Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HDV target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
 Browse    HDV RNA genome   HDVJS   
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 707 rescords (15 pages)previous   Page 2   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
51hsa-miR-518a790808-14.76121
AGGUCGUUUCCCUUCGCgaaa
||| ||:|| ||||||
TCC--CAGAGAGAAGCGagag
NONO
52hsa-miR-5233050-10.22121
gggagaUAUCCCUUCGCGcaa
|||| |||||
gggaggATAGATCAGCGCccg
NONO
53hsa-miR-52413841405-20121
uGAGGU-UUCCCUUCGCGGAAG
||:|: :|||:||| || ||
tCTTCGCCGGGGGAGCCCCCTC
NONO
54hsa-miR-5259991020-15.9121
uCUUUCACGUA-GGGAGACCuc
|:||| |:|| :||| |||
gGGAAGAGTATATCCTATGGga
NONO
55hsa-miR-526a146164-12.3121
ucuuUCACGAAGGGAGAUCuc
|||| ||||||
cgccAGTG--AAACTCTAGga
NONO
56hsa-miR-526b15251554-11121
uugucuuucaCGA--AGG----GAGUUCUc
||| || |||:|||
tctttcttccGCTCACCCACTGCTCGAGAa
NONO
57hsa-miR-53912471269-11121
uGUGUGGUU-CCUAUUAAAGAGg
| |:||:| | |: ||||||
cCCCGCCGATAGCTGCTTTCTCt
NONO
58hsa-miR-99b9991021-13.8121
gCGUUC-CAGCCAAGAUGCCCac
| ||| || | |||:|||
gGGAAGAGTATATCCTATGGGaa
7.475NO
59hsa-miR-10011451165-12.33122
GUGUUCAAGCCUAGAUGCCCaa
||| | | | ||:||||
CAC-ACCCCCAACCTGCGGGcc
9.137NO
60hsa-miR-128a16481670-16.1122
UUUUCUCUGGCCA-AGUGACAcu
|:|:|||||:| | | ||||
AGAGGAGACTGCTGGCCCTGTcg
5.472NO
61hsa-miR-133a201222-13.3122
ugucGACCAACUUCCCCUGGuu
| | | :||||| ||
cctcCCGATCCGAGGGGCCCgg
5.000NO
62hsa-miR-133b202222-13.3122
aucGACCAACUUCCCCUGGuu
| | | :||||| ||
ctcCCGATCCGAGGGGCCCgg
NONO
63hsa-miR-149384408-21.6122
CCUCA----CUUCUGUGCCUCGGUCu
||||| |:|||| || ||| ||
GGAGTTGGGGGAGAC-CGAAGCGAGg
5.000NO
64hsa-miR-149976997-20.2122
CCUCACUUCUGUGCCUCGGUCu
||:| ||:|| : |:|:|:|
GGGGAGAGGAGGGAGGGTCGGc
5.000NO
65hsa-miR-152946962-12.1122
GGGUUCAAGACAGUACGUGACu
||| | || |:|| |||||
CCC--G--CT-TTATTCACTGg
7.093NO
66hsa-miR-18413071328-21.8122
ugGGAAUAGUCA-AGAGGCAGGu
||||:||:|| ||| |||
ctCCTTGTCGGTGAATCC-TCCc
5.000NO
67hsa-miR-18512561272-13.6122
cUUGACGGAAAGAGAggu
|:||| ||||||||
tAGCTG-CTTTCTCTtgt
6.327NO
68hsa-miR-18715931616-16.6122
GCCGACGUUG----UGUUCUGUGCU
||||| || | || ||| :|||
CGGCT-CATCTTCGACTAGAGGCGA
5.000NO
69hsa-miR-188199219-21.4122
ugGGAGGUGGUACGUUCCCuac
||||| | || |:||||
ggCCTCC-CGATCCGAGGGgcc
5.000NO
70hsa-miR-18a*370397-18.6122
UCUUCC-------UCGUGAAUCCCGUCa
||:||| || | ||:||| ||
AGGAGGGGATGCTAGGAGTTGGGGGAGa
NONO
71hsa-miR-191*350372-15.3122
cCCCUGCUUUAGGU-UCGC-GUCg
|||| | |: ||| |||| :||
aGGGA-GTAGACCATAGCGATAGg
NONO
72hsa-miR-193b637666-20.3122
UUUCGCCC-----UGAAAC-UCCCGGUCaa
| :||||| ||| || ||||:| |
ATGGCGGGACCCCACTCTGCAGGGTCCGcg
NONO
73hsa-miR-20410491071-10.7122
uccguauccuaCU-GUUUCCCuu
|| :||||||
ctccccggtccGAGTAAAGGGgg
5.379NO
74hsa-miR-20611101130-21.3122
GGUGUGUGA-AGGAAUGUAAGGU
||: :|:|| ||| |:|||||
CCGGGCGCTCCCCT--CGTTCCA
5.000NO
75hsa-miR-21110491071-12.6122
uccgcuuccuaCU-GUUUCCCuu
|| :||||||
ctccccggtccGAGTAAAGGGgg
5.593NO
76hsa-miR-211747771-16122
uccgcuuCC--UACUG-UUUCCCUu
|| |||:| || ||||
tcccctcGGTAATGGCGAATGGGAc
5.593NO
77hsa-miR-299-3p11371156-14.4122
UUCGCCAAAUGGUAGGGUGUau
|:| |||| | || ||| ||
AGGGGGTTCA-CA-CCCCCAac
NONO
78hsa-miR-32011131136-19.2122
aaGCG-GGAGAGUUGGGUCGAAaa
||| || |||: :||| |||
ggCGCTCCCCTCGTTCCACCTTcg
10.314NO
79hsa-miR-32011431172-15.62122
AAGCGGGAGAGUUG-------GGUCGAAAA
||| | | | |||| ||:||| ||
TTCACACCCCCAACCTGCGGGCCGGCTATT
10.314NO
80hsa-miR-328331357-15.5122
UGCCU-UCCCGU----CUCUCCCgguc
|| || || ||| |||||||
ACAGAGAGCGCATCGCGAGAGGGagta
NONO
81hsa-miR-3294963-10.59122
uuUCUCCAAUUGGUCCACACAa
||||| |||| ||
cgAGAGG-------GGTGAGTc
NONO
82hsa-miR-339522548-12.4122
aCUCGAGGA---CCUC-CUG--UCCCu
|| | ||| || ||| ||||
gGACCCCCTTTCAAAGTGACCGAGGGg
NONO
83hsa-miR-33913771396-15.8122
aCUCGAGGACCUCCUGUCCCu
|:|| ||| | |:|||
cGGGC-CCTCTTCGCCGGGGg
NONO
84hsa-miR-342455475-14.31122
cuGCCCACGCUAAAGACACACUCu
|| | | |: | | |||||
ccCGAGAGGGG--AC-GAGTGAGg
NONO
85hsa-miR-363*13581378-21.1122
uUUAACGUAGCACUAGGUGGGC
| || |||| ||:|||:::||
tACTTCCATC-TGGTCCGTTCG
NONO
86hsa-miR-373*211238-17.1122
cCUUUCGCGGG-----GGU--AAAACUCa
||::| |||| ||| ||| |||
cGAGGG-GCCCGGCGGCCAAGTTTGGAGg
NONO
87hsa-miR-42312331260-16.8122
GACUCCCCGGA----GUCUGGC--UCGA
|||||| |:| | :||| ||||
CTGAGGTTCTTTCCCCCCGCCGATAGCT
NONO
88hsa-miR-42410721094-12.9122
aaguuuuguacuuAACG-ACGAC
|||| |||||
actccgggactccTTGCATGCTG
NONO
89hsa-miR-43211191139-15.8122
GGUGGGUUACUGGAUGAGGUUCu
|| |:|: | || ||:|:||
CCCCTCGTT--CCACCTTCGAGg
NONO
90hsa-miR-43214921514-19.8122
GGUGGGUUACUGGAUGAG-GUUCu
|| :||:: |::|| ||| |:||
CCTTCCGGAGGTCT-CTCTCGAGt
NONO
91hsa-miR-45115981622-10.9122
uUUGAGUC--AUUACCAUUGCCAaa
| ||: | ||: || :|||||
cATCTTCGACTAGAGGCGACGGTcc
NONO
92hsa-miR-49114331451-13.2122
AGGAGUACCUUCCCAAGGGGUga
|||| | || |||:||||
TCCT--TTGA--TGTTTCCCAgc
NONO
93hsa-miR-49116001627-14.1122
AGGAGU--ACCUUC-C--CAAGGGGUga
||:||: | ||:| | | |||:||
TCTTCGACTAGAGGCGACGGTCCTCAgt
NONO
94hsa-miR-503691718-14.12122
GACGU-CU--UGAC--AAGGGCGACgau
| ||| |: | | | |:|||||
CGGCATGGTCCCAGCCTCCTCGCTGgcg
NONO
95hsa-miR-50310731094-17.4122
GACGUCUUGACAAGGGCG-ACGAu
|| |:|:|| | |::|| ||||
CTCCGGGAC--TCCTTGCATGCTg
NONO
96hsa-miR-504947967-12122
uaucucacgucUGGUCCCAGa
||::|||||
ccgctttattcACTGGGGTCg
NONO
97hsa-miR-515-3p10531075-21122
uGCGAGGUU--UUCUUCCGUGAG
|| |||:| || ::|| ||||
cCGGTCCGAGTAAAGGGGGACTC
NONO
98hsa-miR-516-3p969989-16.9122
uggGAGA---CUUUCCUUCgu
|||| ||:||||:|
caaCTCTGGGGAGAGGAGGga
NONO
99hsa-miR-518b318345-10.36122
UGGAGAUUUC------CCCUCGCGAAac
||| || || | |||||| |
ACCCCTTCAGCGAACAGAGAGCGCATcg
NONO
100hsa-miR-518c*806837-17.1122
gUC-UUUCA-CGA-AGGG-------AGGUCUCu
|| ||||| ||| |||| ||| |||
gAGAAAAGTGGCTCTCCCTTAGCCATCC-GAGt
NONO
miR-518a
Target on HDV 
Binding site 790-808
mfe : -14.76
Hybrid sequence
AGGUCGUUUCCCUUCGCgaaa
TCC--CAGAGAGAAGCGagag miR-523
Target on HDV 
Binding site 30-50
mfe : -10.22
Hybrid sequence
gggagaUAUCCCUUCGCGcaa
gggaggATAGATCAGCGCccg miR-524
Target on HDV 
Binding site 1384-1405
mfe : -20
Hybrid sequence
uGAGGU-UUCCCUUCGCGGAAG
tCTTCGCCGGGGGAGCCCCCTC miR-525
Target on HDV 
Binding site 999-1020
mfe : -15.9
Hybrid sequence
uCUUUCACGUA-GGGAGACCuc
gGGAAGAGTATATCCTATGGga miR-526a
Target on HDV 
Binding site 146-164
mfe : -12.3
Hybrid sequence
ucuuUCACGAAGGGAGAUCuc
cgccAGTG--AAACTCTAGga miR-526b
Target on HDV 
Binding site 1525-1554
mfe : -11
Hybrid sequence
uugucuuucaCGA--AGG----GAGUUCUc
tctttcttccGCTCACCCACTGCTCGAGAa miR-539
Target on HDV 
Binding site 1247-1269
mfe : -11
Hybrid sequence
uGUGUGGUU-CCUAUUAAAGAGg
cCCCGCCGATAGCTGCTTTCTCt miR-99b
Target on HDV 
Binding site 999-1021
mfe : -13.8
Hybrid sequence
gCGUUC-CAGCCAAGAUGCCCac
gGGAAGAGTATATCCTATGGGaa miR-100
Target on HDV 
Binding site 1145-1165
mfe : -12.33
Hybrid sequence
GUGUUCAAGCCUAGAUGCCCaa
CAC-ACCCCCAACCTGCGGGcc miR-128a
Target on HDV 
Binding site 1648-1670
mfe : -16.1
Hybrid sequence
UUUUCUCUGGCCA-AGUGACAcu
AGAGGAGACTGCTGGCCCTGTcg miR-133a
Target on HDV 
Binding site 201-222
mfe : -13.3
Hybrid sequence
ugucGACCAACUUCCCCUGGuu
cctcCCGATCCGAGGGGCCCgg miR-133b
Target on HDV 
Binding site 202-222
mfe : -13.3
Hybrid sequence
aucGACCAACUUCCCCUGGuu
ctcCCGATCCGAGGGGCCCgg miR-149
Target on HDV 
Binding site 384-408
mfe : -21.6
Hybrid sequence
CCUCA----CUUCUGUGCCUCGGUCu
GGAGTTGGGGGAGAC-CGAAGCGAGg miR-149
Target on HDV 
Binding site 976-997
mfe : -20.2
Hybrid sequence
CCUCACUUCUGUGCCUCGGUCu
GGGGAGAGGAGGGAGGGTCGGc miR-152
Target on HDV 
Binding site 946-962
mfe : -12.1
Hybrid sequence
GGGUUCAAGACAGUACGUGACu
CCC--G--CT-TTATTCACTGg miR-184
Target on HDV 
Binding site 1307-1328
mfe : -21.8
Hybrid sequence
ugGGAAUAGUCA-AGAGGCAGGu
ctCCTTGTCGGTGAATCC-TCCc miR-185
Target on HDV 
Binding site 1256-1272
mfe : -13.6
Hybrid sequence
cUUGACGGAAAGAGAggu
tAGCTG-CTTTCTCTtgt miR-187
Target on HDV 
Binding site 1593-1616
mfe : -16.6
Hybrid sequence
GCCGACGUUG----UGUUCUGUGCU
CGGCT-CATCTTCGACTAGAGGCGA miR-188
Target on HDV 
Binding site 199-219
mfe : -21.4
Hybrid sequence
ugGGAGGUGGUACGUUCCCuac
ggCCTCC-CGATCCGAGGGgcc miR-18a*
Target on HDV 
Binding site 370-397
mfe : -18.6
Hybrid sequence
UCUUCC-------UCGUGAAUCCCGUCa
AGGAGGGGATGCTAGGAGTTGGGGGAGa miR-191*
Target on HDV 
Binding site 350-372
mfe : -15.3
Hybrid sequence
cCCCUGCUUUAGGU-UCGC-GUCg
aGGGA-GTAGACCATAGCGATAGg miR-193b
Target on HDV 
Binding site 637-666
mfe : -20.3
Hybrid sequence
UUUCGCCC-----UGAAAC-UCCCGGUCaa
ATGGCGGGACCCCACTCTGCAGGGTCCGcg miR-204
Target on HDV 
Binding site 1049-1071
mfe : -10.7
Hybrid sequence
uccguauccuaCU-GUUUCCCuu
ctccccggtccGAGTAAAGGGgg miR-206
Target on HDV 
Binding site 1110-1130
mfe : -21.3
Hybrid sequence
GGUGUGUGA-AGGAAUGUAAGGU
CCGGGCGCTCCCCT--CGTTCCA miR-211
Target on HDV 
Binding site 1049-1071
mfe : -12.6
Hybrid sequence
uccgcuuccuaCU-GUUUCCCuu
ctccccggtccGAGTAAAGGGgg miR-211
Target on HDV 
Binding site 747-771
mfe : -16
Hybrid sequence
uccgcuuCC--UACUG-UUUCCCUu
tcccctcGGTAATGGCGAATGGGAc miR-299-3p
Target on HDV 
Binding site 1137-1156
mfe : -14.4
Hybrid sequence
UUCGCCAAAUGGUAGGGUGUau
AGGGGGTTCA-CA-CCCCCAac miR-320
Target on HDV 
Binding site 1113-1136
mfe : -19.2
Hybrid sequence
aaGCG-GGAGAGUUGGGUCGAAaa
ggCGCTCCCCTCGTTCCACCTTcg miR-320
Target on HDV 
Binding site 1143-1172
mfe : -15.62
Hybrid sequence
AAGCGGGAGAGUUG-------GGUCGAAAA
TTCACACCCCCAACCTGCGGGCCGGCTATT miR-328
Target on HDV 
Binding site 331-357
mfe : -15.5
Hybrid sequence
UGCCU-UCCCGU----CUCUCCCgguc
ACAGAGAGCGCATCGCGAGAGGGagta miR-329
Target on HDV 
Binding site 49-63
mfe : -10.59
Hybrid sequence
uuUCUCCAAUUGGUCCACACAa
cgAGAGG-------GGTGAGTc miR-339
Target on HDV 
Binding site 522-548
mfe : -12.4
Hybrid sequence
aCUCGAGGA---CCUC-CUG--UCCCu
gGACCCCCTTTCAAAGTGACCGAGGGg miR-339
Target on HDV 
Binding site 1377-1396
mfe : -15.8
Hybrid sequence
aCUCGAGGACCUCCUGUCCCu
cGGGC-CCTCTTCGCCGGGGg miR-342
Target on HDV 
Binding site 455-475
mfe : -14.31
Hybrid sequence
cuGCCCACGCUAAAGACACACUCu
ccCGAGAGGGG--AC-GAGTGAGg miR-363*
Target on HDV 
Binding site 1358-1378
mfe : -21.1
Hybrid sequence
uUUAACGUAGCACUAGGUGGGC
tACTTCCATC-TGGTCCGTTCG miR-373*
Target on HDV 
Binding site 211-238
mfe : -17.1
Hybrid sequence
cCUUUCGCGGG-----GGU--AAAACUCa
cGAGGG-GCCCGGCGGCCAAGTTTGGAGg miR-423
Target on HDV 
Binding site 1233-1260
mfe : -16.8
Hybrid sequence
GACUCCCCGGA----GUCUGGC--UCGA
CTGAGGTTCTTTCCCCCCGCCGATAGCT miR-424
Target on HDV 
Binding site 1072-1094
mfe : -12.9
Hybrid sequence
aaguuuuguacuuAACG-ACGAC
actccgggactccTTGCATGCTG miR-432
Target on HDV 
Binding site 1119-1139
mfe : -15.8
Hybrid sequence
GGUGGGUUACUGGAUGAGGUUCu
CCCCTCGTT--CCACCTTCGAGg miR-432
Target on HDV 
Binding site 1492-1514
mfe : -19.8
Hybrid sequence
GGUGGGUUACUGGAUGAG-GUUCu
CCTTCCGGAGGTCT-CTCTCGAGt miR-451
Target on HDV 
Binding site 1598-1622
mfe : -10.9
Hybrid sequence
uUUGAGUC--AUUACCAUUGCCAaa
cATCTTCGACTAGAGGCGACGGTcc miR-491
Target on HDV 
Binding site 1433-1451
mfe : -13.2
Hybrid sequence
AGGAGUACCUUCCCAAGGGGUga
TCCT--TTGA--TGTTTCCCAgc miR-491
Target on HDV 
Binding site 1600-1627
mfe : -14.1
Hybrid sequence
AGGAGU--ACCUUC-C--CAAGGGGUga
TCTTCGACTAGAGGCGACGGTCCTCAgt miR-503
Target on HDV 
Binding site 691-718
mfe : -14.12
Hybrid sequence
GACGU-CU--UGAC--AAGGGCGACgau
CGGCATGGTCCCAGCCTCCTCGCTGgcg miR-503
Target on HDV 
Binding site 1073-1094
mfe : -17.4
Hybrid sequence
GACGUCUUGACAAGGGCG-ACGAu
CTCCGGGAC--TCCTTGCATGCTg miR-504
Target on HDV 
Binding site 947-967
mfe : -12
Hybrid sequence
uaucucacgucUGGUCCCAGa
ccgctttattcACTGGGGTCg miR-515-3p
Target on HDV 
Binding site 1053-1075
mfe : -21
Hybrid sequence
uGCGAGGUU--UUCUUCCGUGAG
cCGGTCCGAGTAAAGGGGGACTC miR-516-3p
Target on HDV 
Binding site 969-989
mfe : -16.9
Hybrid sequence
uggGAGA---CUUUCCUUCgu
caaCTCTGGGGAGAGGAGGga miR-518b
Target on HDV 
Binding site 318-345
mfe : -10.36
Hybrid sequence
UGGAGAUUUC------CCCUCGCGAAac
ACCCCTTCAGCGAACAGAGAGCGCATcg miR-518c*
Target on HDV 
Binding site 806-837
mfe : -17.1
Hybrid sequence
gUC-UUUCA-CGA-AGGG-------AGGUCUCu
gAGAAAAGTGGCTCTCCCTTAGCCATCC-GAGt