Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HEV target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
 Browse   Structural and nonstructural protein mRNA, complete cds   Complete cds   mexican strain) structural proteins and a nonstructural polyprotein genes, complete cds   nonstructural polyprotein and putative capsid protein genes, complete cds   
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 2592 rescords (52 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7a61436166-14.7121
uugauaUGUUG--GAUGAUGGagu
|| || ||:|||||
ctcaccACCACGGCTGCTACCcgc
11.678NO
2hsa-let-7a62956318-12.5121
uugauauGUUGG-AUGAUG-GAGu
||:|: | |||| |||
tggtggcCAGCTGTTCTACTCTCg
11.678NO
3hsa-let-7b30393057-14.8121
uUGGUGUGUUGGAUGAUGGAGu
||| |:|| | |||:|| |
cACCCCGCA--C-ACTGCCGCc
11.726NO
4hsa-let-7b62956318-13.4121
uugguguGUUGG-AUGAUG-GAGu
||:|: | |||| |||
tggtggcCAGCTGTTCTACTCTCg
11.726NO
5hsa-let-7c40204041-17.1121
uugGUAUGUUGGAUGAUGGAgu
|:||||: :||| ||||
ccaCGTACAGGTTACAACCTgt
11.774NO
6hsa-let-7c53205346-21.4121
uUGGU-AUGUUGG--AUGA--UGGAGu
|||: |:|::|| :|| |||||
cACCGCTGCGGCCGGGGCTGGACCTCg
11.774NO
7hsa-let-7c62956318-13.6121
uugguauGUUGG-AUGAUG-GAGu
||:|: | |||| |||
tggtggcCAGCTGTTCTACTCTCg
11.774NO
8hsa-let-7c12761301-15.5121
uuGGUAUGUUGG----AUGAUG-GAGU
||:| ||::: | |||| ||||
ggCCGT-CAGTTGGAGTTCTACGCTCA
11.774NO
9hsa-let-7e13581378-15.1121
ugauauGUUGGAGGAUGGAGu
|::|| |||:|| |
atgagtCGGCCCCCTGCCACt
6.037NO
10hsa-let-7i62906318-17.9121
uGUCG-----UGUUUGAU--GAUG-GAGu
|:|| :| |:||: |||| |||
tCGGCTGGTGGCCAGCTGTTCTACTCTCg
7.883NO
11hsa-miR-10049374958-13.2121
guguucaAGCCUAGAUGCCCaa
||| :|:||:|||
ttgtctcTCGTGTTTATGGGgt
9.137NO
12hsa-miR-10046154638-13.5121
gUGUUCAA-GC-CUAGAUGCCCAa
|::| || || |||||:| |||
tATGATTTCCGCGATCTGCAGGTg
9.137NO
13hsa-miR-10351215148-17.2121
aGUAU-CGGGA--C--AUGUUACGACGA
|||: ||||| | ||: |||||:|
cCATGCGCCCTCGGCCTATTTTGCTGTT
9.493NO
14hsa-miR-106a62096234-12121
cgaUGGAC-GUGACAU-UCGUGAAaa
|:| | |:| | | |||:|||
gagATCGGCCGCGGGATAGCGCTTac
8.618NO
15hsa-miR-10759385960-12.7121
acuAUCGGGACAUGUUACG--ACGa
|:|:|:||| |||| |||
ctcTGGTCTTGT--TATGCTTTGCa
9.255NO
16hsa-miR-10a46154639-16.9121
gUGUUUAA-GC-CUAGAUGUCCcau
|::| || || |||||:||||
tATGATTTCCGCGATCTGCAGGtgg
7.071NO
17hsa-miR-122a71477168-13.3121
uguuugugGUAACAGUGUGAGGu
|:|| |:|:||||
catttctgCGTT-CCGCGCTCCc
12.384NO
18hsa-miR-12617241744-14121
cguaauAAUGAGUGCCAUGCu
||::| |||| :||
cgtcgtTTGTTGACGGGGCGg
10.720NO
19hsa-miR-12728532877-20.5121
UCGGU-UC-G-AGUCUGCCUAGGCu
||||| || | ||:| |||: |:|
AGCCACAGACGTCGGCCGGGCCTGt
5.000NO
20hsa-miR-13270157038-13.89121
gcuGGUACC-GACAU-CUGACAau
|| ||| || | |:||||
cccCCTTGGCCTCCAGGGCTGTgc
5.000NO
21hsa-miR-133a50975124-13.3121
uGUCGAC-C---AACUU--CCCCUGGUu
| |||| | ||:: | |||||
tCTGCTGCGCCCATGGGTTCGCGACCAt
5.000NO
22hsa-miR-133a5177-15121
ugUCGACCAAC---UUC--CCCUGGUU
||| || || || | |:||||
tgAGCAGGCTGCTCTAGCAGCGGCCAA
5.000NO
23hsa-miR-133b5277-15121
aUCGACCAAC---UUC--CCCUGGUU
||| || || || | |:||||
gAGCAGGCTGCTCTAGCAGCGGCCAA
NONO
24hsa-miR-13465806601-13.72121
GGGAGACCAGUU-GGUCAGugu
|:||: | |:: ||||||
CTCTTCGACCGGCCCAGTCtat
5.000NO
25hsa-miR-135a59165938-12.7121
aguguauCCUUAUUUUUCGGUau
|||: |::|:||||
gggtggcGGAGGAGGAGGCCAcc
NONO
26hsa-miR-142-3p20792107-14.9121
AGGUAUUUCAUC---CUU-UGUG--AUGU
||||| ||:| ||: |||| ||||
TCCATTCTGTGGAGAGAGCACACTTTACA
9.468NO
27hsa-miR-14930533079-16.9121
ccucacuUCUGUG-----CCUCGGUCu
|| ||| || |||:|
ccgccagAGTCACCCAGGGGCGCCGGg
5.000NO
28hsa-miR-15061876212-16121
gUGACCAUG-UU-CC-CAACC-CUCU
||| |||| || || || || ||||
tACTAGTACTAATGGTGTCGGTGAGA
7.336NO
29hsa-miR-15158055834-12.2121
GGAGUU-CCU-----C--GAAGUCAGAUCa
||||:| || | :||:|||| ||
CCTCGACTGATGTTCGTATTTTAGTCCAGc
NONO
30hsa-miR-15242494268-16.9121
GGGUUCAAGACAGUACG-UGACU
||| :|||| |:||| |:|||
CCCTGGTTC---CGTGCTATTGA
7.093NO
31hsa-miR-15357215741-14121
aGUGA-AAACACUGAUACGuu
|:|| || |||:||| ||
aCGCTGTTGGTGGCTACGCca
7.150NO
32hsa-miR-1668746896-12.82121
GCGGUUAU-AAAUGCACGACgau
| ||| || |: ||||||
CACCACTAGCCTGGGTGCTGgcc
11.196NO
33hsa-miR-1665156541-14.4121
GCGGUU--AUAAAUGCACGA---CGAu
| ||:| || | |:||||| |||
CTCCGAGCTAATGATGTGCTTTGGCTt
11.196NO
34hsa-miR-17-5p389410-14.3121
UGAUGGACGUGACAUUCGUGAaac
|:|:|| ||:: | |||||
ATTGCCGGCGT--TCCGCACTgcg
8.771NO
35hsa-miR-17-5p607631-13.3121
UG-AUGGACGUGACAU-UCGUGAAac
|| |||| |||| | : |:||||
ACATACC-GCACCGCGTCGTACTTgc
8.771NO
36hsa-miR-17-5p62096234-12121
ugaUGGAC-GUGACAU-UCGUGAAac
|:| | |:| | | |||:|||
gagATCGGCCGCGGGATAGCGCTTac
8.771NO
37hsa-miR-17-5p769793-13.4121
ugauggacGUGACAUUC-GUGAAAC
||:|| | |||||||
gttagggcCATTGGCTGCCACTTTG
8.771NO
38hsa-miR-181d27932817-15.8121
UUGGGUG-GCUGUUGUUACUUACAA
|||:| | | |:||| : |:|||||
AACTCTCACTATAACTGAGGATGTT
NONO
39hsa-miR-182*45724595-15.5121
aucaACCGU---UCAGAUCUUGgu
||| | |||||:||||
tctaTGGAATACAGTCTGGAACat
5.173NO
40hsa-miR-18461016121-15.7121
uGGGAAUAGUCAAGAGGCAGgu
||| | | | ||:||||
gCCCGTCACCG-CCTTCGTCgc
5.000NO
41hsa-miR-18434843502-14.6121
ugGGAAU-AGUCAAGAGGCAGGu
||| | |||| :|||||
ggCCTCATTCAG----TCGTCCc
5.000NO
42hsa-miR-18467076738-17.7121
UGGG----AAU-AG--UC---AAGAGGCAGGu
|||| || || || ||||::||||
ACCCAGCAGTATTCAAAGACCTTCTTTGTCCt
5.000NO
43hsa-miR-18527842801-14.4121
CUUGACGGAAAGAGAGgu
|| ||||| |||||
GACCTGCCCAACTCTCac
6.327NO
44hsa-miR-18a*10491068-13.1121
UCUUCCUCGUGAAUCCCGUca
| |||| :||| |||||
ACAAGG-TTACTGTGGGCAcc
NONO
45hsa-miR-19152195237-12.9121
uCGACGAAAACC-CUAAGGCaac
|| || || |:|||||
cGCAGC----GGCGGTTCCGgcg
NONO
46hsa-miR-191*12871314-13.6121
CCCC----UGC--UUUAGGUUCGCGUCg
|| | ||| |:| :|:|||| |
GGAGTTCTACGCTCAGTGTAGGCGCTGg
NONO
47hsa-miR-196a22782297-13.7121
GGUUGUUGUACUUUGAUGGau
||::| | ||: :|||||
CCGGC-TCCTGGCGCTACCgc
NONO
48hsa-miR-196b348368-14.6121
gGUUGUUGUCCUUUGAUGGau
||:|: ::| | |||:||
tCAGCGTTGGTATACTGCCcc
NONO
49hsa-miR-19744394457-17.9121
cgacCCACCUCUUCCACCACUu
||||||| |||| ||
ttatGGTGGAG--TGTGG-GAt
6.957NO
50hsa-miR-19748604893-15.5121
CGACCCACCUCUUC------------CAC-CACUu
|| ||| | || || ||| ||||
GC-GGGCGAAGCAGCTCCGCCTCGCTGTGAGTGAt
6.957NO
let-7a
Target on HEV 
Binding site 6143-6166
mfe : -14.7
Hybrid sequence
uugauaUGUUG--GAUGAUGGagu
ctcaccACCACGGCTGCTACCcgc let-7a
Target on HEV 
Binding site 6295-6318
mfe : -12.5
Hybrid sequence
uugauauGUUGG-AUGAUG-GAGu
tggtggcCAGCTGTTCTACTCTCg let-7b
Target on HEV 
Binding site 3039-3057
mfe : -14.8
Hybrid sequence
uUGGUGUGUUGGAUGAUGGAGu
cACCCCGCA--C-ACTGCCGCc let-7b
Target on HEV 
Binding site 6295-6318
mfe : -13.4
Hybrid sequence
uugguguGUUGG-AUGAUG-GAGu
tggtggcCAGCTGTTCTACTCTCg let-7c
Target on HEV 
Binding site 4020-4041
mfe : -17.1
Hybrid sequence
uugGUAUGUUGGAUGAUGGAgu
ccaCGTACAGGTTACAACCTgt let-7c
Target on HEV 
Binding site 5320-5346
mfe : -21.4
Hybrid sequence
uUGGU-AUGUUGG--AUGA--UGGAGu
cACCGCTGCGGCCGGGGCTGGACCTCg let-7c
Target on HEV 
Binding site 6295-6318
mfe : -13.6
Hybrid sequence
uugguauGUUGG-AUGAUG-GAGu
tggtggcCAGCTGTTCTACTCTCg let-7c
Target on HEV 
Binding site 1276-1301
mfe : -15.5
Hybrid sequence
uuGGUAUGUUGG----AUGAUG-GAGU
ggCCGT-CAGTTGGAGTTCTACGCTCA let-7e
Target on HEV 
Binding site 1358-1378
mfe : -15.1
Hybrid sequence
ugauauGUUGGAGGAUGGAGu
atgagtCGGCCCCCTGCCACt let-7i
Target on HEV 
Binding site 6290-6318
mfe : -17.9
Hybrid sequence
uGUCG-----UGUUUGAU--GAUG-GAGu
tCGGCTGGTGGCCAGCTGTTCTACTCTCg miR-100
Target on HEV 
Binding site 4937-4958
mfe : -13.2
Hybrid sequence
guguucaAGCCUAGAUGCCCaa
ttgtctcTCGTGTTTATGGGgt miR-100
Target on HEV 
Binding site 4615-4638
mfe : -13.5
Hybrid sequence
gUGUUCAA-GC-CUAGAUGCCCAa
tATGATTTCCGCGATCTGCAGGTg miR-103
Target on HEV 
Binding site 5121-5148
mfe : -17.2
Hybrid sequence
aGUAU-CGGGA--C--AUGUUACGACGA
cCATGCGCCCTCGGCCTATTTTGCTGTT miR-106a
Target on HEV 
Binding site 6209-6234
mfe : -12
Hybrid sequence
cgaUGGAC-GUGACAU-UCGUGAAaa
gagATCGGCCGCGGGATAGCGCTTac miR-107
Target on HEV 
Binding site 5938-5960
mfe : -12.7
Hybrid sequence
acuAUCGGGACAUGUUACG--ACGa
ctcTGGTCTTGT--TATGCTTTGCa miR-10a
Target on HEV 
Binding site 4615-4639
mfe : -16.9
Hybrid sequence
gUGUUUAA-GC-CUAGAUGUCCcau
tATGATTTCCGCGATCTGCAGGtgg miR-122a
Target on HEV 
Binding site 7147-7168
mfe : -13.3
Hybrid sequence
uguuugugGUAACAGUGUGAGGu
catttctgCGTT-CCGCGCTCCc miR-126
Target on HEV 
Binding site 1724-1744
mfe : -14
Hybrid sequence
cguaauAAUGAGUGCCAUGCu
cgtcgtTTGTTGACGGGGCGg miR-127
Target on HEV 
Binding site 2853-2877
mfe : -20.5
Hybrid sequence
UCGGU-UC-G-AGUCUGCCUAGGCu
AGCCACAGACGTCGGCCGGGCCTGt miR-132
Target on HEV 
Binding site 7015-7038
mfe : -13.89
Hybrid sequence
gcuGGUACC-GACAU-CUGACAau
cccCCTTGGCCTCCAGGGCTGTgc miR-133a
Target on HEV 
Binding site 5097-5124
mfe : -13.3
Hybrid sequence
uGUCGAC-C---AACUU--CCCCUGGUu
tCTGCTGCGCCCATGGGTTCGCGACCAt miR-133a
Target on HEV 
Binding site 51-77
mfe : -15
Hybrid sequence
ugUCGACCAAC---UUC--CCCUGGUU
tgAGCAGGCTGCTCTAGCAGCGGCCAA miR-133b
Target on HEV 
Binding site 52-77
mfe : -15
Hybrid sequence
aUCGACCAAC---UUC--CCCUGGUU
gAGCAGGCTGCTCTAGCAGCGGCCAA miR-134
Target on HEV 
Binding site 6580-6601
mfe : -13.72
Hybrid sequence
GGGAGACCAGUU-GGUCAGugu
CTCTTCGACCGGCCCAGTCtat miR-135a
Target on HEV 
Binding site 5916-5938
mfe : -12.7
Hybrid sequence
aguguauCCUUAUUUUUCGGUau
gggtggcGGAGGAGGAGGCCAcc miR-142-3p
Target on HEV 
Binding site 2079-2107
mfe : -14.9
Hybrid sequence
AGGUAUUUCAUC---CUU-UGUG--AUGU
TCCATTCTGTGGAGAGAGCACACTTTACA miR-149
Target on HEV 
Binding site 3053-3079
mfe : -16.9
Hybrid sequence
ccucacuUCUGUG-----CCUCGGUCu
ccgccagAGTCACCCAGGGGCGCCGGg miR-150
Target on HEV 
Binding site 6187-6212
mfe : -16
Hybrid sequence
gUGACCAUG-UU-CC-CAACC-CUCU
tACTAGTACTAATGGTGTCGGTGAGA miR-151
Target on HEV 
Binding site 5805-5834
mfe : -12.2
Hybrid sequence
GGAGUU-CCU-----C--GAAGUCAGAUCa
CCTCGACTGATGTTCGTATTTTAGTCCAGc miR-152
Target on HEV 
Binding site 4249-4268
mfe : -16.9
Hybrid sequence
GGGUUCAAGACAGUACG-UGACU
CCCTGGTTC---CGTGCTATTGA miR-153
Target on HEV 
Binding site 5721-5741
mfe : -14
Hybrid sequence
aGUGA-AAACACUGAUACGuu
aCGCTGTTGGTGGCTACGCca miR-16
Target on HEV 
Binding site 6874-6896
mfe : -12.82
Hybrid sequence
GCGGUUAU-AAAUGCACGACgau
CACCACTAGCCTGGGTGCTGgcc miR-16
Target on HEV 
Binding site 6515-6541
mfe : -14.4
Hybrid sequence
GCGGUU--AUAAAUGCACGA---CGAu
CTCCGAGCTAATGATGTGCTTTGGCTt miR-17-5p
Target on HEV 
Binding site 389-410
mfe : -14.3
Hybrid sequence
UGAUGGACGUGACAUUCGUGAaac
ATTGCCGGCGT--TCCGCACTgcg miR-17-5p
Target on HEV 
Binding site 607-631
mfe : -13.3
Hybrid sequence
UG-AUGGACGUGACAU-UCGUGAAac
ACATACC-GCACCGCGTCGTACTTgc miR-17-5p
Target on HEV 
Binding site 6209-6234
mfe : -12
Hybrid sequence
ugaUGGAC-GUGACAU-UCGUGAAac
gagATCGGCCGCGGGATAGCGCTTac miR-17-5p
Target on HEV 
Binding site 769-793
mfe : -13.4
Hybrid sequence
ugauggacGUGACAUUC-GUGAAAC
gttagggcCATTGGCTGCCACTTTG miR-181d
Target on HEV 
Binding site 2793-2817
mfe : -15.8
Hybrid sequence
UUGGGUG-GCUGUUGUUACUUACAA
AACTCTCACTATAACTGAGGATGTT miR-182*
Target on HEV 
Binding site 4572-4595
mfe : -15.5
Hybrid sequence
aucaACCGU---UCAGAUCUUGgu
tctaTGGAATACAGTCTGGAACat miR-184
Target on HEV 
Binding site 6101-6121
mfe : -15.7
Hybrid sequence
uGGGAAUAGUCAAGAGGCAGgu
gCCCGTCACCG-CCTTCGTCgc miR-184
Target on HEV 
Binding site 3484-3502
mfe : -14.6
Hybrid sequence
ugGGAAU-AGUCAAGAGGCAGGu
ggCCTCATTCAG----TCGTCCc miR-184
Target on HEV 
Binding site 6707-6738
mfe : -17.7
Hybrid sequence
UGGG----AAU-AG--UC---AAGAGGCAGGu
ACCCAGCAGTATTCAAAGACCTTCTTTGTCCt miR-185
Target on HEV 
Binding site 2784-2801
mfe : -14.4
Hybrid sequence
CUUGACGGAAAGAGAGgu
GACCTGCCCAACTCTCac miR-18a*
Target on HEV 
Binding site 1049-1068
mfe : -13.1
Hybrid sequence
UCUUCCUCGUGAAUCCCGUca
ACAAGG-TTACTGTGGGCAcc miR-191
Target on HEV 
Binding site 5219-5237
mfe : -12.9
Hybrid sequence
uCGACGAAAACC-CUAAGGCaac
cGCAGC----GGCGGTTCCGgcg miR-191*
Target on HEV 
Binding site 1287-1314
mfe : -13.6
Hybrid sequence
CCCC----UGC--UUUAGGUUCGCGUCg
GGAGTTCTACGCTCAGTGTAGGCGCTGg miR-196a
Target on HEV 
Binding site 2278-2297
mfe : -13.7
Hybrid sequence
GGUUGUUGUACUUUGAUGGau
CCGGC-TCCTGGCGCTACCgc miR-196b
Target on HEV 
Binding site 348-368
mfe : -14.6
Hybrid sequence
gGUUGUUGUCCUUUGAUGGau
tCAGCGTTGGTATACTGCCcc miR-197
Target on HEV 
Binding site 4439-4457
mfe : -17.9
Hybrid sequence
cgacCCACCUCUUCCACCACUu
ttatGGTGGAG--TGTGG-GAt miR-197
Target on HEV 
Binding site 4860-4893
mfe : -15.5
Hybrid sequence
CGACCCACCUCUUC------------CAC-CACUu
GC-GGGCGAAGCAGCTCCGCCTCGCTGTGAGTGAt