Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HCV wildtype target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    
Subtypes1a  1b  2a  3a  4a  5a  6a  10a  11a 
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 4725 rescords (95 pages)previous   Page 2   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
51hsa-miR-14764026423-13.8121
CGUCU-UCGUAA-AGGUGUGug
| ||| :||||| | |||||
GGAGACGGCATTATGCACACtc
5.000NO
52hsa-miR-14754745494-11.3121
cgucuUCGU-AAAGGUGUGUg
|||| || ||::|||
ctctcAGCACTTACCGTACAt
5.000NO
53hsa-miR-148a60656086-14121
uguuucaagaCAUCACGUGACu
| |||||| ||
gggcgaggggGCAGTGCAATGg
NONO
54hsa-miR-148b317345-10.9121
uguuUCAAGA-CA-CU---ACGUG--ACU
|| ||| || || ||||| |||
cgggAGGTCTCGTAGACCGTGCACCATGA
NONO
55hsa-miR-14959966017-11.32121
ccucacuucuGUGCCUCGGucu
| :||||||
catcctctcgCCTGGAGCCctt
5.000NO
56hsa-miR-14931153131-15.1121
cCUCACUUCUGUGCCUCGGUCU
| | |||||: ||||:||
cGCG-GAAGAT----AGCCGGA
5.000NO
57hsa-miR-14978567875-15.6121
cCUCACUUCUGUGCCUCGGUCU
||| |||| | :| |||| ||
aGAG-GAAG-CTTGCAGCCTGA
5.000NO
58hsa-miR-15251075128-14121
gGGUUC-AAGACAGUACGUGAcu
||||| | || :|||:||
aCCAAGCCACCGT-GTGCGCTag
7.093NO
59hsa-miR-15244194443-11.1121
GGGUUCAAG-----ACAGUACGUGACu
||:|| || || ||| |||
CCTAACATCGAGGAGGT--TGCTCTGt
7.093NO
60hsa-miR-152880897-12121
GGGUUCAAGACAGUACGUGACU
||| | || || ||| ||||
CCC---TGCTCTCTTGC-CTGA
7.093NO
61hsa-miR-15439163944-14.31121
GCUUCC----GUUGUG---CCUAUUGGAU
||: || :| | | ||| ||||||
CGGTGGACTTTATCCCTGTGGAGAACCTA
5.000NO
62hsa-miR-17-3p61596181-13.72121
uGUUCACG---GAAGUGACGuca
||: || | |||||||
gCAGCCGCCCGCGTCACTGCcat
6.278NO
63hsa-miR-17-3p64186437-10.8121
UGUUCACGGAAGUGACGUCa
||| ||: |||||::|
ACACTCGCTGCCACTGTGGa
6.278NO
64hsa-miR-17-5p76577681-11.6121
ugaUGGACGUG-ACAUUCGUGAaac
| |||| | | | |||||
aaaAACTGCCCATCAACGCACTgag
8.771NO
65hsa-miR-18217001722-13.8121
ACACUCAAGAUGGU-AACGGUUu
|| ||| |: :||| ||||:|
TGAGAGGTTGGCCAGCTGCCGAc
5.000NO
66hsa-miR-182*31723196-11.2121
aucaACCGU---U-CAGAUCUUGGU
||||| | || || |||||
ttacTGGCACCTATGTGTATAACCA
5.173NO
67hsa-miR-18346904718-10.2121
GUCACU-UAAGAUG--GU---CACGGUau
| |||| | ||:| || |||:||
CTGTGATAGACTGCAACACGTGTGTCAct
5.000NO
68hsa-miR-18357105732-13.5121
gucACUUAAGAUGGUC-ACGGUAu
||: ||:|| ||| ||||:|
tgaTGGCTTTTA-CAGCTGCCGTc
5.000NO
69hsa-miR-18416841700-16.1121
UGGGAAUAGUCAAGAGGCAGGu
||:|| |||| |:||||
ACTCT--TCAGG---CTGTCCt
5.000NO
70hsa-miR-18473037322-15121
uGGGAAUAGUCA-AGAGGCAGGu
|||| | || ||||| ||
cCCCT--CCTGTGCCTCCG-CCt
5.000NO
71hsa-miR-18712271245-14.1121
gCCGACGUUGUGUUCUG-UGCu
||| || ||| :||| |||
aGGC-GC--CACTGGACGACGc
5.000NO
72hsa-miR-18837613783-22.6121
uGGG-AGGUGGUACGUUCC-CUAc
||| | |:||: ||:||| |||
tCCCGTGCGCCG-GCGAGGTGATa
5.000NO
73hsa-miR-18a60426060-14.6121
auaGACGUGAUCUACGUGGAAu
||||:| | |||| ||
ataCTGCGC-CG--GCACGTTg
NONO
74hsa-miR-18b51175143-14.3121
auugACGUGAUC-----UACGUGGAau
|||:|||| | || |||
cgtgTGCGCTAGGGCTCAAGCCCCTcc
NONO
75hsa-miR-18b64046424-12121
auUGACGUGAUCUACGUG-GAau
|| |||:| |||||| ||
agACGGCATT--ATGCACACTcg
NONO
76hsa-miR-191*47904811-16.4121
ccCCUGCUUUAGGUUCGCGUCg
|||| || | :| ||||
caGGACTCAACGCCGGGGCAGg
NONO
77hsa-miR-193b64606486-26121
UUUCGCCCUGAAACUC---CCGGUCAa
||| |||||| |||| |:|:||
AAAACGGGACGATGAGGATCGTCGGTc
NONO
78hsa-miR-196b47324750-10.4121
gGUUGUUGUCCUUUGAUGGAu
||:| | || ||||||
tCAGC--CTTGACCCTACCTt
NONO
79hsa-miR-19753745395-14.36121
CGACCCACCUCUUCCACCacuu
|||| |||| | ||||
GCTGCGTGGTCATAGTGGgcag
6.957NO
80hsa-miR-19829772997-13.32121
ggauaGAGGG--GAGACCugg
| ||| ||||||
ttgtaCACCCGACTCTGGtat
5.000NO
81hsa-miR-19822892307-10.6121
ggauaGAGGGGAGACCUgg
|| : ||||||
gaacgCTGTGATCTGGAag
5.000NO
82hsa-miR-19880768100-19.9121
GGAUAG----AGGGG--AGACCUGg
|: ||| ||||| ||||:|
CTCATCGTGTTCCCCGACCTGGGCg
5.000NO
83hsa-miR-199a*95639585-12.5121
UUGGUUACACGU-CUGAU-GACAu
|:|| || || |:||| ||||
AGCCCTAGT-CACGGCTAGCTGTg
9.369NO
84hsa-miR-200a13151337-10.3121
UGUAGCAAUGG-U-CUGUCACAAu
|| | || || | |:||| |||
AC-TGGTCCCCTACGGCAGCGTTg
6.741NO
85hsa-miR-200a*412431-13121
AGGUCGUGACAGGCCAUUCUAc
||| | :: | |||| ||||
TCCCGGGTGG--CGGTCAGATc
NONO
86hsa-miR-200a*59385960-13121
AGGUCGUG-ACAGGCCAUUCUAc
|| || | || ||||:||:|
TCAAGATCATGAGCGGTGAGGTc
NONO
87hsa-miR-200b24242446-10.82121
caGUAGUAAUGGUCCGUCAUAAu
|||::| : |: |||||| |
aaCATTGTGGACGTGCAGTACTt
5.000NO
88hsa-miR-200c75487572-12.3121
gguAGUAAUGG--GCC-GUCAUAAu
|||| ::| ||| ||||| |
gggTCATGGTCGACGGTCAGTAGTg
5.000NO
89hsa-miR-20247294751-14.9121
aAAAG--GGUAC-GGGAUAUGGAGA
|||| || || ||| |||||:|
aTTTCAGCCTTGACCC--TACCTTT
NONO
90hsa-miR-20433833409-12.7121
UCCGUAUCC-UACU----GUUUCCCuu
|| |: || |||: |||:|||
AGCCGACGGAATGGTCTCCAAGGGGtg
5.379NO
91hsa-miR-20b76587681-10.9121
gaUGGACGUGAUACU--CGUGAaac
| |||| | || | |||||
aaAACTGC-CCATCAACGCACTgag
NONO
92hsa-miR-21024202441-14.4121
aGUC-GGCGACAGUGUGCGUGUC
||| | :||| : |||::|||
cCAGAACATTGT-GGACGTGCAG
6.639NO
93hsa-miR-21285138536-16.12121
cCGGC--ACUGACCU-CUGACaau
|||| |:|| | |||||
aGCCGCAGGGCTCCAGGACTGcac
5.000NO
94hsa-miR-21392109230-14.4121
ccAUGUUAGUUGCCAGCUACCa
| |||| |:||| || |||
acTCCAAT-AGCGGCCGCTGGc
5.701NO
95hsa-miR-2149881008-10.21121
GACGG--ACAGACACGGACGaca
| ||| || | | |||||
CGGCCGATG-CCAT-CCTGCaca
8.407NO
96hsa-miR-21471837200-10.2121
gaCGGACAGACACGGACGaca
||| | | |||||
tcGCC---CGGGCCCTGCccg
8.407NO
97hsa-miR-21438433862-13.8121
GACGGACAGACAC-GGACGACa
| | |||| |||| || || |
CCG-CTGT-TGTGCCCCGCGGg
8.407NO
98hsa-miR-21782288251-17.5121
uAGGUUAGUCAAGGACUACGUCAu
||||| || || |||| :||
gTCCAAGAAGACCCCGATGGGGTt
5.000NO
99hsa-miR-21852965319-11.72121
UGUACCAAUCUA-----GUUCGUGuu
|| ||| ||:| |:|||||
ACCTGG--AGGTCGTCACGAGCACct
5.000NO
100hsa-miR-21823082329-14.2121
UGUACCAAUCUA-GUUCGUGUu
||| || ||:| |:||| ||
ACAGGGACAGGTCCGAGCTCAg
5.000NO
miR-147
Target on hcv wildtype 
Binding site 6402-6423
mfe : -13.8
Hybrid sequence
CGUCU-UCGUAA-AGGUGUGug
GGAGACGGCATTATGCACACtc miR-147
Target on hcv wildtype 
Binding site 5474-5494
mfe : -11.3
Hybrid sequence
cgucuUCGU-AAAGGUGUGUg
ctctcAGCACTTACCGTACAt miR-148a
Target on hcv wildtype 
Binding site 6065-6086
mfe : -14
Hybrid sequence
uguuucaagaCAUCACGUGACu
gggcgaggggGCAGTGCAATGg miR-148b
Target on hcv wildtype 
Binding site 317-345
mfe : -10.9
Hybrid sequence
uguuUCAAGA-CA-CU---ACGUG--ACU
cgggAGGTCTCGTAGACCGTGCACCATGA miR-149
Target on hcv wildtype 
Binding site 5996-6017
mfe : -11.32
Hybrid sequence
ccucacuucuGUGCCUCGGucu
catcctctcgCCTGGAGCCctt miR-149
Target on hcv wildtype 
Binding site 3115-3131
mfe : -15.1
Hybrid sequence
cCUCACUUCUGUGCCUCGGUCU
cGCG-GAAGAT----AGCCGGA miR-149
Target on hcv wildtype 
Binding site 7856-7875
mfe : -15.6
Hybrid sequence
cCUCACUUCUGUGCCUCGGUCU
aGAG-GAAG-CTTGCAGCCTGA miR-152
Target on hcv wildtype 
Binding site 5107-5128
mfe : -14
Hybrid sequence
gGGUUC-AAGACAGUACGUGAcu
aCCAAGCCACCGT-GTGCGCTag miR-152
Target on hcv wildtype 
Binding site 4419-4443
mfe : -11.1
Hybrid sequence
GGGUUCAAG-----ACAGUACGUGACu
CCTAACATCGAGGAGGT--TGCTCTGt miR-152
Target on hcv wildtype 
Binding site 880-897
mfe : -12
Hybrid sequence
GGGUUCAAGACAGUACGUGACU
CCC---TGCTCTCTTGC-CTGA miR-154
Target on hcv wildtype 
Binding site 3916-3944
mfe : -14.31
Hybrid sequence
GCUUCC----GUUGUG---CCUAUUGGAU
CGGTGGACTTTATCCCTGTGGAGAACCTA miR-17-3p
Target on hcv wildtype 
Binding site 6159-6181
mfe : -13.72
Hybrid sequence
uGUUCACG---GAAGUGACGuca
gCAGCCGCCCGCGTCACTGCcat miR-17-3p
Target on hcv wildtype 
Binding site 6418-6437
mfe : -10.8
Hybrid sequence
UGUUCACGGAAGUGACGUCa
ACACTCGCTGCCACTGTGGa miR-17-5p
Target on hcv wildtype 
Binding site 7657-7681
mfe : -11.6
Hybrid sequence
ugaUGGACGUG-ACAUUCGUGAaac
aaaAACTGCCCATCAACGCACTgag miR-182
Target on hcv wildtype 
Binding site 1700-1722
mfe : -13.8
Hybrid sequence
ACACUCAAGAUGGU-AACGGUUu
TGAGAGGTTGGCCAGCTGCCGAc miR-182*
Target on hcv wildtype 
Binding site 3172-3196
mfe : -11.2
Hybrid sequence
aucaACCGU---U-CAGAUCUUGGU
ttacTGGCACCTATGTGTATAACCA miR-183
Target on hcv wildtype 
Binding site 4690-4718
mfe : -10.2
Hybrid sequence
GUCACU-UAAGAUG--GU---CACGGUau
CTGTGATAGACTGCAACACGTGTGTCAct miR-183
Target on hcv wildtype 
Binding site 5710-5732
mfe : -13.5
Hybrid sequence
gucACUUAAGAUGGUC-ACGGUAu
tgaTGGCTTTTA-CAGCTGCCGTc miR-184
Target on hcv wildtype 
Binding site 1684-1700
mfe : -16.1
Hybrid sequence
UGGGAAUAGUCAAGAGGCAGGu
ACTCT--TCAGG---CTGTCCt miR-184
Target on hcv wildtype 
Binding site 7303-7322
mfe : -15
Hybrid sequence
uGGGAAUAGUCA-AGAGGCAGGu
cCCCT--CCTGTGCCTCCG-CCt miR-187
Target on hcv wildtype 
Binding site 1227-1245
mfe : -14.1
Hybrid sequence
gCCGACGUUGUGUUCUG-UGCu
aGGC-GC--CACTGGACGACGc miR-188
Target on hcv wildtype 
Binding site 3761-3783
mfe : -22.6
Hybrid sequence
uGGG-AGGUGGUACGUUCC-CUAc
tCCCGTGCGCCG-GCGAGGTGATa miR-18a
Target on hcv wildtype 
Binding site 6042-6060
mfe : -14.6
Hybrid sequence
auaGACGUGAUCUACGUGGAAu
ataCTGCGC-CG--GCACGTTg miR-18b
Target on hcv wildtype 
Binding site 5117-5143
mfe : -14.3
Hybrid sequence
auugACGUGAUC-----UACGUGGAau
cgtgTGCGCTAGGGCTCAAGCCCCTcc miR-18b
Target on hcv wildtype 
Binding site 6404-6424
mfe : -12
Hybrid sequence
auUGACGUGAUCUACGUG-GAau
agACGGCATT--ATGCACACTcg miR-191*
Target on hcv wildtype 
Binding site 4790-4811
mfe : -16.4
Hybrid sequence
ccCCUGCUUUAGGUUCGCGUCg
caGGACTCAACGCCGGGGCAGg miR-193b
Target on hcv wildtype 
Binding site 6460-6486
mfe : -26
Hybrid sequence
UUUCGCCCUGAAACUC---CCGGUCAa
AAAACGGGACGATGAGGATCGTCGGTc miR-196b
Target on hcv wildtype 
Binding site 4732-4750
mfe : -10.4
Hybrid sequence
gGUUGUUGUCCUUUGAUGGAu
tCAGC--CTTGACCCTACCTt miR-197
Target on hcv wildtype 
Binding site 5374-5395
mfe : -14.36
Hybrid sequence
CGACCCACCUCUUCCACCacuu
GCTGCGTGGTCATAGTGGgcag miR-198
Target on hcv wildtype 
Binding site 2977-2997
mfe : -13.32
Hybrid sequence
ggauaGAGGG--GAGACCugg
ttgtaCACCCGACTCTGGtat miR-198
Target on hcv wildtype 
Binding site 2289-2307
mfe : -10.6
Hybrid sequence
ggauaGAGGGGAGACCUgg
gaacgCTGTGATCTGGAag miR-198
Target on hcv wildtype 
Binding site 8076-8100
mfe : -19.9
Hybrid sequence
GGAUAG----AGGGG--AGACCUGg
CTCATCGTGTTCCCCGACCTGGGCg miR-199a*
Target on hcv wildtype 
Binding site 9563-9585
mfe : -12.5
Hybrid sequence
UUGGUUACACGU-CUGAU-GACAu
AGCCCTAGT-CACGGCTAGCTGTg miR-200a
Target on hcv wildtype 
Binding site 1315-1337
mfe : -10.3
Hybrid sequence
UGUAGCAAUGG-U-CUGUCACAAu
AC-TGGTCCCCTACGGCAGCGTTg miR-200a*
Target on hcv wildtype 
Binding site 412-431
mfe : -13
Hybrid sequence
AGGUCGUGACAGGCCAUUCUAc
TCCCGGGTGG--CGGTCAGATc miR-200a*
Target on hcv wildtype 
Binding site 5938-5960
mfe : -13
Hybrid sequence
AGGUCGUG-ACAGGCCAUUCUAc
TCAAGATCATGAGCGGTGAGGTc miR-200b
Target on hcv wildtype 
Binding site 2424-2446
mfe : -10.82
Hybrid sequence
caGUAGUAAUGGUCCGUCAUAAu
aaCATTGTGGACGTGCAGTACTt miR-200c
Target on hcv wildtype 
Binding site 7548-7572
mfe : -12.3
Hybrid sequence
gguAGUAAUGG--GCC-GUCAUAAu
gggTCATGGTCGACGGTCAGTAGTg miR-202
Target on hcv wildtype 
Binding site 4729-4751
mfe : -14.9
Hybrid sequence
aAAAG--GGUAC-GGGAUAUGGAGA
aTTTCAGCCTTGACCC--TACCTTT miR-204
Target on hcv wildtype 
Binding site 3383-3409
mfe : -12.7
Hybrid sequence
UCCGUAUCC-UACU----GUUUCCCuu
AGCCGACGGAATGGTCTCCAAGGGGtg miR-20b
Target on hcv wildtype 
Binding site 7658-7681
mfe : -10.9
Hybrid sequence
gaUGGACGUGAUACU--CGUGAaac
aaAACTGC-CCATCAACGCACTgag miR-210
Target on hcv wildtype 
Binding site 2420-2441
mfe : -14.4
Hybrid sequence
aGUC-GGCGACAGUGUGCGUGUC
cCAGAACATTGT-GGACGTGCAG miR-212
Target on hcv wildtype 
Binding site 8513-8536
mfe : -16.12
Hybrid sequence
cCGGC--ACUGACCU-CUGACaau
aGCCGCAGGGCTCCAGGACTGcac miR-213
Target on hcv wildtype 
Binding site 9210-9230
mfe : -14.4
Hybrid sequence
ccAUGUUAGUUGCCAGCUACCa
acTCCAAT-AGCGGCCGCTGGc miR-214
Target on hcv wildtype 
Binding site 988-1008
mfe : -10.21
Hybrid sequence
GACGG--ACAGACACGGACGaca
CGGCCGATG-CCAT-CCTGCaca miR-214
Target on hcv wildtype 
Binding site 7183-7200
mfe : -10.2
Hybrid sequence
gaCGGACAGACACGGACGaca
tcGCC---CGGGCCCTGCccg miR-214
Target on hcv wildtype 
Binding site 3843-3862
mfe : -13.8
Hybrid sequence
GACGGACAGACAC-GGACGACa
CCG-CTGT-TGTGCCCCGCGGg miR-217
Target on hcv wildtype 
Binding site 8228-8251
mfe : -17.5
Hybrid sequence
uAGGUUAGUCAAGGACUACGUCAu
gTCCAAGAAGACCCCGATGGGGTt miR-218
Target on hcv wildtype 
Binding site 5296-5319
mfe : -11.72
Hybrid sequence
UGUACCAAUCUA-----GUUCGUGuu
ACCTGG--AGGTCGTCACGAGCACct miR-218
Target on hcv wildtype 
Binding site 2308-2329
mfe : -14.2
Hybrid sequence
UGUACCAAUCUA-GUUCGUGUu
ACAGGGACAGGTCCGAGCTCAg