Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HCV wildtype target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    
Subtypes1a  1b  2a  3a  4a  5a  6a  10a  11a 
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 3863 rescords (78 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7c64106432-14.1121
uUGGUAUGU-UGGAUGAUGGAGu
|::||:|| ||: :||:|| |
cATTATGCACACTCGCTGCCACt
11.774NO
2hsa-let-7c70157035-13.4121
UUG-GUAUGUUGGAUGA-UGGAGu
|:| |||| |: :|| |||||
AGCTCATAGAG---GCTAACCTCc
11.774NO
3hsa-let-7e897921-13.92121
UGAUAU-GUUGGA---GGAUGGagu
|||:|: | :|:| ||||||
ACTGTGCCCGCTTCAGCCTACCaag
6.037NO
4hsa-let-7f21572178-12.9121
UUGAUAUGUUAGAUGAUGGagu
|: |: |:::|| ||||||
AGGTGCATGGTCGACTACCcgt
10.092NO
5hsa-let-7f59745995-20.5121
UUGAUAUGUUAGAUGAUGGagu
| ||: ||||||:||:||
ACCTGGTCAATCTGCTGCCcgc
10.092NO
6hsa-let-7g39653986-13.5121
ugACA--UGUUUGAUGAUGGAGu
||| ||::|| ||| ||||
ggTGTTCACGGACAACT-CCTCt
9.988NO
7hsa-let-7g84648493-12.51121
uGACA----UGU-----UUGAUGAUGGAGU
|||| ||| | :|:|||| |||
gCTGTGGTAACACCCTCACTTGCTACATCA
9.988NO
8hsa-miR-10081888204-12.6121
GUGUUCAAGCCUAGAUGCCCAA
||| | ||| | :||||||
CACCA----GGA-CAGCGGGTT
9.137NO
9hsa-miR-106b17891809-12.12121
uagacgUGACAGUCGUGAaau
|||| ::|||||
gcccctACTGCTGGCACTacc
5.784NO
10hsa-miR-10768416868-16.2121
acuAUCGGGACA--UGU---UACGAcga
||||| ||| ||: |||||
acgTAGCCGTGTTGACGTCCATGCTcac
9.255NO
11hsa-miR-10a75267552-16121
guguuUAAGCCUAGA-----UGUCCCAu
|| ||||||| || ||||
tggggATCCGGATCTCAGCGAC-GGGTc
7.071NO
12hsa-miR-10b16421663-13.7121
UGUUUAAGCCAAGAUGUCCCau
||| | | |: :|||||
ACACCGGCTGGTTAGCAGGGct
6.727NO
13hsa-miR-10b48374857-14.3121
UGUUUAAGCCAAGAUGUCCCau
|||:|||:| | || |||
ACAGATTTGTGGC-ACCGGGgg
6.727NO
14hsa-miR-10b16751696-13.3121
UGUUUAAGCCAAGAUGUCCCAu
|||||||| ||| |||| |
ACAAATTCAACTCTTCAGGCTg
6.727NO
15hsa-miR-10b40734094-12.8121
uguuuaaGCCAAGAUGUCCCAu
| | ||||| |||
cgcagccCAGGGCTACAAGGTg
6.727NO
16hsa-miR-124a64076433-16.76121
aCCGUAA---GUG-GCGC-ACGGaauu
|||||| ||| | || ||||
cGGCATTATGCACACTCGCTGCCactg
5.000NO
17hsa-miR-125b71557181-14121
aGUGUUCAA---UCC--CAGAGUCCCU
|| || || || |||||:| ||
gCAGAAATTCTGCGGAAGTCTCGGAGA
10.846NO
18hsa-miR-12737033724-13.7121
ucGGUUCGAGUCUGCCUAGGcu
|| || | :||| |||
caCCCTGCACCTGCGGCTCCtc
5.000NO
19hsa-miR-12711721192-14.2121
ucgguUCGAGUCUGCCUAGGCu
| || | |||:||:|
gggggACCTGTG-CGGGTCTGt
5.000NO
20hsa-miR-12747634786-16.1121
UCGGUUCGAGUCUG-CCUA-GGCu
| ||| |||| | |||| |:|
AACCACGCTCCCCCAGGATGCTGt
5.000NO
21hsa-miR-12764556484-14.3121
uCGGUUCGAG-UCUG-----CCUAG--GCu
|:||| | :||| ||||| ||
tGTCAAAAACGGGACGATGAGGATCGTCGg
5.000NO
22hsa-miR-12771657186-14.2121
uCG-GUUC-GAGUCUGCCUAGGCu
|| ||| |||:|| |||:||
tGCGGAAGTCTCGGA--GATTCGc
5.000NO
23hsa-miR-12964806503-17.2121
CGUUCGGG--UCUGG-CGUUUUUc
|: :|:|| :|||| |||::||
GTCGGTCCTAGGACCTGCAGGAAc
5.000NO
24hsa-miR-13262676292-14.42121
gCUGGUACC-----GACAUCUGACaau
|:|:| || ||| :|||||
tGGCTAAGGGACATCTG-GGACTGgat
5.000NO
25hsa-miR-133a58575881-17.36121
uGUCGAC-CAACUU--CCCCUgguu
|:|| | ||||:| |||||
tCGGCAGCGTTGGACTGGGGAaggt
5.000NO
26hsa-miR-133a48374862-15.9121
UGUC-GACCAACUU---CCCCUGGuu
|||| :| || | | ||||| |
ACAGATTTGTGGCACCGGGGGAGCgc
5.000NO
27hsa-miR-133b90909116-15.2121
AUCG-ACCAACUUC-----CCCUGGuu
| || | |||:|| ||| ||
TTGCGAGCTTGGAGACACCGGGCCCgg
NONO
28hsa-miR-133b323-17.1121
aUCGACCAACUUCCCCUGGUu
||| ||| ||||:| |
cAGCCCCCTGATGGGGGCGAc
NONO
29hsa-miR-133b87288747-13121
auCGACCAACUUC-CCCUGGUu
||||| ||| ||| |:|
gcGCTGG--AAAGAGGGTCTAc
NONO
30hsa-miR-13412161233-12.7121
GGGAGACCAGUUGGUCAGUGu
||:||| || |||| |:|
CCTTCT-CTC--CCAGGCGCc
5.000NO
31hsa-miR-13415741605-18.5121
GGGAGACCAGUUG--------GUCA---GUGU
|| ||| ||||| |||| ||||
CCAACTGATCAACACCAACGGCAGTTGGCACA
5.000NO
32hsa-miR-13416601677-13.5121
ggGAGACCAGUUGGUCAGUGU
|||| || |:||| ||||
ggCTCT--TCTATCAG-CACA
5.000NO
33hsa-miR-142-3p61226144-12.21121
agguauuucauccUUUGUGAUGu
| :||||||
ccatgtttcccccACGCACTACg
9.468NO
34hsa-miR-14333123335-14.5121
acuCG-AUGUCAC-GAAGUAGagu
|| |:|:||| | |||||
gccGCGTGCGGTGACATCATCaac
10.136NO
35hsa-miR-14558295850-15.6121
uuCCCUAAG-GACCCUUUUGACCug
||| | |||| |:||||
gtGGG---CGCTGGCTTAGCTGGcg
11.062NO
36hsa-miR-146a794816-13.9121
uuGGGUACCUUAAG-UCAAGAgu
| ||||| :| | :|||||
ggCGCATGGCGTCCGGGTTCTgg
NONO
37hsa-miR-14790079030-17.5121
cGUCUUCGUAA-----AGGUGUgug
||| ||||| ||||||
tCAG-CGCATTTTCACTCCACAgtt
5.000NO
38hsa-miR-14764026423-13.8121
CGUCU-UCGUAA-AGGUGUGug
| ||| :||||| | |||||
GGAGACGGCATTATGCACACtc
5.000NO
39hsa-miR-148a60656086-14121
uguuucaagaCAUCACGUGACu
| |||||| ||
gggcgaggggGCAGTGCAATGg
NONO
40hsa-miR-14931153131-15.1121
cCUCACUUCUGUGCCUCGGUCU
| | |||||: ||||:||
cGCG-GAAGAT----AGCCGGA
5.000NO
41hsa-miR-14978567875-15.6121
cCUCACUUCUGUGCCUCGGUCU
||| |||| | :| |||| ||
aGAG-GAAG-CTTGCAGCCTGA
5.000NO
42hsa-miR-15251075128-14121
gGGUUC-AAGACAGUACGUGAcu
||||| | || :|||:||
aCCAAGCCACCGT-GTGCGCTag
7.093NO
43hsa-miR-152880897-12121
GGGUUCAAGACAGUACGUGACU
||| | || || ||| ||||
CCC---TGCTCTCTTGC-CTGA
7.093NO
44hsa-miR-15439163944-14.31121
GCUUCC----GUUGUG---CCUAUUGGAU
||: || :| | | ||| ||||||
CGGTGGACTTTATCCCTGTGGAGAACCTA
5.000NO
45hsa-miR-17-3p61596181-13.72121
uGUUCACG---GAAGUGACGuca
||: || | |||||||
gCAGCCGCCCGCGTCACTGCcat
6.278NO
46hsa-miR-18217001722-13.8121
ACACUCAAGAUGGU-AACGGUUu
|| ||| |: :||| ||||:|
TGAGAGGTTGGCCAGCTGCCGAc
5.000NO
47hsa-miR-18357105732-13.5121
gucACUUAAGAUGGUC-ACGGUAu
||: ||:|| ||| ||||:|
tgaTGGCTTTTA-CAGCTGCCGTc
5.000NO
48hsa-miR-18416841700-16.1121
UGGGAAUAGUCAAGAGGCAGGu
||:|| |||| |:||||
ACTCT--TCAGG---CTGTCCt
5.000NO
49hsa-miR-18473037322-15121
uGGGAAUAGUCA-AGAGGCAGGu
|||| | || ||||| ||
cCCCT--CCTGTGCCTCCG-CCt
5.000NO
50hsa-miR-18712271245-14.1121
gCCGACGUUGUGUUCUG-UGCu
||| || ||| :||| |||
aGGC-GC--CACTGGACGACGc
5.000NO
let-7c
Target on hcv wildtype 
Binding site 6410-6432
mfe : -14.1
Hybrid sequence
uUGGUAUGU-UGGAUGAUGGAGu
cATTATGCACACTCGCTGCCACt let-7c
Target on hcv wildtype 
Binding site 7015-7035
mfe : -13.4
Hybrid sequence
UUG-GUAUGUUGGAUGA-UGGAGu
AGCTCATAGAG---GCTAACCTCc let-7e
Target on hcv wildtype 
Binding site 897-921
mfe : -13.92
Hybrid sequence
UGAUAU-GUUGGA---GGAUGGagu
ACTGTGCCCGCTTCAGCCTACCaag let-7f
Target on hcv wildtype 
Binding site 2157-2178
mfe : -12.9
Hybrid sequence
UUGAUAUGUUAGAUGAUGGagu
AGGTGCATGGTCGACTACCcgt let-7f
Target on hcv wildtype 
Binding site 5974-5995
mfe : -20.5
Hybrid sequence
UUGAUAUGUUAGAUGAUGGagu
ACCTGGTCAATCTGCTGCCcgc let-7g
Target on hcv wildtype 
Binding site 3965-3986
mfe : -13.5
Hybrid sequence
ugACA--UGUUUGAUGAUGGAGu
ggTGTTCACGGACAACT-CCTCt let-7g
Target on hcv wildtype 
Binding site 8464-8493
mfe : -12.51
Hybrid sequence
uGACA----UGU-----UUGAUGAUGGAGU
gCTGTGGTAACACCCTCACTTGCTACATCA miR-100
Target on hcv wildtype 
Binding site 8188-8204
mfe : -12.6
Hybrid sequence
GUGUUCAAGCCUAGAUGCCCAA
CACCA----GGA-CAGCGGGTT miR-106b
Target on hcv wildtype 
Binding site 1789-1809
mfe : -12.12
Hybrid sequence
uagacgUGACAGUCGUGAaau
gcccctACTGCTGGCACTacc miR-107
Target on hcv wildtype 
Binding site 6841-6868
mfe : -16.2
Hybrid sequence
acuAUCGGGACA--UGU---UACGAcga
acgTAGCCGTGTTGACGTCCATGCTcac miR-10a
Target on hcv wildtype 
Binding site 7526-7552
mfe : -16
Hybrid sequence
guguuUAAGCCUAGA-----UGUCCCAu
tggggATCCGGATCTCAGCGAC-GGGTc miR-10b
Target on hcv wildtype 
Binding site 1642-1663
mfe : -13.7
Hybrid sequence
UGUUUAAGCCAAGAUGUCCCau
ACACCGGCTGGTTAGCAGGGct miR-10b
Target on hcv wildtype 
Binding site 4837-4857
mfe : -14.3
Hybrid sequence
UGUUUAAGCCAAGAUGUCCCau
ACAGATTTGTGGC-ACCGGGgg miR-10b
Target on hcv wildtype 
Binding site 1675-1696
mfe : -13.3
Hybrid sequence
UGUUUAAGCCAAGAUGUCCCAu
ACAAATTCAACTCTTCAGGCTg miR-10b
Target on hcv wildtype 
Binding site 4073-4094
mfe : -12.8
Hybrid sequence
uguuuaaGCCAAGAUGUCCCAu
cgcagccCAGGGCTACAAGGTg miR-124a
Target on hcv wildtype 
Binding site 6407-6433
mfe : -16.76
Hybrid sequence
aCCGUAA---GUG-GCGC-ACGGaauu
cGGCATTATGCACACTCGCTGCCactg miR-125b
Target on hcv wildtype 
Binding site 7155-7181
mfe : -14
Hybrid sequence
aGUGUUCAA---UCC--CAGAGUCCCU
gCAGAAATTCTGCGGAAGTCTCGGAGA miR-127
Target on hcv wildtype 
Binding site 3703-3724
mfe : -13.7
Hybrid sequence
ucGGUUCGAGUCUGCCUAGGcu
caCCCTGCACCTGCGGCTCCtc miR-127
Target on hcv wildtype 
Binding site 1172-1192
mfe : -14.2
Hybrid sequence
ucgguUCGAGUCUGCCUAGGCu
gggggACCTGTG-CGGGTCTGt miR-127
Target on hcv wildtype 
Binding site 4763-4786
mfe : -16.1
Hybrid sequence
UCGGUUCGAGUCUG-CCUA-GGCu
AACCACGCTCCCCCAGGATGCTGt miR-127
Target on hcv wildtype 
Binding site 6455-6484
mfe : -14.3
Hybrid sequence
uCGGUUCGAG-UCUG-----CCUAG--GCu
tGTCAAAAACGGGACGATGAGGATCGTCGg miR-127
Target on hcv wildtype 
Binding site 7165-7186
mfe : -14.2
Hybrid sequence
uCG-GUUC-GAGUCUGCCUAGGCu
tGCGGAAGTCTCGGA--GATTCGc miR-129
Target on hcv wildtype 
Binding site 6480-6503
mfe : -17.2
Hybrid sequence
CGUUCGGG--UCUGG-CGUUUUUc
GTCGGTCCTAGGACCTGCAGGAAc miR-132
Target on hcv wildtype 
Binding site 6267-6292
mfe : -14.42
Hybrid sequence
gCUGGUACC-----GACAUCUGACaau
tGGCTAAGGGACATCTG-GGACTGgat miR-133a
Target on hcv wildtype 
Binding site 5857-5881
mfe : -17.36
Hybrid sequence
uGUCGAC-CAACUU--CCCCUgguu
tCGGCAGCGTTGGACTGGGGAaggt miR-133a
Target on hcv wildtype 
Binding site 4837-4862
mfe : -15.9
Hybrid sequence
UGUC-GACCAACUU---CCCCUGGuu
ACAGATTTGTGGCACCGGGGGAGCgc miR-133b
Target on hcv wildtype 
Binding site 9090-9116
mfe : -15.2
Hybrid sequence
AUCG-ACCAACUUC-----CCCUGGuu
TTGCGAGCTTGGAGACACCGGGCCCgg miR-133b
Target on hcv wildtype 
Binding site 3-23
mfe : -17.1
Hybrid sequence
aUCGACCAACUUCCCCUGGUu
cAGCCCCCTGATGGGGGCGAc miR-133b
Target on hcv wildtype 
Binding site 8728-8747
mfe : -13
Hybrid sequence
auCGACCAACUUC-CCCUGGUu
gcGCTGG--AAAGAGGGTCTAc miR-134
Target on hcv wildtype 
Binding site 1216-1233
mfe : -12.7
Hybrid sequence
GGGAGACCAGUUGGUCAGUGu
CCTTCT-CTC--CCAGGCGCc miR-134
Target on hcv wildtype 
Binding site 1574-1605
mfe : -18.5
Hybrid sequence
GGGAGACCAGUUG--------GUCA---GUGU
CCAACTGATCAACACCAACGGCAGTTGGCACA miR-134
Target on hcv wildtype 
Binding site 1660-1677
mfe : -13.5
Hybrid sequence
ggGAGACCAGUUGGUCAGUGU
ggCTCT--TCTATCAG-CACA miR-142-3p
Target on hcv wildtype 
Binding site 6122-6144
mfe : -12.21
Hybrid sequence
agguauuucauccUUUGUGAUGu
ccatgtttcccccACGCACTACg miR-143
Target on hcv wildtype 
Binding site 3312-3335
mfe : -14.5
Hybrid sequence
acuCG-AUGUCAC-GAAGUAGagu
gccGCGTGCGGTGACATCATCaac miR-145
Target on hcv wildtype 
Binding site 5829-5850
mfe : -15.6
Hybrid sequence
uuCCCUAAG-GACCCUUUUGACCug
gtGGG---CGCTGGCTTAGCTGGcg miR-146a
Target on hcv wildtype 
Binding site 794-816
mfe : -13.9
Hybrid sequence
uuGGGUACCUUAAG-UCAAGAgu
ggCGCATGGCGTCCGGGTTCTgg miR-147
Target on hcv wildtype 
Binding site 9007-9030
mfe : -17.5
Hybrid sequence
cGUCUUCGUAA-----AGGUGUgug
tCAG-CGCATTTTCACTCCACAgtt miR-147
Target on hcv wildtype 
Binding site 6402-6423
mfe : -13.8
Hybrid sequence
CGUCU-UCGUAA-AGGUGUGug
GGAGACGGCATTATGCACACtc miR-148a
Target on hcv wildtype 
Binding site 6065-6086
mfe : -14
Hybrid sequence
uguuucaagaCAUCACGUGACu
gggcgaggggGCAGTGCAATGg miR-149
Target on hcv wildtype 
Binding site 3115-3131
mfe : -15.1
Hybrid sequence
cCUCACUUCUGUGCCUCGGUCU
cGCG-GAAGAT----AGCCGGA miR-149
Target on hcv wildtype 
Binding site 7856-7875
mfe : -15.6
Hybrid sequence
cCUCACUUCUGUGCCUCGGUCU
aGAG-GAAG-CTTGCAGCCTGA miR-152
Target on hcv wildtype 
Binding site 5107-5128
mfe : -14
Hybrid sequence
gGGUUC-AAGACAGUACGUGAcu
aCCAAGCCACCGT-GTGCGCTag miR-152
Target on hcv wildtype 
Binding site 880-897
mfe : -12
Hybrid sequence
GGGUUCAAGACAGUACGUGACU
CCC---TGCTCTCTTGC-CTGA miR-154
Target on hcv wildtype 
Binding site 3916-3944
mfe : -14.31
Hybrid sequence
GCUUCC----GUUGUG---CCUAUUGGAU
CGGTGGACTTTATCCCTGTGGAGAACCTA miR-17-3p
Target on hcv wildtype 
Binding site 6159-6181
mfe : -13.72
Hybrid sequence
uGUUCACG---GAAGUGACGuca
gCAGCCGCCCGCGTCACTGCcat miR-182
Target on hcv wildtype 
Binding site 1700-1722
mfe : -13.8
Hybrid sequence
ACACUCAAGAUGGU-AACGGUUu
TGAGAGGTTGGCCAGCTGCCGAc miR-183
Target on hcv wildtype 
Binding site 5710-5732
mfe : -13.5
Hybrid sequence
gucACUUAAGAUGGUC-ACGGUAu
tgaTGGCTTTTA-CAGCTGCCGTc miR-184
Target on hcv wildtype 
Binding site 1684-1700
mfe : -16.1
Hybrid sequence
UGGGAAUAGUCAAGAGGCAGGu
ACTCT--TCAGG---CTGTCCt miR-184
Target on hcv wildtype 
Binding site 7303-7322
mfe : -15
Hybrid sequence
uGGGAAUAGUCA-AGAGGCAGGu
cCCCT--CCTGTGCCTCCG-CCt miR-187
Target on hcv wildtype 
Binding site 1227-1245
mfe : -14.1
Hybrid sequence
gCCGACGUUGUGUUCUG-UGCu
aGGC-GC--CACTGGACGACGc