Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HBV wildtype target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    adr   adyw   unspecified   ayw   adr4   ayw(patient C)   adw2   wildtype    
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 1075 rescords (22 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7b22982320-16121
uUGGUGUGUU---GGAUGAUGGAGU
||||| ||| || |||:||:|
gACCAC-CAAATGCC-CCTATCTTA
11.726NO
2hsa-miR-114131434-14.1121
aUGUAUGAAG-AAAUGUAAGGu
||:| |||: |||||:| ||
gACGTCCTTTGTTTACGTCCCg
5.340NO
3hsa-miR-100371392-14.9121
GUGUUCAAGCCUAGAUGCC-CAA
|:| :| | | :|||:||| |||
CGCTGGAT-GTGTCTGCGGCGTT
9.137NO
4hsa-miR-105372395-14121
uGUCCU---CAGAC-UCGUAAAcu
| ||| ||||| :||:|||
gCTGGATGTGTCTGCGGCGTTTta
5.000NO
5hsa-miR-106b377395-14.3121
UAGACGUGACAGUCGUGAAAU
|| ||: ||| |:||::||||
ATGTGT-CTG-CGGCGTTTTA
5.784NO
6hsa-miR-10b186210-14.5121
uguuuaAGC-CAA-G-AUGUCCCAu
||| ||| | :|:||||
ccctgcTCGTGTTACAGGCGGGGTt
6.727NO
7hsa-miR-125b18711899-14.1121
AGUGUUC-------AAUCC-CAGAGUCCCU
|| |||| ||:|| | ||: ||||
TC-CAAGCTGTGCCTTGGGTGGCTTTGGGA
10.846NO
8hsa-miR-12614381457-14.3121
CGUAAUAAUGAGUGCCAUGCU
||: |: | |:||| ||||
GCGCTGAATCCCGCGG-ACGA
10.720NO
9hsa-miR-128a20232046-17121
uuuUCUC--UGGCCAAGUGACAcu
|||| |||| ||:|||
cttAGAGTCTCCGGAACATTGTtc
5.472NO
10hsa-miR-128a17071731-14.7121
uuuUCUCUGGC---CAAGUGACACu
| ||||:| |||:|||| |
ttcAAAGACTGTGTGTTTACTGAGt
5.472NO
11hsa-miR-128b20232046-17121
cuuUCUC--UGGCCAAGUGACAcu
|||| |||| ||:|||
cttAGAGTCTCCGGAACATTGTtc
5.226NO
12hsa-miR-128b17071731-14.7121
cuuUCUCUGGC---CAAGUGACACu
| ||||:| |||:|||| |
ttcAAAGACTGTGTGTTTACTGAGt
5.226NO
13hsa-miR-130b22582285-19.1121
uACGGGAAA----GUA-GUAA-CGUGAc
||:||||| ::| ||| |||||
gTGTCCTTTGGAGTGTGGATTCGCACTc
5.095NO
14hsa-miR-133a527549-10.4121
UGUCGA--CCAACUUCCCCUGGuu
|||||| | | || || |||
ACAGCTCCTGCTCAA-GGAACCtc
5.000NO
15hsa-miR-133a23392367-11.4121
UGUCGACCAACU-----UCC--CCUGGuu
|| |:|| | || ||| |||||
ACTGTTGTTAGACAAAGAGGCAGGACCcc
5.000NO
16hsa-miR-15021072133-13.31121
GU-GA-CCAUGUUCC---CAACCCUCU
|| || |||: :| | |||| |||
CACCTGGGTGGGAAGTAATTTGGAAGA
7.336NO
17hsa-miR-181b358381-10.9121
ggguGG--CUGUCGUUACUUACAa
|| | :| |: ||:||||
ttgtCCTGGTTATCGCTGGATGTg
6.484NO
18hsa-miR-182670690-11.4121
acACUCAAGAUGGUAACGGUuu
| |||| |||:| |||||
gcTCAGTT-TACTAGTGCCAtt
5.000NO
19hsa-miR-18414821502-15.4121
ugggaauaGUCAAGAGGCAGGu
|: ||||||| ||
ctaccgccCGCTTCTCCG-CCt
5.000NO
20hsa-miR-1929851008-11.1121
ccgACAGU---UAAGUAUCCAGuc
||||| | |::|:||||
gtaTGTCAACGAATTGTGGGTCtt
11.589NO
21hsa-miR-193b25822603-13.1121
uUUCGCCCUGAAAC-UCCCGGucaa
|||| | |||| :|||||
tAAGC---AATTTGTGGGGCCcctt
NONO
22hsa-miR-193b14061436-16121
uuuCGCCCU----GAAAC---UCCCGGUCAa
|||||| ||||| | | || ||
tgcGCGGGACGTCCTTTGTTTACGTCCCGTc
NONO
23hsa-miR-196a23212343-13.9121
gGUUGU--UGUACUUUGAUGgau
||||| | ||||||||
tCAACACTTCCGGAAACTACtgt
NONO
24hsa-miR-199a*401420-11.2121
uuGGUUACACGUCUGAUGACau
|| | |||| ||:|||
ttCC--TCTGCATCCTGCTGct
9.369NO
25hsa-miR-200a25482574-10.8121
UGU-AGCAAUGGU----CUGUCACAAu
||| || || || |||| ||||
ACATTCATTTGCAGGAGGACATTGTTg
6.741NO
26hsa-miR-202*28352855-12.72121
uUUCUUCAUAUACGUAUCCUuu
|||| || | ||||:|||
cAAGATCTACA-GCATGGGAgg
NONO
27hsa-miR-2036077-11.6121
GAUCACCAGGAUUUGUAAAGUg
||:|||| :| || ||||
CTGGTGGCTC----CAGTTCAg
5.000NO
28hsa-miR-20320242048-11.5121
gAUCAC-CAGGAUUUGUA--AAGUG
||| | ||| :||||| |||||
tTAGAGTCTCCGGAACATTGTTCAC
5.000NO
29hsa-miR-2063358-10.79121
GGUGU--GU---GAAGGA-AUGUAAGGu
||| | || | ||| ||| ||||
CCAGAGTCAGGGC--CCTGTACCTTCCt
5.000NO
30hsa-miR-21029933015-16.5121
agucGGCGA-CAGUGUGCGUGUC
|: || | |: |||||::|
aggaCTACTGGCCGGACGCATGG
6.639NO
31hsa-miR-21731943212-10.7121
UAGGUUAGUCAAGGACUACGUCAu
||||| ||| || ||| |||
ATCCA--CAG-GCC--ATGAAGTg
5.000NO
32hsa-miR-22411871215-18.5121
auuUGCCUU---GGUGAU---CACUGAAC
||| || |||||: | |:||||
ctgACGCAACCCCCACTGGTTGGGGCTTG
7.182NO
33hsa-miR-24632653-15.7121
gacAAGGACGACUUGACUCGGu
| ||| : |:| ||:|||
aaaTACCTATGGGAGTGGGCCt
11.006NO
34hsa-miR-30122622285-17.7121
cGAAACUGUUAUG-AUAA-CGUGAc
|||||: |:|:: ||| |||||
cCTTTGG-AGTGTGGATTCGCACTc
6.388NO
35hsa-miR-302c504525-14.6121
gGUGACUUUGUACCUUCGUGAAu
||| |:| |||| ||| ||||
gCACGGGACCATGCAAG-ACTTg
NONO
36hsa-miR-302d15631587-10.7121
uGU-GA--GUUU-GUACCUUCGUGAAu
|| || |::| |:|| ||||||
tCATCTGCCGGACCGTGT--GCACTTc
NONO
37hsa-miR-30e-3p13851404-13.4121
CGACAUUUGUAGGCUGACUUuc
||||| :| || ||||:|
GCTGT--GCTGCCAACTGGAtc
NONO
38hsa-miR-31448468-14.8121
gucGAUACGGUCGUAGAACGG
|||| :|:|| |||||
ggaCTATCAAGGTATGTTGCC
5.000NO
39hsa-miR-324-5p627650-16.7121
uGUGGUUACGGGAUCCCCU-ACgc
|:| || |||| |||| ||
tCGCAAAATACCTATGGGAGTGgg
NONO
40hsa-miR-324-5p18691893-17.34121
uGUGGUU----ACGGGAUCCCCUACGc
| |||| ||||:| ||| ||
cCTCCAAGCTGTGCCTT--GGGTGGCt
NONO
41hsa-miR-330275303-19.4121
AGAGA-CGUCC-----GGCACACGAAACg
|:||| | :|| |||||||: |||
TTTCTAGGGGGAACACCCGTGTGTCTTGg
NONO
42hsa-miR-33130443067-13.6121
aagauccuauccGGGU-CCCCG--
|||| ||||
ggttcacccctcCCCATGGGGGAC
NONO
43hsa-miR-335651670-10.6121
uguaaaAAGCAAUAACGAGAACu
| |||| | ||||||
cctcagTCCGTT-T--CTCTTGg
NONO
44hsa-miR-337629651-15.4121
uuuccguaGUAUAUCCUCGACCu
| |||:||||: ||
gcaaaataCCTATGGGAGTGGGc
NONO
45hsa-miR-33930773096-20.1121
aCUCGAGGACCUCC-UGUCCCu
|||| ||| ||| |||||
gGAGC-CCT-CAGGCTCAGGGc
NONO
46hsa-miR-340880901-13.8121
CCGAUAUUUCAUUGA--CUCUGCCu
|| ||| ||||:| ||| :||
GGATAT---GTAATTGGGAGTTGGg
NONO
47hsa-miR-34630243046-18.9121
UCUCCGUCCGUACGCCC-GUCugu
|| || | |||| |||| |||
AGTGGGA-GCATTCGGGCCAGggt
NONO
48hsa-miR-34617731793-14.5121
ucUCCGUCCGUACGCCCGUCUgu
||| |||| ||: |||| |
ctAGG-AGGC-TGTAGGCATAaa
NONO
49hsa-miR-36216241650-17.72121
UGAGUGUGGAUCC----A-AGGUUCCuaa
|| | ||| ||| | ||||||
ACGCCCAC--AGGAACCTGCCCAAGGtct
NONO
50hsa-miR-36530183036-11.3121
uauuCCUAAAAAUCCC-CGUAAu
||| | ||| |||||
ggtgGGAGT----GGGAGCATTc
NONO
let-7b
Target on HBV wildtype 
Binding site 2298-2320
mfe : -16
Hybrid sequence
uUGGUGUGUU---GGAUGAUGGAGU
gACCAC-CAAATGCC-CCTATCTTA miR-1
Target on HBV wildtype 
Binding site 1413-1434
mfe : -14.1
Hybrid sequence
aUGUAUGAAG-AAAUGUAAGGu
gACGTCCTTTGTTTACGTCCCg miR-100
Target on HBV wildtype 
Binding site 371-392
mfe : -14.9
Hybrid sequence
GUGUUCAAGCCUAGAUGCC-CAA
CGCTGGAT-GTGTCTGCGGCGTT miR-105
Target on HBV wildtype 
Binding site 372-395
mfe : -14
Hybrid sequence
uGUCCU---CAGAC-UCGUAAAcu
gCTGGATGTGTCTGCGGCGTTTta miR-106b
Target on HBV wildtype 
Binding site 377-395
mfe : -14.3
Hybrid sequence
UAGACGUGACAGUCGUGAAAU
ATGTGT-CTG-CGGCGTTTTA miR-10b
Target on HBV wildtype 
Binding site 186-210
mfe : -14.5
Hybrid sequence
uguuuaAGC-CAA-G-AUGUCCCAu
ccctgcTCGTGTTACAGGCGGGGTt miR-125b
Target on HBV wildtype 
Binding site 1871-1899
mfe : -14.1
Hybrid sequence
AGUGUUC-------AAUCC-CAGAGUCCCU
TC-CAAGCTGTGCCTTGGGTGGCTTTGGGA miR-126
Target on HBV wildtype 
Binding site 1438-1457
mfe : -14.3
Hybrid sequence
CGUAAUAAUGAGUGCCAUGCU
GCGCTGAATCCCGCGG-ACGA miR-128a
Target on HBV wildtype 
Binding site 2023-2046
mfe : -17
Hybrid sequence
uuuUCUC--UGGCCAAGUGACAcu
cttAGAGTCTCCGGAACATTGTtc miR-128a
Target on HBV wildtype 
Binding site 1707-1731
mfe : -14.7
Hybrid sequence
uuuUCUCUGGC---CAAGUGACACu
ttcAAAGACTGTGTGTTTACTGAGt miR-128b
Target on HBV wildtype 
Binding site 2023-2046
mfe : -17
Hybrid sequence
cuuUCUC--UGGCCAAGUGACAcu
cttAGAGTCTCCGGAACATTGTtc miR-128b
Target on HBV wildtype 
Binding site 1707-1731
mfe : -14.7
Hybrid sequence
cuuUCUCUGGC---CAAGUGACACu
ttcAAAGACTGTGTGTTTACTGAGt miR-130b
Target on HBV wildtype 
Binding site 2258-2285
mfe : -19.1
Hybrid sequence
uACGGGAAA----GUA-GUAA-CGUGAc
gTGTCCTTTGGAGTGTGGATTCGCACTc miR-133a
Target on HBV wildtype 
Binding site 527-549
mfe : -10.4
Hybrid sequence
UGUCGA--CCAACUUCCCCUGGuu
ACAGCTCCTGCTCAA-GGAACCtc miR-133a
Target on HBV wildtype 
Binding site 2339-2367
mfe : -11.4
Hybrid sequence
UGUCGACCAACU-----UCC--CCUGGuu
ACTGTTGTTAGACAAAGAGGCAGGACCcc miR-150
Target on HBV wildtype 
Binding site 2107-2133
mfe : -13.31
Hybrid sequence
GU-GA-CCAUGUUCC---CAACCCUCU
CACCTGGGTGGGAAGTAATTTGGAAGA miR-181b
Target on HBV wildtype 
Binding site 358-381
mfe : -10.9
Hybrid sequence
ggguGG--CUGUCGUUACUUACAa
ttgtCCTGGTTATCGCTGGATGTg miR-182
Target on HBV wildtype 
Binding site 670-690
mfe : -11.4
Hybrid sequence
acACUCAAGAUGGUAACGGUuu
gcTCAGTT-TACTAGTGCCAtt miR-184
Target on HBV wildtype 
Binding site 1482-1502
mfe : -15.4
Hybrid sequence
ugggaauaGUCAAGAGGCAGGu
ctaccgccCGCTTCTCCG-CCt miR-192
Target on HBV wildtype 
Binding site 985-1008
mfe : -11.1
Hybrid sequence
ccgACAGU---UAAGUAUCCAGuc
gtaTGTCAACGAATTGTGGGTCtt miR-193b
Target on HBV wildtype 
Binding site 2582-2603
mfe : -13.1
Hybrid sequence
uUUCGCCCUGAAAC-UCCCGGucaa
tAAGC---AATTTGTGGGGCCcctt miR-193b
Target on HBV wildtype 
Binding site 1406-1436
mfe : -16
Hybrid sequence
uuuCGCCCU----GAAAC---UCCCGGUCAa
tgcGCGGGACGTCCTTTGTTTACGTCCCGTc miR-196a
Target on HBV wildtype 
Binding site 2321-2343
mfe : -13.9
Hybrid sequence
gGUUGU--UGUACUUUGAUGgau
tCAACACTTCCGGAAACTACtgt miR-199a*
Target on HBV wildtype 
Binding site 401-420
mfe : -11.2
Hybrid sequence
uuGGUUACACGUCUGAUGACau
ttCC--TCTGCATCCTGCTGct miR-200a
Target on HBV wildtype 
Binding site 2548-2574
mfe : -10.8
Hybrid sequence
UGU-AGCAAUGGU----CUGUCACAAu
ACATTCATTTGCAGGAGGACATTGTTg miR-202*
Target on HBV wildtype 
Binding site 2835-2855
mfe : -12.72
Hybrid sequence
uUUCUUCAUAUACGUAUCCUuu
cAAGATCTACA-GCATGGGAgg miR-203
Target on HBV wildtype 
Binding site 60-77
mfe : -11.6
Hybrid sequence
GAUCACCAGGAUUUGUAAAGUg
CTGGTGGCTC----CAGTTCAg miR-203
Target on HBV wildtype 
Binding site 2024-2048
mfe : -11.5
Hybrid sequence
gAUCAC-CAGGAUUUGUA--AAGUG
tTAGAGTCTCCGGAACATTGTTCAC miR-206
Target on HBV wildtype 
Binding site 33-58
mfe : -10.79
Hybrid sequence
GGUGU--GU---GAAGGA-AUGUAAGGu
CCAGAGTCAGGGC--CCTGTACCTTCCt miR-210
Target on HBV wildtype 
Binding site 2993-3015
mfe : -16.5
Hybrid sequence
agucGGCGA-CAGUGUGCGUGUC
aggaCTACTGGCCGGACGCATGG miR-217
Target on HBV wildtype 
Binding site 3194-3212
mfe : -10.7
Hybrid sequence
UAGGUUAGUCAAGGACUACGUCAu
ATCCA--CAG-GCC--ATGAAGTg miR-224
Target on HBV wildtype 
Binding site 1187-1215
mfe : -18.5
Hybrid sequence
auuUGCCUU---GGUGAU---CACUGAAC
ctgACGCAACCCCCACTGGTTGGGGCTTG miR-24
Target on HBV wildtype 
Binding site 632-653
mfe : -15.7
Hybrid sequence
gacAAGGACGACUUGACUCGGu
aaaTACCTATGGGAGTGGGCCt miR-301
Target on HBV wildtype 
Binding site 2262-2285
mfe : -17.7
Hybrid sequence
cGAAACUGUUAUG-AUAA-CGUGAc
cCTTTGG-AGTGTGGATTCGCACTc miR-302c
Target on HBV wildtype 
Binding site 504-525
mfe : -14.6
Hybrid sequence
gGUGACUUUGUACCUUCGUGAAu
gCACGGGACCATGCAAG-ACTTg miR-302d
Target on HBV wildtype 
Binding site 1563-1587
mfe : -10.7
Hybrid sequence
uGU-GA--GUUU-GUACCUUCGUGAAu
tCATCTGCCGGACCGTGT--GCACTTc miR-30e-3p
Target on HBV wildtype 
Binding site 1385-1404
mfe : -13.4
Hybrid sequence
CGACAUUUGUAGGCUGACUUuc
GCTGT--GCTGCCAACTGGAtc miR-31
Target on HBV wildtype 
Binding site 448-468
mfe : -14.8
Hybrid sequence
gucGAUACGGUCGUAGAACGG
ggaCTATCAAGGTATGTTGCC miR-324-5p
Target on HBV wildtype 
Binding site 627-650
mfe : -16.7
Hybrid sequence
uGUGGUUACGGGAUCCCCU-ACgc
tCGCAAAATACCTATGGGAGTGgg miR-324-5p
Target on HBV wildtype 
Binding site 1869-1893
mfe : -17.34
Hybrid sequence
uGUGGUU----ACGGGAUCCCCUACGc
cCTCCAAGCTGTGCCTT--GGGTGGCt miR-330
Target on HBV wildtype 
Binding site 275-303
mfe : -19.4
Hybrid sequence
AGAGA-CGUCC-----GGCACACGAAACg
TTTCTAGGGGGAACACCCGTGTGTCTTGg miR-331
Target on HBV wildtype 
Binding site 3044-3067
mfe : -13.6
Hybrid sequence
aagauccuauccGGGU-CCCCG--
ggttcacccctcCCCATGGGGGAC miR-335
Target on HBV wildtype 
Binding site 651-670
mfe : -10.6
Hybrid sequence
uguaaaAAGCAAUAACGAGAACu
cctcagTCCGTT-T--CTCTTGg miR-337
Target on HBV wildtype 
Binding site 629-651
mfe : -15.4
Hybrid sequence
uuuccguaGUAUAUCCUCGACCu
gcaaaataCCTATGGGAGTGGGc miR-339
Target on HBV wildtype 
Binding site 3077-3096
mfe : -20.1
Hybrid sequence
aCUCGAGGACCUCC-UGUCCCu
gGAGC-CCT-CAGGCTCAGGGc miR-340
Target on HBV wildtype 
Binding site 880-901
mfe : -13.8
Hybrid sequence
CCGAUAUUUCAUUGA--CUCUGCCu
GGATAT---GTAATTGGGAGTTGGg miR-346
Target on HBV wildtype 
Binding site 3024-3046
mfe : -18.9
Hybrid sequence
UCUCCGUCCGUACGCCC-GUCugu
AGTGGGA-GCATTCGGGCCAGggt miR-346
Target on HBV wildtype 
Binding site 1773-1793
mfe : -14.5
Hybrid sequence
ucUCCGUCCGUACGCCCGUCUgu
ctAGG-AGGC-TGTAGGCATAaa miR-362
Target on HBV wildtype 
Binding site 1624-1650
mfe : -17.72
Hybrid sequence
UGAGUGUGGAUCC----A-AGGUUCCuaa
ACGCCCAC--AGGAACCTGCCCAAGGtct miR-365
Target on HBV wildtype 
Binding site 3018-3036
mfe : -11.3
Hybrid sequence
uauuCCUAAAAAUCCC-CGUAAu
ggtgGGAGT----GGGAGCATTc