGTGCAGGTTCCTCCGGta miR-125a
Target on HGV 
Binding site 2109-2132
mfe : -15.8
Hybrid sequence
gUGUCC-AAU-UUCCCAGAGUCCCu
gATGGGTTTATACATGTC-CAGGGt miR-125a
Target on HGV 
Binding site 7533-7564
mfe : -14.2
Hybrid sequence
gUG-UCC-----AAUUUCCCA-GAG--UCCCu
gACAAGGTGACCTTCTGGCGTGCTCCTAGGGt miR-125b
Target on HGV 
Binding site 8936-8961
mfe : -12.3
Hybrid sequence
aGUGUUCAAUC--CC--AGAGUCCCu
cCCTGAGATTGCTGGTATCCCGGGGg miR-125b
Target on HGV 
Binding site 6097-6124
mfe : -19.9
Hybrid sequence
aGUGU--UCAAU---CCCAG-AGUCCCU
gCACAGTGGTTGCCCTGGTCAACAGGGA miR-126
Target on HGV 
Binding site 2358-2377
mfe : -13
Hybrid sequence
cguaauaaUGAGUGCCAUGCu
tgtctgggACTCCCGGT-CGt miR-126
Target on HGV 
Binding site 9244-9264
mfe : -12.9
Hybrid sequence
CGUAAUAAUGAGUGCCA-UGCu
GCACTGCCACTT-CGGTGGCGg miR-127
Target on HGV 
Binding site 6107-6129
mfe : -14.71
Hybrid sequence
uCGGUUCGAGUCUG--CCUAGGcu
tGCCCTGGTCA-ACAGGGAGCCta miR-127
Target on HGV 
Binding site 9164-9184
mfe : -14.2
Hybrid sequence
uCGGUUCGAGUCUGCCUAGGCu
cGCTGGG-TAAAAAGGGCCCGg miR-128a
Target on HGV 
Binding site 9173-9202
mfe : -18.1
Hybrid sequence
UUUUCUCUGGCC--AA------GUGACACu
AAAAGGGCCCGGCCTTGGGAGGCATGGTGg miR-128b
Target on HGV 
Binding site 5094-5113
mfe : -12.9
Hybrid sequence
CUUUCUCUGGCCAAGUGACACU
GAGGGTTAC--GTCCGCTGCGA miR-130b
Target on HGV 
Binding site 9049-9071
mfe : -18.1
Hybrid sequence
uaCGGGA-AAGUAGUAACGUGAc
taGCCCTGCTCATCGTAGCCCTc miR-132
Target on HGV 
Binding site 5519-5541
mfe : -14.6
Hybrid sequence
GCUGGUACCGACAU-CUGACAau
CGCCGGAGGGTGGGCGGCTGTgg miR-133a
Target on HGV 
Binding site 2319-2346
mfe : -12.9
Hybrid sequence
uguCGACCAACUUC-------CCCUGGuu
gtgGCAGG-TGAGGTCTTCGCGGGCCCtg miR-133a
Target on HGV 
Binding site 6671-6692
mfe : -13.8
Hybrid sequence
ugucgaccAACUUCCCCUGGuu
tgttaccaTTGACGGGGAGCgc miR-133a
Target on HGV 
Binding site 5006-5027
mfe : -15.72
Hybrid sequence
UGUCGACCAACUUC-CCCUGGUu
ACTCCT-GCTGAGGTGGGGCAAt miR-133b
Target on HGV 
Binding site 2481-2506
mfe : -18.4
Hybrid sequence
auCGACC-----AACUUCCCCUgguu
ccGCTGGCCCTCTTGATGGGGAtttc miR-133b
Target on HGV 
Binding site 1342-1364
mfe : -12.8
Hybrid sequence
aUCG--A-CCAACUUCCC-CUGGuu
aAGCAATCGGCTG--GGGTGACCcc miR-133b
Target on HGV 
Binding site 6519-6541
mfe : -15
Hybrid sequence
aucgACCA--ACUUCCCCUGGuu
cacgTGGTAATCAGGAGGACCtc miR-133b
Target on HGV 
Binding site 6672-6692
mfe : -13.8
Hybrid sequence
aucgaccAACUUCCCCUGGuu
gttaccaTTGACGGGGAGCgc miR-135a
Target on HGV 
Binding site 4649-4673
mfe : -15.62
Hybrid sequence
agUGUAUCCUUAUU--UUUCGGuau
ctACGCGGGGGTGGGCAAAGCCcct miR-136
Target on HGV 
Binding site 4236-4260
mfe : -14.3
Hybrid sequence
AGGUAGUAGUUUUG--UUUACCUca
TCCATAATTGAGACAAAATTGGAcg miR-136
Target on HGV 
Binding site 3788-3808
mfe : -13
Hybrid sequence
AGGUAGUAGUUUUGUUUACCUCA
TCCGGTGCC--GGCCAAAGGAGT miR-142-3p
Target on HGV 
Binding site 2558-2579
mfe : -12
Hybrid sequence
AGGUA--UUUCAUCCUUUGUGAUGu
TACATTCGAGGT-GG--ACACTTCg miR-143
Target on HGV 
Binding site 8384-8410
mfe : -12.5
Hybrid sequence
ACUCGAUGU-CAC-----GAAGUAGAGU
TGGG-TACGCGTGCGAGCCCTCATATCA miR-145
Target on HGV 
Binding site 1779-1802
mfe : -23.8
Hybrid sequence
UUCCCUAAGGACCCUUUUGACCUG
AGGGGGCCCCTGGGCAACCAGGGC miR-147
Target on HGV 
Binding site 4458-4478
mfe : -15.76
Hybrid sequence
cGUCUUCGU-AAAGGUGugug
aCAGACGCGCTTTCCACtggg miR-149
Target on HGV 
Binding site 3543-3569
mfe : -18.02
Hybrid sequence
cCUCACU--UCU--G-UGCCUCGGucu
tGGGTCATCAGATCCGACGGGGCCcta miR-149
Target on HGV 
Binding site 474-495
mfe : -14.8
Hybrid sequence
ccuCACUUCUGUGCCUCGGUCu
tccGCGGCGGCCTGCAGCCGGg miR-149
Target on HGV 
Binding site 4346-4371
mfe : -15.9
Hybrid sequence
cCUCAC-UUC-UG---UGCCUCGGUCu
tGAGTGCGAGCGCCTTGCTG-GCCAGt miR-149
Target on HGV 
Binding site 4611-4634
mfe : -16.4
Hybrid sequence
cCUCACUUCUGUGC----CUCGGUCu
cGAG-GACG-CACGGGTAGGGGCAGg miR-149
Target on HGV 
Binding site 6623-6646
mfe : -16.7
Hybrid sequence
CCU-CACUUCUGUGC-CUCGGUCu
GGACGCGGACGCTCGTGCGCCCGc miR-149
Target on HGV 
Binding site 6773-6805
mfe : -18.3
Hybrid sequence
CCUC--ACUUCUG---------UGCCUCGGUCU
GGAGACTGAAGACTCAGAACTGACTGAGGCCGA miR-150
Target on HGV 
Binding site 2560-2590
mfe : -15.32
Hybrid sequence
GUGA---CCA--UGU----UCCCAACCCucu
CATTCGAGGTGGACACTTCGGTGTTGGGctg miR-150
Target on HGV 
Binding site 5906-5928
mfe : -14.1
Hybrid sequence
GUGACCAUGUUCCCAAC-CCUCU
CCCGGGGGCGGGCCTTGCGGGGA miR-152
Target on HGV 
Binding site 1947-1967
mfe : -12.9
Hybrid sequence
GGGUUCAAGACAGUACGUGAcu
CTCAACAACTG-CATGCTCTtg miR-154
Target on HGV 
Binding site 4708-4729
mfe : -18
Hybrid sequence
GCUUCCGUUGUGCCUAUUGGAu
CGGTGGAAGCTGGAGTGACCTg miR-154
Target on HGV 
Binding site 1851-1871
mfe : -12.8
Hybrid sequence
gcuUCCGUUGUGC-CUAUUGGAU
accAGG--ATCCGAGATACCCTA miR-155
Target on HGV 
Binding site 8032-8056
mfe : -13.6
Hybrid sequence
GG-GGAUAGUGC--UAAUCGUAAUu
CCACCTGCTTCGACAGTAGCATAAc