Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HDV target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
 Browse    HDV RNA genome   HDVJS   
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 593 rescords (12 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7b599620-13.2121
uuGGUGUGUUGGAUGAUGGAGu
||:| ||| || || || |
ttCCGCCCAAGCTCCTTCCCCc
11.726NO
2hsa-miR-10712761305-16121
aCUAUCG---GGA--CA--UGUUACGACGa
|| :|| ||| || :::|| ||||
cGAGGGCCTTCCTTCGTCGGTGATCCTGCc
9.255NO
3hsa-miR-10a534-17.51121
guGUUUAAG-------CCUAGAUGUCCCau
|||:||| ||||: :|:|||
gcCAAGTTCCGAACAAGGATTCGCGGGGag
7.071NO
4hsa-miR-12713541375-12.6121
UCGGUUCGAGUCUGCCUAGGCu
||:| | :|| | |:||||
AGTCTACTTCCATCTGGTCCGt
5.000NO
5hsa-miR-133b13641385-12.5121
aUCGACCA-ACUUCCCCUGGuu
| ||||| | ||| ||
cATCTGGTCCGTTCGGGCCCtc
NONO
6hsa-miR-136820842-13.61121
AGGUAGUAGUUUUGUUUACCUca
||| |:| | | |:|:||||
TCCCTTAGCCATCCGAGTGGAcg
7.279NO
7hsa-miR-14010841108-14.2121
GAUGGUAU--CCCAU--UUUGGUGa
|| |||: ||| | ||:||:|
CTTGCATGCTGGGGACGAAGCCGCc
5.000NO
8hsa-miR-181a239265-16.8121
UGAGUGGCUG----UCGCAACUUACAa
|| | |||:| || |||||: ||
ACACTCCGGCCCGAAGGGTTGAGAGTa
9.523NO
9hsa-miR-191711740-15.6121
uCGAC----GAAAACCC----UAAGGCaac
|||| | |||| ||||||
cGCTGGCGCCGGCTGGGCAACATTCCGagg
NONO
10hsa-miR-199b5279-13.7121
CUUGUCUAUCAG--AU---UUGUGACCc
||: :| |||| || |:||:|||
GAGGGGTGAGTCGGTAAAGAGCATTGGa
5.000NO
11hsa-miR-20215361559-20.7121
aaaaGGGU-ACGGG-AUAUGGAGA
|||| |||:| : ||||||
ctcaCCCACTGCTCGAGAACCTCT
NONO
12hsa-miR-28569594-16.3121
gaGUUAUCU--G-ACACU-CGAGGaa
||:|:|| | || || |||||
acCAGTGGAGCCATGGGATGCTCCtc
8.778NO
13hsa-miR-299-3p638654-14.22121
uuCGCCAAAUGGUAGGGUGuau
|||| || |||||
tgGCGG--GAC---CCCACtct
NONO
14hsa-miR-30d14441465-17.6121
gAAGGUCAGCCCCUACAAAUgu
| |||| | |||||||| |
tTCCCAGCCAGGGATGTTCAtc
11.306NO
15hsa-miR-30e-5p14461465-19.7121
aGGUCAGUUCCUACAAAUgu
|||| ||:||||||| |
cCCAGCCAGGGATGTTCAtc
NONO
16hsa-miR-324-5p11281146-14.8121
uGUGGUUACGGGAUCCCCUACGc
|||| ::| |||||:| |
cCACC----TTCGAGGGGGTTCa
NONO
17hsa-miR-326851868-12.3121
gaccuCCUUCCCGGGUCucc
||| ||||||
ccttcGGA--TGCCCAGgtc
NONO
18hsa-miR-328719747-23.61121
uGCCUUCCCG-UCU----CUCCC--GGuc
||| |||| | | ||||| ||
cCGGCTGGGCAACATTCCGAGGGGACCgt
NONO
19hsa-miR-328540573-21.2121
UGCCUUCCC------------GUCUCUCCCGGUC
|| ||:||| || |:|| ||||
ACCGAGGGGGGTGACTTTGAACATTGGGGACCAG
NONO
20hsa-miR-339152170-15121
AC-UCGAGGACCUCCUGUCCCU
|| | |||: |||| :||||
TGAAACTCT---AGGAAGGGGA
NONO
21hsa-miR-3399781002-19.3121
aCUCGAGGACCUC----CUGUCCCU
||| |||| |:| ||||
gGAGAGGAGGGAGGGTCGGCTGGGA
NONO
22hsa-miR-346623647-16.49121
UCUC--C--GUCCGUACGCCCG-UCUGu
||:| | |||| || ||| :|||
AGGGTCGCCCAGGAAT---GGCGGGACc
NONO
23hsa-miR-363*810834-15.4121
UUUAAC---GUAGCACUAGGUGGGC
||| || | | | | |||:|||
AAAGTGGCTCTCCCTTAGCCATCCG
NONO
24hsa-miR-378371394-22.5121
ugUGUCCUG-GA-CCUCAGUCCUC
| :|||: || |||||::||:|
ggAGGGGATGCTAGGAGTTGGGGG
NONO
25hsa-miR-38112511275-13.62121
uGUCUCU---CGAACGGGAACAuau
| || | |||| |:|||||
gCCGATAGCTGCTTTCTCTTGTtct
NONO
26hsa-miR-3827698-12.1121
gCUUAGGUGGUGCU-UGUUGAag
|:| | | : || ||||||
tGGAACGTCGGAGATACAACTcc
NONO
27hsa-miR-409-3p11381161-22.3121
uCCCCAAGUG-GCUCGUUGUAAGC
||||||||| | |||| | ||
gGGGGTTCACACCCCCAACCTGCG
NONO
28hsa-miR-423312338-14121
GACUCCCCGG--AGUC---UGGCUCga
| |||| || |||| || |||
CAGAGGACCCCTTCAGCGAACAGAGag
NONO
29hsa-miR-42310431064-14.8121
gacuccccGGAGUCUGGCUCga
|| |:| |||||
cagtccctCCCCGGTCCGAGta
NONO
30hsa-miR-425234253-20.2121
CCGCCUGUGCUGUAAGGGCUa
|| |||||| | |||||
GGAGGACAC-TCCGGCCCGAa
NONO
31hsa-miR-432*186213-18121
UCUGUACCUCCUC------GG-UAGGuc
||| | ||||| | || ||||
AGAGAAGGAGGCGGGCCTCCCGATCCga
NONO
32hsa-miR-432*12701289-12.9121
ucuguACCUCCUCGGUAGGuc
| |||| ||| |||
tgttcTCGAGG-GCCTTCCtt
NONO
33hsa-miR-432*307327-15.4121
ucuguacCUCCUCGGUAGGUC
||||| || |:|||
acctccaGAGGACCCCTTCAG
NONO
34hsa-miR-449225250-13.4121
uGG-UCGAUUGUUAUGUGA---CGGu
|| ||:| : |: ||||| |||
gCCAAGTTTGGAGGACACTCCGGCCc
NONO
35hsa-miR-49010601082-19.92121
gUCG-UACCUCAGGAGGUCCaac
||: | ||:| ||||:||
gAGTAAAGGGGGACTCCGGGact
NONO
36hsa-miR-515-5p369395-17.2121
gUCUUUC---ACGAAAGAAAACCUCUU
||:|:| |||| ||||:|:|
tAGGAGGGGATGCTAGGAGTTGGGGGA
NONO
37hsa-miR-518a790808-14.76121
AGGUCGUUUCCCUUCGCgaaa
||| ||:|| ||||||
TCC--CAGAGAGAAGCGagag
NONO
38hsa-miR-52413841405-20121
uGAGGU-UUCCCUUCGCGGAAG
||:|: :|||:||| || ||
tCTTCGCCGGGGGAGCCCCCTC
NONO
39hsa-miR-5259991020-15.9121
uCUUUCACGUA-GGGAGACCuc
|:||| |:|| :||| |||
gGGAAGAGTATATCCTATGGga
NONO
40hsa-miR-526a146164-12.3121
ucuuUCACGAAGGGAGAUCuc
|||| ||||||
cgccAGTG--AAACTCTAGga
NONO
41hsa-miR-99b9991021-13.8121
gCGUUC-CAGCCAAGAUGCCCac
| ||| || | |||:|||
gGGAAGAGTATATCCTATGGGaa
7.475NO
42hsa-miR-10011451165-12.33122
GUGUUCAAGCCUAGAUGCCCaa
||| | | | ||:||||
CAC-ACCCCCAACCTGCGGGcc
9.137NO
43hsa-miR-128a16481670-16.1122
UUUUCUCUGGCCA-AGUGACAcu
|:|:|||||:| | | ||||
AGAGGAGACTGCTGGCCCTGTcg
5.472NO
44hsa-miR-133a201222-13.3122
ugucGACCAACUUCCCCUGGuu
| | | :||||| ||
cctcCCGATCCGAGGGGCCCgg
5.000NO
45hsa-miR-133b202222-13.3122
aucGACCAACUUCCCCUGGuu
| | | :||||| ||
ctcCCGATCCGAGGGGCCCgg
NONO
46hsa-miR-149384408-21.6122
CCUCA----CUUCUGUGCCUCGGUCu
||||| |:|||| || ||| ||
GGAGTTGGGGGAGAC-CGAAGCGAGg
5.000NO
47hsa-miR-149976997-20.2122
CCUCACUUCUGUGCCUCGGUCu
||:| ||:|| : |:|:|:|
GGGGAGAGGAGGGAGGGTCGGc
5.000NO
48hsa-miR-152946962-12.1122
GGGUUCAAGACAGUACGUGACu
||| | || |:|| |||||
CCC--G--CT-TTATTCACTGg
7.093NO
49hsa-miR-18413071328-21.8122
ugGGAAUAGUCA-AGAGGCAGGu
||||:||:|| ||| |||
ctCCTTGTCGGTGAATCC-TCCc
5.000NO
50hsa-miR-18512561272-13.6122
cUUGACGGAAAGAGAggu
|:||| ||||||||
tAGCTG-CTTTCTCTtgt
6.327NO
let-7b
Target on HDV 
Binding site 599-620
mfe : -13.2
Hybrid sequence
uuGGUGUGUUGGAUGAUGGAGu
ttCCGCCCAAGCTCCTTCCCCc miR-107
Target on HDV 
Binding site 1276-1305
mfe : -16
Hybrid sequence
aCUAUCG---GGA--CA--UGUUACGACGa
cGAGGGCCTTCCTTCGTCGGTGATCCTGCc miR-10a
Target on HDV 
Binding site 5-34
mfe : -17.51
Hybrid sequence
guGUUUAAG-------CCUAGAUGUCCCau
gcCAAGTTCCGAACAAGGATTCGCGGGGag miR-127
Target on HDV 
Binding site 1354-1375
mfe : -12.6
Hybrid sequence
UCGGUUCGAGUCUGCCUAGGCu
AGTCTACTTCCATCTGGTCCGt miR-133b
Target on HDV 
Binding site 1364-1385
mfe : -12.5
Hybrid sequence
aUCGACCA-ACUUCCCCUGGuu
cATCTGGTCCGTTCGGGCCCtc miR-136
Target on HDV 
Binding site 820-842
mfe : -13.61
Hybrid sequence
AGGUAGUAGUUUUGUUUACCUca
TCCCTTAGCCATCCGAGTGGAcg miR-140
Target on HDV 
Binding site 1084-1108
mfe : -14.2
Hybrid sequence
GAUGGUAU--CCCAU--UUUGGUGa
CTTGCATGCTGGGGACGAAGCCGCc miR-181a
Target on HDV 
Binding site 239-265
mfe : -16.8
Hybrid sequence
UGAGUGGCUG----UCGCAACUUACAa
ACACTCCGGCCCGAAGGGTTGAGAGTa miR-191
Target on HDV 
Binding site 711-740
mfe : -15.6
Hybrid sequence
uCGAC----GAAAACCC----UAAGGCaac
cGCTGGCGCCGGCTGGGCAACATTCCGagg miR-199b
Target on HDV 
Binding site 52-79
mfe : -13.7
Hybrid sequence
CUUGUCUAUCAG--AU---UUGUGACCc
GAGGGGTGAGTCGGTAAAGAGCATTGGa miR-202
Target on HDV 
Binding site 1536-1559
mfe : -20.7
Hybrid sequence
aaaaGGGU-ACGGG-AUAUGGAGA
ctcaCCCACTGCTCGAGAACCTCT miR-28
Target on HDV 
Binding site 569-594
mfe : -16.3
Hybrid sequence
gaGUUAUCU--G-ACACU-CGAGGaa
acCAGTGGAGCCATGGGATGCTCCtc miR-299-3p
Target on HDV 
Binding site 638-654
mfe : -14.22
Hybrid sequence
uuCGCCAAAUGGUAGGGUGuau
tgGCGG--GAC---CCCACtct miR-30d
Target on HDV 
Binding site 1444-1465
mfe : -17.6
Hybrid sequence
gAAGGUCAGCCCCUACAAAUgu
tTCCCAGCCAGGGATGTTCAtc miR-30e-5p
Target on HDV 
Binding site 1446-1465
mfe : -19.7
Hybrid sequence
aGGUCAGUUCCUACAAAUgu
cCCAGCCAGGGATGTTCAtc miR-324-5p
Target on HDV 
Binding site 1128-1146
mfe : -14.8
Hybrid sequence
uGUGGUUACGGGAUCCCCUACGc
cCACC----TTCGAGGGGGTTCa miR-326
Target on HDV 
Binding site 851-868
mfe : -12.3
Hybrid sequence
gaccuCCUUCCCGGGUCucc
ccttcGGA--TGCCCAGgtc miR-328
Target on HDV 
Binding site 719-747
mfe : -23.61
Hybrid sequence
uGCCUUCCCG-UCU----CUCCC--GGuc
cCGGCTGGGCAACATTCCGAGGGGACCgt miR-328
Target on HDV 
Binding site 540-573
mfe : -21.2
Hybrid sequence
UGCCUUCCC------------GUCUCUCCCGGUC
ACCGAGGGGGGTGACTTTGAACATTGGGGACCAG miR-339
Target on HDV 
Binding site 152-170
mfe : -15
Hybrid sequence
AC-UCGAGGACCUCCUGUCCCU
TGAAACTCT---AGGAAGGGGA miR-339
Target on HDV 
Binding site 978-1002
mfe : -19.3
Hybrid sequence
aCUCGAGGACCUC----CUGUCCCU
gGAGAGGAGGGAGGGTCGGCTGGGA miR-346
Target on HDV 
Binding site 623-647
mfe : -16.49
Hybrid sequence
UCUC--C--GUCCGUACGCCCG-UCUGu
AGGGTCGCCCAGGAAT---GGCGGGACc miR-363*
Target on HDV 
Binding site 810-834
mfe : -15.4
Hybrid sequence
UUUAAC---GUAGCACUAGGUGGGC
AAAGTGGCTCTCCCTTAGCCATCCG miR-378
Target on HDV 
Binding site 371-394
mfe : -22.5
Hybrid sequence
ugUGUCCUG-GA-CCUCAGUCCUC
ggAGGGGATGCTAGGAGTTGGGGG miR-381
Target on HDV 
Binding site 1251-1275
mfe : -13.62
Hybrid sequence
uGUCUCU---CGAACGGGAACAuau
gCCGATAGCTGCTTTCTCTTGTtct miR-382
Target on HDV 
Binding site 76-98
mfe : -12.1
Hybrid sequence
gCUUAGGUGGUGCU-UGUUGAag
tGGAACGTCGGAGATACAACTcc miR-409-3p
Target on HDV 
Binding site 1138-1161
mfe : -22.3
Hybrid sequence
uCCCCAAGUG-GCUCGUUGUAAGC
gGGGGTTCACACCCCCAACCTGCG miR-423
Target on HDV 
Binding site 312-338
mfe : -14
Hybrid sequence
GACUCCCCGG--AGUC---UGGCUCga
CAGAGGACCCCTTCAGCGAACAGAGag miR-423
Target on HDV 
Binding site 1043-1064
mfe : -14.8
Hybrid sequence
gacuccccGGAGUCUGGCUCga
cagtccctCCCCGGTCCGAGta miR-425
Target on HDV 
Binding site 234-253
mfe : -20.2
Hybrid sequence
CCGCCUGUGCUGUAAGGGCUa
GGAGGACAC-TCCGGCCCGAa miR-432*
Target on HDV 
Binding site 186-213
mfe : -18
Hybrid sequence
UCUGUACCUCCUC------GG-UAGGuc
AGAGAAGGAGGCGGGCCTCCCGATCCga miR-432*
Target on HDV 
Binding site 1270-1289
mfe : -12.9
Hybrid sequence
ucuguACCUCCUCGGUAGGuc
tgttcTCGAGG-GCCTTCCtt miR-432*
Target on HDV 
Binding site 307-327
mfe : -15.4
Hybrid sequence
ucuguacCUCCUCGGUAGGUC
acctccaGAGGACCCCTTCAG miR-449
Target on HDV 
Binding site 225-250
mfe : -13.4
Hybrid sequence
uGG-UCGAUUGUUAUGUGA---CGGu
gCCAAGTTTGGAGGACACTCCGGCCc miR-490
Target on HDV 
Binding site 1060-1082
mfe : -19.92
Hybrid sequence
gUCG-UACCUCAGGAGGUCCaac
gAGTAAAGGGGGACTCCGGGact miR-515-5p
Target on HDV 
Binding site 369-395
mfe : -17.2
Hybrid sequence
gUCUUUC---ACGAAAGAAAACCUCUU
tAGGAGGGGATGCTAGGAGTTGGGGGA miR-518a
Target on HDV 
Binding site 790-808
mfe : -14.76
Hybrid sequence
AGGUCGUUUCCCUUCGCgaaa
TCC--CAGAGAGAAGCGagag miR-524
Target on HDV 
Binding site 1384-1405
mfe : -20
Hybrid sequence
uGAGGU-UUCCCUUCGCGGAAG
tCTTCGCCGGGGGAGCCCCCTC miR-525
Target on HDV 
Binding site 999-1020
mfe : -15.9
Hybrid sequence
uCUUUCACGUA-GGGAGACCuc
gGGAAGAGTATATCCTATGGga miR-526a
Target on HDV 
Binding site 146-164
mfe : -12.3
Hybrid sequence
ucuuUCACGAAGGGAGAUCuc
cgccAGTG--AAACTCTAGga miR-99b
Target on HDV 
Binding site 999-1021
mfe : -13.8
Hybrid sequence
gCGUUC-CAGCCAAGAUGCCCac
gGGAAGAGTATATCCTATGGGaa miR-100
Target on HDV 
Binding site 1145-1165
mfe : -12.33
Hybrid sequence
GUGUUCAAGCCUAGAUGCCCaa
CAC-ACCCCCAACCTGCGGGcc miR-128a
Target on HDV 
Binding site 1648-1670
mfe : -16.1
Hybrid sequence
UUUUCUCUGGCCA-AGUGACAcu
AGAGGAGACTGCTGGCCCTGTcg miR-133a
Target on HDV 
Binding site 201-222
mfe : -13.3
Hybrid sequence
ugucGACCAACUUCCCCUGGuu
cctcCCGATCCGAGGGGCCCgg miR-133b
Target on HDV 
Binding site 202-222
mfe : -13.3
Hybrid sequence
aucGACCAACUUCCCCUGGuu
ctcCCGATCCGAGGGGCCCgg miR-149
Target on HDV 
Binding site 384-408
mfe : -21.6
Hybrid sequence
CCUCA----CUUCUGUGCCUCGGUCu
GGAGTTGGGGGAGAC-CGAAGCGAGg miR-149
Target on HDV 
Binding site 976-997
mfe : -20.2
Hybrid sequence
CCUCACUUCUGUGCCUCGGUCu
GGGGAGAGGAGGGAGGGTCGGc miR-152
Target on HDV 
Binding site 946-962
mfe : -12.1
Hybrid sequence
GGGUUCAAGACAGUACGUGACu
CCC--G--CT-TTATTCACTGg miR-184
Target on HDV 
Binding site 1307-1328
mfe : -21.8
Hybrid sequence
ugGGAAUAGUCA-AGAGGCAGGu
ctCCTTGTCGGTGAATCC-TCCc miR-185
Target on HDV 
Binding site 1256-1272
mfe : -13.6
Hybrid sequence
cUUGACGGAAAGAGAggu
tAGCTG-CTTTCTCTtgt