Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HGV target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
 Browse   strain Iowan, complete genome   wildtype(complete genome)   
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 4939 rescords (99 pages)previous   Page 2   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
51hsa-miR-14942984316-11.8121
cCUCACUUCUGUGCCUCGGUCU
||| | ||::| || ||:||
cGAGCG--GATGC-GAACCGGA
5.000NO
52hsa-miR-14967736805-18.3121
CCUC--ACUUCUG---------UGCCUCGGUCU
|||| ||||||| || ||| | ||
GGAGACTGAAGACTCAGAACTGACTGAGGCCGA
5.000NO
53hsa-miR-15025602590-15.32121
GUGA---CCA--UGU----UCCCAACCCucu
||:| ||| ||| :| ||||||
CATTCGAGGTGGACACTTCGGTGTTGGGctg
7.336NO
54hsa-miR-15062856302-10.4121
gUGACCAUGUUCCCAACCCUCu
|| ||| || |||| |||
gAC-GGT-CA--TGTTGAGAGt
7.336NO
55hsa-miR-15011911218-10.5121
GUGACCAUG-UUCCC-----AACCCUCU
| || || | ||| |||| |||
CCCTTTGACTACGGGTTGACTTGGCAGA
7.336NO
56hsa-miR-15059065928-14.1121
GUGACCAUGUUCCCAAC-CCUCU
| | || :|::| ||| ||:||
CCCGGGGGCGGGCCTTGCGGGGA
7.336NO
57hsa-miR-15219471967-12.9121
GGGUUCAAGACAGUACGUGAcu
|:||| ||| ||||| ||
CTCAACAACTG-CATGCTCTtg
7.093NO
58hsa-miR-15248474867-11121
GGGUUCAAGACAGUACGU--GACU
|||| || | ||||| ||||
CCCA--TTGAG-GATGCACCCTGA
7.093NO
59hsa-miR-15447084729-18121
GCUUCCGUUGUGCCUAUUGGAu
||: || |:| | :|:||||
CGGTGGAAGCTGGAGTGACCTg
5.000NO
60hsa-miR-15418511871-12.8121
gcuUCCGUUGUGC-CUAUUGGAU
||| |: || |||| ||||
accAGG--ATCCGAGATACCCTA
5.000NO
61hsa-miR-15580328056-13.6121
GG-GGAUAGUGC--UAAUCGUAAUu
|| |||: : || | |||||| |
CCACCTGCTTCGACAGTAGCATAAc
5.000NO
62hsa-miR-15a722739-10.02121
GUGUUUGGUAAUACACGACgau
||| :|||| | |||||
CACTGACCA--A--TGCTGgcc
9.991NO
63hsa-miR-15a29082929-14.3121
GUGUUUGGUAAUACACGACgau
| |:::: :||: ||||||
CTCGGGTGGTTGAGTGCTGtgt
9.991NO
64hsa-miR-1650905113-14.7121
gCGGUUAUAAAUGC--ACGACGau
|| :| : ||||| |||||
gGCGGAGGGTTACGTCCGCTGCga
11.196NO
65hsa-miR-17-3p87388764-12.4121
UGUUC-ACGGA------AGUGACGUCa
|| || || | |:|| ||||
ACCAGCAGCGTTGAGGGTTACCGCAGa
6.278NO
66hsa-miR-17-3p65636583-10.9121
uGUUCACGGAAG-UGACGUCA
||| | |: || :|||| ||
gCAAATCCTATCGGCTGCTGT
6.278NO
67hsa-miR-17-5p92259251-11.95121
ugauGGAC-GUGAC-AUU-CGUGAaac
|||| :: || ||| |||||
aaagCCTGATGGTGCTAATGCACTgcc
8.771NO
68hsa-miR-181a21302153-14.3121
ugAGUGGCUGU-CGCAACUUACaa
||||: :|| | | ||:|||
ggTCACTTGCAGGAGGTGGATGca
9.523NO
69hsa-miR-181b74767502-13.7121
ggguGGCUGUCGU-----UACUUACAA
|||||| :| :|| |||||
gtggCCGACACTACTAAGGTGTATGTT
6.484NO
70hsa-miR-182*20052027-13.6121
aucaaCCGUUC-AGAU-CUUGGu
|| ::| |||| |||||
tcacgGGGGGGTTCTATGAACCc
5.173NO
71hsa-miR-182*14981520-13.2121
AUCAAC-CG-UUCAGAUCUUGGU
||| || |: :|||:||| :|||
TAGATGTGTGGAGTTTAGTGCCA
5.173NO
72hsa-miR-182*74117431-13.8121
aUCAACCGU-UCAGAUCUUGGU
|| || |: | ||||::|||
gAG-TGCCGCTGACTAGGGCCA
5.173NO
73hsa-miR-18310051039-14.3121
gUCACUUAAG-----AUGG-------UCACGGUAu
| ||:|||| |||| :|| ||||
tACTGGATTCTGGAATACCTCTGGAAGGTCCCATt
5.000NO
74hsa-miR-18331133143-14.3121
gUCACUUAA----GAUG---GUCACG--GUAu
|| || || ||:| |||||| |||
gAG-GACTTTGTCCTGCGGGCAGTGCGTCATg
5.000NO
75hsa-miR-18343794397-11.3121
gUCACUUAAGAUGGUCACGGUAu
|| |:: || | ||||||
tAGGGGGGTCAA----TGCCATt
5.000NO
76hsa-miR-18351515173-10.5121
guCACUUA--AGAUGGUCACGGUAU
| |||| ||||| | |:||||
ggGGGAATGATCTAC--GCGTCATA
5.000NO
77hsa-miR-18447834804-17.5121
uGGGAAUAGUCAAG-AGGCAGgu
|||||| || | |||||
gCCCTTA-CACCGCAGCCGTCgc
5.000NO
78hsa-miR-18556985717-15121
CUUGACGGAA--AGAGAGGu
|||| ||||| | ||||
GAACCGCCTTGGGCACTCCt
6.327NO
79hsa-miR-18737073731-17.1121
GCCGACGUU---GU-GUUCUGUGCu
|||: |:|: || |: |:||||
CGGTGGTAGGGTCACCGCGGCACGg
5.000NO
80hsa-miR-18783348359-18.1121
GCCG-----ACGUUGUGUUCUGUGCu
|||| |||:|| |||| |||
CGGCCAGTGTGCGACCCAAGCGACGc
5.000NO
81hsa-miR-18880968120-20.8121
ugGGAGG-UGGUACG--UUCCCUAC
||||: ||||| | || ||:||
ggCCTCTGACCATCCAGAATGGGTG
5.000NO
82hsa-miR-189428450-14.2121
ugacuauagucGAGUCAUCCGug
| |:||:|||
gtcccgcccttCCCGGTGGGCcg
5.126NO
83hsa-miR-18993629383-13.1121
ugaCUAUAGUCGAGUCAUCCGug
|| ||:|| | | ||||
gaaGAGCTCGGC-CCGAAGGCcg
5.126NO
84hsa-miR-18963276350-17.3121
UGACUAUAGUCGAG--UCAUCCGUg
||||:|: | |:|| | |:||||
ACTGGTGAC-GTTCTGAATGGGCAa
5.126NO
85hsa-miR-18936953721-10.9121
ugACUAUAGUCGAG----UCAUCC--GUG
|| | ||| ||| :||||| |||
tgTGCT-TCA-CTCCGGTGGTAGGGTCAC
5.126NO
86hsa-miR-18a35023520-10.9121
auaGACGUGAUCUACGUGGAAu
|| |::|| | ||||||
ctaCTTCGTTA-A--CACCTTg
NONO
87hsa-miR-18a*478500-13.7121
uCUUCC--UCGUGAAUCCCGUCa
|: || ||| :|||:||
cGGCGGCCTGCAGCCGGGGTAGc
NONO
88hsa-miR-18a*82678283-12.3121
uCUUCCUCGUGAAUCCCGUCa
||: ||| |:|||| |
tGAGAGAG----TGGGGCTGa
NONO
89hsa-miR-19111111136-12.2121
UCGACGAA-A--ACCCUAAGG-CAAC
| | | || | ||| |||| ||||
AACGGATTGTCATGGTCTTCCTGTTG
NONO
90hsa-miR-191*36603679-17.2121
cCCCUGCUUUAGGUUCGCGUCg
| ||||||: | | |||||
tGTGACGAAGGGC-A-CGCAGt
NONO
91hsa-miR-191*52495274-14.1121
CCCCUGC--UUUAGGU--UCGCGUCg
|| ||| | ||: :|:||||
GGCCACGCCTCAGCCGGTGGTGCAGg
NONO
92hsa-miR-191*67676790-19.6121
cCCCUGCUUUAGG-UUC-GCGUCg
||||||:|: |: ||| | |||
tGGGACGGAGACTGAAGACTCAGa
NONO
93hsa-miR-191*87448764-10.4121
cCCCUGCUUUAGGUUCGCGUCg
| | :||:: :: | |||||
aGCGTTGAGGGTT-ACCGCAGa
NONO
94hsa-miR-191*30383058-13.2121
cccCUGCUUUAGGUUC-GCGUCG
| :|:||| ::| ||||||
cctGTTGGAAT--GGGACGCAGC
NONO
95hsa-miR-191*93479373-18.9121
cCCCUGCUUUAGG-----UUCGCGUCG
|||::| | || :||| |:||
aGGGGTGCACCCCGGGAAGAGCTCGGC
NONO
96hsa-miR-193a23262347-11.06121
gAC-CCUGAAACAUCCGGucaa
|| || ||| | :||||
gTGAGGTCTTCGCGGGCCctgc
NONO
97hsa-miR-193a42534270-14.2121
gACCCUGAAACAUCCGGUCaa
| |||| ||:||| ||
aTTGGAC---GTGGGCGAGat
NONO
98hsa-miR-193b885913-19.3121
UUUCGCCCU----GAAACUCC-CGGUCaa
| :|:|||| | |||| | |||:|
ACGGTGGGAGTCGCGTTGACGCGCCGGgt
NONO
99hsa-miR-193b20862111-11.6121
uuucgcccuGAAACUC--CCGGUCaa
||| |:| |||| |
catggctctCTTCGGGCAGGCCTGat
NONO
100hsa-miR-19411171138-11.5121
agguGUACCUCAACGACAAugu
||||| || |||||
ttgtCATGGTCTTCCTGTTggt
11.225NO
miR-149
Target on HGV 
Binding site 4298-4316
mfe : -11.8
Hybrid sequence
cCUCACUUCUGUGCCUCGGUCU
cGAGCG--GATGC-GAACCGGA miR-149
Target on HGV 
Binding site 6773-6805
mfe : -18.3
Hybrid sequence
CCUC--ACUUCUG---------UGCCUCGGUCU
GGAGACTGAAGACTCAGAACTGACTGAGGCCGA miR-150
Target on HGV 
Binding site 2560-2590
mfe : -15.32
Hybrid sequence
GUGA---CCA--UGU----UCCCAACCCucu
CATTCGAGGTGGACACTTCGGTGTTGGGctg miR-150
Target on HGV 
Binding site 6285-6302
mfe : -10.4
Hybrid sequence
gUGACCAUGUUCCCAACCCUCu
gAC-GGT-CA--TGTTGAGAGt miR-150
Target on HGV 
Binding site 1191-1218
mfe : -10.5
Hybrid sequence
GUGACCAUG-UUCCC-----AACCCUCU
CCCTTTGACTACGGGTTGACTTGGCAGA miR-150
Target on HGV 
Binding site 5906-5928
mfe : -14.1
Hybrid sequence
GUGACCAUGUUCCCAAC-CCUCU
CCCGGGGGCGGGCCTTGCGGGGA miR-152
Target on HGV 
Binding site 1947-1967
mfe : -12.9
Hybrid sequence
GGGUUCAAGACAGUACGUGAcu
CTCAACAACTG-CATGCTCTtg miR-152
Target on HGV 
Binding site 4847-4867
mfe : -11
Hybrid sequence
GGGUUCAAGACAGUACGU--GACU
CCCA--TTGAG-GATGCACCCTGA miR-154
Target on HGV 
Binding site 4708-4729
mfe : -18
Hybrid sequence
GCUUCCGUUGUGCCUAUUGGAu
CGGTGGAAGCTGGAGTGACCTg miR-154
Target on HGV 
Binding site 1851-1871
mfe : -12.8
Hybrid sequence
gcuUCCGUUGUGC-CUAUUGGAU
accAGG--ATCCGAGATACCCTA miR-155
Target on HGV 
Binding site 8032-8056
mfe : -13.6
Hybrid sequence
GG-GGAUAGUGC--UAAUCGUAAUu
CCACCTGCTTCGACAGTAGCATAAc miR-15a
Target on HGV 
Binding site 722-739
mfe : -10.02
Hybrid sequence
GUGUUUGGUAAUACACGACgau
CACTGACCA--A--TGCTGgcc miR-15a
Target on HGV 
Binding site 2908-2929
mfe : -14.3
Hybrid sequence
GUGUUUGGUAAUACACGACgau
CTCGGGTGGTTGAGTGCTGtgt miR-16
Target on HGV 
Binding site 5090-5113
mfe : -14.7
Hybrid sequence
gCGGUUAUAAAUGC--ACGACGau
gGCGGAGGGTTACGTCCGCTGCga miR-17-3p
Target on HGV 
Binding site 8738-8764
mfe : -12.4
Hybrid sequence
UGUUC-ACGGA------AGUGACGUCa
ACCAGCAGCGTTGAGGGTTACCGCAGa miR-17-3p
Target on HGV 
Binding site 6563-6583
mfe : -10.9
Hybrid sequence
uGUUCACGGAAG-UGACGUCA
gCAAATCCTATCGGCTGCTGT miR-17-5p
Target on HGV 
Binding site 9225-9251
mfe : -11.95
Hybrid sequence
ugauGGAC-GUGAC-AUU-CGUGAaac
aaagCCTGATGGTGCTAATGCACTgcc miR-181a
Target on HGV 
Binding site 2130-2153
mfe : -14.3
Hybrid sequence
ugAGUGGCUGU-CGCAACUUACaa
ggTCACTTGCAGGAGGTGGATGca miR-181b
Target on HGV 
Binding site 7476-7502
mfe : -13.7
Hybrid sequence
ggguGGCUGUCGU-----UACUUACAA
gtggCCGACACTACTAAGGTGTATGTT miR-182*
Target on HGV 
Binding site 2005-2027
mfe : -13.6
Hybrid sequence
aucaaCCGUUC-AGAU-CUUGGu
tcacgGGGGGGTTCTATGAACCc miR-182*
Target on HGV 
Binding site 1498-1520
mfe : -13.2
Hybrid sequence
AUCAAC-CG-UUCAGAUCUUGGU
TAGATGTGTGGAGTTTAGTGCCA miR-182*
Target on HGV 
Binding site 7411-7431
mfe : -13.8
Hybrid sequence
aUCAACCGU-UCAGAUCUUGGU
gAG-TGCCGCTGACTAGGGCCA miR-183
Target on HGV 
Binding site 1005-1039
mfe : -14.3
Hybrid sequence
gUCACUUAAG-----AUGG-------UCACGGUAu
tACTGGATTCTGGAATACCTCTGGAAGGTCCCATt miR-183
Target on HGV 
Binding site 3113-3143
mfe : -14.3
Hybrid sequence
gUCACUUAA----GAUG---GUCACG--GUAu
gAG-GACTTTGTCCTGCGGGCAGTGCGTCATg miR-183
Target on HGV 
Binding site 4379-4397
mfe : -11.3
Hybrid sequence
gUCACUUAAGAUGGUCACGGUAu
tAGGGGGGTCAA----TGCCATt miR-183
Target on HGV 
Binding site 5151-5173
mfe : -10.5
Hybrid sequence
guCACUUA--AGAUGGUCACGGUAU
ggGGGAATGATCTAC--GCGTCATA miR-184
Target on HGV 
Binding site 4783-4804
mfe : -17.5
Hybrid sequence
uGGGAAUAGUCAAG-AGGCAGgu
gCCCTTA-CACCGCAGCCGTCgc miR-185
Target on HGV 
Binding site 5698-5717
mfe : -15
Hybrid sequence
CUUGACGGAA--AGAGAGGu
GAACCGCCTTGGGCACTCCt miR-187
Target on HGV 
Binding site 3707-3731
mfe : -17.1
Hybrid sequence
GCCGACGUU---GU-GUUCUGUGCu
CGGTGGTAGGGTCACCGCGGCACGg miR-187
Target on HGV 
Binding site 8334-8359
mfe : -18.1
Hybrid sequence
GCCG-----ACGUUGUGUUCUGUGCu
CGGCCAGTGTGCGACCCAAGCGACGc miR-188
Target on HGV 
Binding site 8096-8120
mfe : -20.8
Hybrid sequence
ugGGAGG-UGGUACG--UUCCCUAC
ggCCTCTGACCATCCAGAATGGGTG miR-189
Target on HGV 
Binding site 428-450
mfe : -14.2
Hybrid sequence
ugacuauagucGAGUCAUCCGug
gtcccgcccttCCCGGTGGGCcg miR-189
Target on HGV 
Binding site 9362-9383
mfe : -13.1
Hybrid sequence
ugaCUAUAGUCGAGUCAUCCGug
gaaGAGCTCGGC-CCGAAGGCcg miR-189
Target on HGV 
Binding site 6327-6350
mfe : -17.3
Hybrid sequence
UGACUAUAGUCGAG--UCAUCCGUg
ACTGGTGAC-GTTCTGAATGGGCAa miR-189
Target on HGV 
Binding site 3695-3721
mfe : -10.9
Hybrid sequence
ugACUAUAGUCGAG----UCAUCC--GUG
tgTGCT-TCA-CTCCGGTGGTAGGGTCAC miR-18a
Target on HGV 
Binding site 3502-3520
mfe : -10.9
Hybrid sequence
auaGACGUGAUCUACGUGGAAu
ctaCTTCGTTA-A--CACCTTg miR-18a*
Target on HGV 
Binding site 478-500
mfe : -13.7
Hybrid sequence
uCUUCC--UCGUGAAUCCCGUCa
cGGCGGCCTGCAGCCGGGGTAGc miR-18a*
Target on HGV 
Binding site 8267-8283
mfe : -12.3
Hybrid sequence
uCUUCCUCGUGAAUCCCGUCa
tGAGAGAG----TGGGGCTGa miR-191
Target on HGV 
Binding site 1111-1136
mfe : -12.2
Hybrid sequence
UCGACGAA-A--ACCCUAAGG-CAAC
AACGGATTGTCATGGTCTTCCTGTTG miR-191*
Target on HGV 
Binding site 3660-3679
mfe : -17.2
Hybrid sequence
cCCCUGCUUUAGGUUCGCGUCg
tGTGACGAAGGGC-A-CGCAGt miR-191*
Target on HGV 
Binding site 5249-5274
mfe : -14.1
Hybrid sequence
CCCCUGC--UUUAGGU--UCGCGUCg
GGCCACGCCTCAGCCGGTGGTGCAGg miR-191*
Target on HGV 
Binding site 6767-6790
mfe : -19.6
Hybrid sequence
cCCCUGCUUUAGG-UUC-GCGUCg
tGGGACGGAGACTGAAGACTCAGa miR-191*
Target on HGV 
Binding site 8744-8764
mfe : -10.4
Hybrid sequence
cCCCUGCUUUAGGUUCGCGUCg
aGCGTTGAGGGTT-ACCGCAGa miR-191*
Target on HGV 
Binding site 3038-3058
mfe : -13.2
Hybrid sequence
cccCUGCUUUAGGUUC-GCGUCG
cctGTTGGAAT--GGGACGCAGC miR-191*
Target on HGV 
Binding site 9347-9373
mfe : -18.9
Hybrid sequence
cCCCUGCUUUAGG-----UUCGCGUCG
aGGGGTGCACCCCGGGAAGAGCTCGGC miR-193a
Target on HGV 
Binding site 2326-2347
mfe : -11.06
Hybrid sequence
gAC-CCUGAAACAUCCGGucaa
gTGAGGTCTTCGCGGGCCctgc miR-193a
Target on HGV 
Binding site 4253-4270
mfe : -14.2
Hybrid sequence
gACCCUGAAACAUCCGGUCaa
aTTGGAC---GTGGGCGAGat miR-193b
Target on HGV 
Binding site 885-913
mfe : -19.3
Hybrid sequence
UUUCGCCCU----GAAACUCC-CGGUCaa
ACGGTGGGAGTCGCGTTGACGCGCCGGgt miR-193b
Target on HGV 
Binding site 2086-2111
mfe : -11.6
Hybrid sequence
uuucgcccuGAAACUC--CCGGUCaa
catggctctCTTCGGGCAGGCCTGat miR-194
Target on HGV 
Binding site 1117-1138
mfe : -11.5
Hybrid sequence
agguGUACCUCAACGACAAugu
ttgtCATGGTCTTCCTGTTggt