Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HBV wildtype target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    adr   adyw   unspecified   ayw   adr4   ayw(patient C)   adw2   wildtype    
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 1075 rescords (22 pages)previous   Page 2   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
51hsa-miR-37017931814-13121
gguCCAAG-GUGGGGUCGUccg
||| | : | ||||||
attGGTGCGTTCACCAGCAcca
NONO
52hsa-miR-3701944-14.8121
gguccAAG--GUGGGGUC---GUCCg
||| |:||||| ||||
aactcTTCAAGATCCCAGAGTCAGGg
NONO
53hsa-miR-37030713095-18.2121
gguCCAAGGUGGG-GUC---GUCCg
||| :||| ||| ||||
tggGGTGGAGCCCTCAGGCTCAGGg
NONO
54hsa-miR-37112971318-12.9121
uGUGAGUUUUCU--ACCGCCGUg
| | ||: ||: ||| ||||
gCTCGCAGCAGGTCTGG-GGCAa
NONO
55hsa-miR-37129843009-13.7121
UGUGAGU-UUUCU----ACCGCCGUG
|||| || ||:|| |||| | ||
ACACGCACAAGGACTACTGGCCGGAC
NONO
56hsa-miR-380-5p28002822-15.9121
CGCGUA-CAAGAU-ACCAGUUGGU
|||| | ||:|: |||| ||||
GCGCCTCATTTTGCGGGTC-ACCA
NONO
57hsa-miR-383384413-13.8121
uCGGUGU----UAGUGGA---AGAC-UAGa
|| :|: ||||:|| |||| |||
tGCGGCGTTTTATCATCTTCCTCTGCATCc
NONO
58hsa-miR-409-3p281313-19.1121
uCCCCAAGUGG----------CUCGUUGUAAGC
|||| |||| |: ||| |||||
gGGGGAACACCCGTGTGTCTTGGCCAAAATTCG
NONO
59hsa-miR-412187209-16.8121
uGCCGAUCACCUGGUCCACUUCA
| ||| ||| |||| |::||
cCTGCTCGTGTTACAGGCGGGGT
NONO
60hsa-miR-41230043026-16.5121
uGCC-GAUCACCUGGUCCA-CUUCA
||| | |||| |||| |:|||
cCGGACGCATGGA--AGGTGGGAGT
NONO
61hsa-miR-422a18541875-11121
CCGGAAGACUGGGAUUC--AGGUc
| ||| ||| :| ||| ||||
GTCCTACTGTTC--AAGCCTCCAa
NONO
62hsa-miR-425854871-13.82121
CCGCCUGUGCUGUAAGGGcua
| :||: ||:||||||
GATGGG---GATATTCCCtta
NONO
63hsa-miR-43120522075-14121
acGUACUGCCG---G-ACGUUCugu
||| ||||| | |||||
acCAT-ACGGCAATCAGGCAAGcta
NONO
64hsa-miR-43214471468-16.2121
GGUGGGUUACUGGAUGAGGUUCu
|| | :| |||| |||| :|
CCCGCGGACGACC-CCTCCCGGg
NONO
65hsa-miR-485-5p12621290-13.5121
cuUAAGUA--GUGCC-----GGUCGGAGA
|| ||| ::||| |:|||| ||
cgATCCATACTGCGGAACTCCTAGCCGCT
NONO
66hsa-miR-48822292259-11.8121
AACUCUC------AC--GG--UAAUAGACCc
|||:||| || |: | |||:|||
TTGGGAGACAAACTGTTCTTGAATATTTGGt
NONO
67hsa-miR-49119721994-11.7121
AGGAGUACCUUCCCAAGGGGUGa
|||| || | | ||:|| |
TCCTGCTGTTCGAGATCTCCTCg
NONO
68hsa-miR-49231833205-12121
UUCUUAG-AACAGGGCGUCCAGGa
||||: | | :|| |||| ||
AAGAGACACTCATCCACAGG-CCa
NONO
69hsa-miR-493-3p20042027-14121
GAC----CGUGUGUCAUCUGGAAgu
||| |:|: |:| ||:||||
CTGCTCTGTAT-CGGGAGGCCTTag
NONO
70hsa-miR-50220582075-10.22121
auCGUGGGUCUAUCGUUCcua
||| :||| |||||
cgGCAATCAG---GCAAGcta
NONO
71hsa-miR-5033762-19121
gacGUCUU--GACAAGG--GCGACGAu
|||:: |||| || | |||||
agtCAGGGCCCTGTACCTTC-CTGCTg
NONO
72hsa-miR-50920452066-13.9121
AGAUGGGUGUCUGCAUG--GUUAGU
|| |:||| | ||| ||||||
TCACCTCAC---CATACGGCAATCA
NONO
73hsa-miR-512-3p14161443-12121
CUGGAGUCGA---UA---CUGUCGUGAa
| |||: |:| :| | |:||:||
GTCCTTTGTTTACGTCCCGTCGGCGCTg
NONO
74hsa-miR-512-3p20462065-13.42121
cUGGAGUCGAUACUGUCGUGAa
|||||| | || ||:||| |
cACCTCA-CCAT-ACGGCAATc
NONO
75hsa-miR-512-3p31433166-11.9121
CUG-GAGUCGAUACUGUCG--UGAa
|:| |||| | |:|||| |||
GGCAGTCAG-GAAGGCAGCCTACTc
NONO
76hsa-miR-515-3p28592884-10.2121
ugcgAGGUUU-----UCUUCCGUgag
|||||| | ||||||
gtctTCCAAACCTCGAAAAGGCAtgg
NONO
77hsa-miR-516-5p313333-11.32121
uuUCACGAAGAAUGGAGGUCuac
||| | | |:||||||
gcAGTCC--CAAATCTCCAGtca
NONO
78hsa-miR-516-5p19591988-11.81121
uuucAC-GAAGAAUGG------AGGUCUAc
|| |||||| || || ||||
cttcTGACTTCTTTCCTGCTGTTCGAGATc
NONO
79hsa-miR-518f*31633187-12.4121
ucucuuucacGAAG-GGAGA-UCUC
|| | ||||| ||||
actcccttatCTCCACCTCTAAGAG
NONO
80hsa-miR-524*12281252-10.2121
cUCUUUCACGAA---GGGAAACAuc
|| : ||| | |||||||
cAGCGCATGCGTGGAACCTTTGTgt
NONO
81hsa-miR-525*30803100-11.2121
CGAGAUUUCCCUUCGCGGAag
|| || |:| || ||||
GCCCTCAGGCTCAGGGCCTac
NONO
82hsa-miR-525*31433164-12.1121
cgagauuUCCCUUCG-CGGAag
||| |:|| ||||
ggcagtcAGGAAGGCAGCCTac
NONO
83hsa-miR-526a31653187-12.4121
ucuuucacGAAG-GGAGA-UCUC
|| | ||||| ||||
tcccttatCTCCACCTCTAAGAG
NONO
84hsa-miR-526b31623187-12121
uugucuuucacGAAG-GGAG-UUCUC
|| | |||| |||||
tactcccttatCTCCACCTCTAAGAG
NONO
85hsa-miR-526c31623187-12.4121
uugucuuucgcGAAG-GGAGA-UCUC
|| | ||||| ||||
tactcccttatCTCCACCTCTAAGAG
NONO
86hsa-miR-542-3p28832904-13.5121
aaagucaaUAGUUAGACAGUGu
||| ||||| |
ggggacaaATCTTGCTGTCCCc
NONO
87hsa-miR-9810771101-14.6121
UUGUUAUGUU---GAAUGAUGGAGu
|:||| |||: :||||| :|||
AGCAAAACAGGCTTTTACTTTCTCg
6.856NO
88hsa-miR-99b24662491-17.1121
GCGUUCCAGCC---AAGAUG-CCCac
| :||||| || |:||| |||
CATAAGGTGGGAAACTTTACTGGGct
7.475NO
89hsa-let-7b14681489-12.9122
uuGGUGUG-UUGGAUGAUGGAGu
||:| : :: || ||||| |
ggCCGCTTGGGGCT-CTACCGCc
11.726NO
90hsa-let-7c15731598-15.8122
uUGGUAUGU-UGGA-UGA--UGGAGu
|||:|::: ||:| :|| |||||
gACCGTGTGCACTTCGCTTCACCTCt
11.774NO
91hsa-let-7e15761598-14.3122
ugAUAUGUUGGAG-GA--UGGAGu
|:|:| ||:|| || |||||
cgTGTGC-ACTTCGCTTCACCTCt
6.037NO
92hsa-let-7g15741598-11.3122
UGACAUGUUUGA--UGA--UGGAGu
|| ||::: ||| :|| |||||
ACCGTGTGCACTTCGCTTCACCTCt
9.988NO
93hsa-let-7i385407-11.34122
uGUCGU--GUUUGAUGAUGGAGu
|:||: : | | || ||||
gCGGCGTTTTATCATCTTCCTCt
7.883NO
94hsa-miR-122a13301354-13.9122
UGUUUGUGGUAACAG--UGUGAGGu
|| :||| : |||| :| ||||
ACTGACAATTCTGTCGTGCTCTCCc
12.384NO
95hsa-miR-125a20162038-14.4122
gugUCC--AAUUUCCCAGAGUCCcu
||| |||:| ||||| ||
gggAGGCCTTAGA--GTCTCCGGaa
10.086NO
96hsa-miR-125b21262148-11.4122
AGUGUUCAA--UCCCAGAGUCCCU
|:: ||| | || || ||||||
TTGGAAGATCAAGCATC-CAGGGA
10.846NO
97hsa-miR-127529549-12.8122
UCG-GUUCGAGUCUGCCUAGGcu
||| | ||||| | ||| ||
AGCTCCTGCTCA-A-GGAACCtc
5.000NO
98hsa-miR-129500523-13.3122
cGUUCG-GGUCUGG--CGUUUUuc
| ||| | :|||| ||||:|
aCCAGCACGGGACCATGCAAGAct
5.000NO
99hsa-miR-133a18731903-15.92122
ugUCGAC-C--AACU--UC----CCCUGguu
||||| | |||: :| |||||
caAGCTGTGCCTTGGGTGGCTTTGGGACatg
5.000NO
100hsa-miR-133a11991220-20.3122
uGUCGACCAACUUCCC---CUGGUu
|| ||||||| ||| |:|||
cCA-CTGGTTG--GGGCTTGGCCAt
5.000NO
miR-370
Target on HBV wildtype 
Binding site 1793-1814
mfe : -13
Hybrid sequence
gguCCAAG-GUGGGGUCGUccg
attGGTGCGTTCACCAGCAcca miR-370
Target on HBV wildtype 
Binding site 19-44
mfe : -14.8
Hybrid sequence
gguccAAG--GUGGGGUC---GUCCg
aactcTTCAAGATCCCAGAGTCAGGg miR-370
Target on HBV wildtype 
Binding site 3071-3095
mfe : -18.2
Hybrid sequence
gguCCAAGGUGGG-GUC---GUCCg
tggGGTGGAGCCCTCAGGCTCAGGg miR-371
Target on HBV wildtype 
Binding site 1297-1318
mfe : -12.9
Hybrid sequence
uGUGAGUUUUCU--ACCGCCGUg
gCTCGCAGCAGGTCTGG-GGCAa miR-371
Target on HBV wildtype 
Binding site 2984-3009
mfe : -13.7
Hybrid sequence
UGUGAGU-UUUCU----ACCGCCGUG
ACACGCACAAGGACTACTGGCCGGAC miR-380-5p
Target on HBV wildtype 
Binding site 2800-2822
mfe : -15.9
Hybrid sequence
CGCGUA-CAAGAU-ACCAGUUGGU
GCGCCTCATTTTGCGGGTC-ACCA miR-383
Target on HBV wildtype 
Binding site 384-413
mfe : -13.8
Hybrid sequence
uCGGUGU----UAGUGGA---AGAC-UAGa
tGCGGCGTTTTATCATCTTCCTCTGCATCc miR-409-3p
Target on HBV wildtype 
Binding site 281-313
mfe : -19.1
Hybrid sequence
uCCCCAAGUGG----------CUCGUUGUAAGC
gGGGGAACACCCGTGTGTCTTGGCCAAAATTCG miR-412
Target on HBV wildtype 
Binding site 187-209
mfe : -16.8
Hybrid sequence
uGCCGAUCACCUGGUCCACUUCA
cCTGCTCGTGTTACAGGCGGGGT miR-412
Target on HBV wildtype 
Binding site 3004-3026
mfe : -16.5
Hybrid sequence
uGCC-GAUCACCUGGUCCA-CUUCA
cCGGACGCATGGA--AGGTGGGAGT miR-422a
Target on HBV wildtype 
Binding site 1854-1875
mfe : -11
Hybrid sequence
CCGGAAGACUGGGAUUC--AGGUc
GTCCTACTGTTC--AAGCCTCCAa miR-425
Target on HBV wildtype 
Binding site 854-871
mfe : -13.82
Hybrid sequence
CCGCCUGUGCUGUAAGGGcua
GATGGG---GATATTCCCtta miR-431
Target on HBV wildtype 
Binding site 2052-2075
mfe : -14
Hybrid sequence
acGUACUGCCG---G-ACGUUCugu
acCAT-ACGGCAATCAGGCAAGcta miR-432
Target on HBV wildtype 
Binding site 1447-1468
mfe : -16.2
Hybrid sequence
GGUGGGUUACUGGAUGAGGUUCu
CCCGCGGACGACC-CCTCCCGGg miR-485-5p
Target on HBV wildtype 
Binding site 1262-1290
mfe : -13.5
Hybrid sequence
cuUAAGUA--GUGCC-----GGUCGGAGA
cgATCCATACTGCGGAACTCCTAGCCGCT miR-488
Target on HBV wildtype 
Binding site 2229-2259
mfe : -11.8
Hybrid sequence
AACUCUC------AC--GG--UAAUAGACCc
TTGGGAGACAAACTGTTCTTGAATATTTGGt miR-491
Target on HBV wildtype 
Binding site 1972-1994
mfe : -11.7
Hybrid sequence
AGGAGUACCUUCCCAAGGGGUGa
TCCTGCTGTTCGAGATCTCCTCg miR-492
Target on HBV wildtype 
Binding site 3183-3205
mfe : -12
Hybrid sequence
UUCUUAG-AACAGGGCGUCCAGGa
AAGAGACACTCATCCACAGG-CCa miR-493-3p
Target on HBV wildtype 
Binding site 2004-2027
mfe : -14
Hybrid sequence
GAC----CGUGUGUCAUCUGGAAgu
CTGCTCTGTAT-CGGGAGGCCTTag miR-502
Target on HBV wildtype 
Binding site 2058-2075
mfe : -10.22
Hybrid sequence
auCGUGGGUCUAUCGUUCcua
cgGCAATCAG---GCAAGcta miR-503
Target on HBV wildtype 
Binding site 37-62
mfe : -19
Hybrid sequence
gacGUCUU--GACAAGG--GCGACGAu
agtCAGGGCCCTGTACCTTC-CTGCTg miR-509
Target on HBV wildtype 
Binding site 2045-2066
mfe : -13.9
Hybrid sequence
AGAUGGGUGUCUGCAUG--GUUAGU
TCACCTCAC---CATACGGCAATCA miR-512-3p
Target on HBV wildtype 
Binding site 1416-1443
mfe : -12
Hybrid sequence
CUGGAGUCGA---UA---CUGUCGUGAa
GTCCTTTGTTTACGTCCCGTCGGCGCTg miR-512-3p
Target on HBV wildtype 
Binding site 2046-2065
mfe : -13.42
Hybrid sequence
cUGGAGUCGAUACUGUCGUGAa
cACCTCA-CCAT-ACGGCAATc miR-512-3p
Target on HBV wildtype 
Binding site 3143-3166
mfe : -11.9
Hybrid sequence
CUG-GAGUCGAUACUGUCG--UGAa
GGCAGTCAG-GAAGGCAGCCTACTc miR-515-3p
Target on HBV wildtype 
Binding site 2859-2884
mfe : -10.2
Hybrid sequence
ugcgAGGUUU-----UCUUCCGUgag
gtctTCCAAACCTCGAAAAGGCAtgg miR-516-5p
Target on HBV wildtype 
Binding site 313-333
mfe : -11.32
Hybrid sequence
uuUCACGAAGAAUGGAGGUCuac
gcAGTCC--CAAATCTCCAGtca miR-516-5p
Target on HBV wildtype 
Binding site 1959-1988
mfe : -11.81
Hybrid sequence
uuucAC-GAAGAAUGG------AGGUCUAc
cttcTGACTTCTTTCCTGCTGTTCGAGATc miR-518f*
Target on HBV wildtype 
Binding site 3163-3187
mfe : -12.4
Hybrid sequence
ucucuuucacGAAG-GGAGA-UCUC
actcccttatCTCCACCTCTAAGAG miR-524*
Target on HBV wildtype 
Binding site 1228-1252
mfe : -10.2
Hybrid sequence
cUCUUUCACGAA---GGGAAACAuc
cAGCGCATGCGTGGAACCTTTGTgt miR-525*
Target on HBV wildtype 
Binding site 3080-3100
mfe : -11.2
Hybrid sequence
CGAGAUUUCCCUUCGCGGAag
GCCCTCAGGCTCAGGGCCTac miR-525*
Target on HBV wildtype 
Binding site 3143-3164
mfe : -12.1
Hybrid sequence
cgagauuUCCCUUCG-CGGAag
ggcagtcAGGAAGGCAGCCTac miR-526a
Target on HBV wildtype 
Binding site 3165-3187
mfe : -12.4
Hybrid sequence
ucuuucacGAAG-GGAGA-UCUC
tcccttatCTCCACCTCTAAGAG miR-526b
Target on HBV wildtype 
Binding site 3162-3187
mfe : -12
Hybrid sequence
uugucuuucacGAAG-GGAG-UUCUC
tactcccttatCTCCACCTCTAAGAG miR-526c
Target on HBV wildtype 
Binding site 3162-3187
mfe : -12.4
Hybrid sequence
uugucuuucgcGAAG-GGAGA-UCUC
tactcccttatCTCCACCTCTAAGAG miR-542-3p
Target on HBV wildtype 
Binding site 2883-2904
mfe : -13.5
Hybrid sequence
aaagucaaUAGUUAGACAGUGu
ggggacaaATCTTGCTGTCCCc miR-98
Target on HBV wildtype 
Binding site 1077-1101
mfe : -14.6
Hybrid sequence
UUGUUAUGUU---GAAUGAUGGAGu
AGCAAAACAGGCTTTTACTTTCTCg miR-99b
Target on HBV wildtype 
Binding site 2466-2491
mfe : -17.1
Hybrid sequence
GCGUUCCAGCC---AAGAUG-CCCac
CATAAGGTGGGAAACTTTACTGGGct let-7b
Target on HBV wildtype 
Binding site 1468-1489
mfe : -12.9
Hybrid sequence
uuGGUGUG-UUGGAUGAUGGAGu
ggCCGCTTGGGGCT-CTACCGCc let-7c
Target on HBV wildtype 
Binding site 1573-1598
mfe : -15.8
Hybrid sequence
uUGGUAUGU-UGGA-UGA--UGGAGu
gACCGTGTGCACTTCGCTTCACCTCt let-7e
Target on HBV wildtype 
Binding site 1576-1598
mfe : -14.3
Hybrid sequence
ugAUAUGUUGGAG-GA--UGGAGu
cgTGTGC-ACTTCGCTTCACCTCt let-7g
Target on HBV wildtype 
Binding site 1574-1598
mfe : -11.3
Hybrid sequence
UGACAUGUUUGA--UGA--UGGAGu
ACCGTGTGCACTTCGCTTCACCTCt let-7i
Target on HBV wildtype 
Binding site 385-407
mfe : -11.34
Hybrid sequence
uGUCGU--GUUUGAUGAUGGAGu
gCGGCGTTTTATCATCTTCCTCt miR-122a
Target on HBV wildtype 
Binding site 1330-1354
mfe : -13.9
Hybrid sequence
UGUUUGUGGUAACAG--UGUGAGGu
ACTGACAATTCTGTCGTGCTCTCCc miR-125a
Target on HBV wildtype 
Binding site 2016-2038
mfe : -14.4
Hybrid sequence
gugUCC--AAUUUCCCAGAGUCCcu
gggAGGCCTTAGA--GTCTCCGGaa miR-125b
Target on HBV wildtype 
Binding site 2126-2148
mfe : -11.4
Hybrid sequence
AGUGUUCAA--UCCCAGAGUCCCU
TTGGAAGATCAAGCATC-CAGGGA miR-127
Target on HBV wildtype 
Binding site 529-549
mfe : -12.8
Hybrid sequence
UCG-GUUCGAGUCUGCCUAGGcu
AGCTCCTGCTCA-A-GGAACCtc miR-129
Target on HBV wildtype 
Binding site 500-523
mfe : -13.3
Hybrid sequence
cGUUCG-GGUCUGG--CGUUUUuc
aCCAGCACGGGACCATGCAAGAct miR-133a
Target on HBV wildtype 
Binding site 1873-1903
mfe : -15.92
Hybrid sequence
ugUCGAC-C--AACU--UC----CCCUGguu
caAGCTGTGCCTTGGGTGGCTTTGGGACatg miR-133a
Target on HBV wildtype 
Binding site 1199-1220
mfe : -20.3
Hybrid sequence
uGUCGACCAACUUCCC---CUGGUu
cCA-CTGGTTG--GGGCTTGGCCAt