Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HDV target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
 Browse    HDV RNA genome   HDVJS   
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 707 rescords (15 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7b599620-13.2121
uuGGUGUGUUGGAUGAUGGAGu
||:| ||| || || || |
ttCCGCCCAAGCTCCTTCCCCc
11.726NO
2hsa-let-7e13431364-10.8121
uGAU--AUGUUGGAGGAUGGAGu
||| | |:: | ||||:||
cCTAGGTCCGGAGT-CTACTTCc
6.037NO
3hsa-let-7f13421364-10.1121
uuGAU--AUGUUAGAUGAUGGAGu
||| | |:: | ||||:||
tcCTAGGTCCGGAGT-CTACTTCc
10.092NO
4hsa-miR-10712761305-16121
aCUAUCG---GGA--CA--UGUUACGACGa
|| :|| ||| || :::|| ||||
cGAGGGCCTTCCTTCGTCGGTGATCCTGCc
9.255NO
5hsa-miR-10a534-17.51121
guGUUUAAG-------CCUAGAUGUCCCau
|||:||| ||||: :|:|||
gcCAAGTTCCGAACAAGGATTCGCGGGGag
7.071NO
6hsa-miR-12713541375-12.6121
UCGGUUCGAGUCUGCCUAGGCu
||:| | :|| | |:||||
AGTCTACTTCCATCTGGTCCGt
5.000NO
7hsa-miR-128a638656-10.5121
uuuuCUCUGGCCAAGUGACACu
|:|||| |||| ||
tggcGGGACC---CCACTCTGc
5.472NO
8hsa-miR-128b638656-10.5121
cuuuCUCUGGCCAAGUGACACu
|:|||| |||| ||
tggcGGGACC---CCACTCTGc
5.226NO
9hsa-miR-133b13641385-12.5121
aUCGACCA-ACUUCCCCUGGuu
| ||||| | ||| ||
cATCTGGTCCGTTCGGGCCCtc
NONO
10hsa-miR-136820842-13.61121
AGGUAGUAGUUUUGUUUACCUca
||| |:| | | |:|:||||
TCCCTTAGCCATCCGAGTGGAcg
7.279NO
11hsa-miR-14010841108-14.2121
GAUGGUAU--CCCAU--UUUGGUGa
|| |||: ||| | ||:||:|
CTTGCATGCTGGGGACGAAGCCGCc
5.000NO
12hsa-miR-14114381462-10.4121
ggUAGAAAUGGUCUGUC---ACAAu
|| ||| |||| ||| ||||
tgATGTTTCCCAGCCAGGGATGTTc
5.100NO
13hsa-miR-146b12501277-10.33121
uCGGAUA-C--CUUAAG---UCAAGAGu
||| || | | ||| ||||||
cGCCGATAGCTGCTTTCTCTTGTTCTCg
NONO
14hsa-miR-1610731094-10.5121
GCGGUUAUAAAUGCACG-ACGAu
| ||:: | | | ||| ||||
CTCCGGGA-CTCCTTGCATGCTg
11.196NO
15hsa-miR-181a239265-16.8121
UGAGUGGCUG----UCGCAACUUACAa
|| | |||:| || |||||: ||
ACACTCCGGCCCGAAGGGTTGAGAGTa
9.523NO
16hsa-miR-191584606-11.62121
uCGACGA-AAACCCUAAGGCaac
| |||| | |||||||
gGATGCTCCTCCCGATTCCGccc
NONO
17hsa-miR-191711740-15.6121
uCGAC----GAAAACCC----UAAGGCaac
|||| | |||| ||||||
cGCTGGCGCCGGCTGGGCAACATTCCGagg
NONO
18hsa-miR-199b5279-13.7121
CUUGUCUAUCAG--AU---UUGUGACCc
||: :| |||| || |:||:|||
GAGGGGTGAGTCGGTAAAGAGCATTGGa
5.000NO
19hsa-miR-20215361559-20.7121
aaaaGGGU-ACGGG-AUAUGGAGA
|||| |||:| : ||||||
ctcaCCCACTGCTCGAGAACCTCT
NONO
20hsa-miR-20592107-10.8121
GUCUGAGGCCACCUUACUUCCU
|| ||||| | ||||||
CA-ACTCC-----CAAGAAGGA
5.000NO
21hsa-miR-28569594-16.3121
gaGUUAUCU--G-ACACU-CGAGGaa
||:|:|| | || || |||||
acCAGTGGAGCCATGGGATGCTCCtc
8.778NO
22hsa-miR-299-3p638654-14.22121
uuCGCCAAAUGGUAGGGUGuau
|||| || |||||
tgGCGG--GAC---CCCACtct
NONO
23hsa-miR-30d14441465-17.6121
gAAGGUCAGCCCCUACAAAUgu
| |||| | |||||||| |
tTCCCAGCCAGGGATGTTCAtc
11.306NO
24hsa-miR-30e-5p14461465-19.7121
aGGUCAGUUCCUACAAAUgu
|||| ||:||||||| |
cCCAGCCAGGGATGTTCAtc
NONO
25hsa-miR-324-5p11281146-14.8121
uGUGGUUACGGGAUCCCCUACGc
|||| ::| |||||:| |
cCACC----TTCGAGGGGGTTCa
NONO
26hsa-miR-326851868-12.3121
gaccuCCUUCCCGGGUCucc
||| ||||||
ccttcGGA--TGCCCAGgtc
NONO
27hsa-miR-328719747-23.61121
uGCCUUCCCG-UCU----CUCCC--GGuc
||| |||| | | ||||| ||
cCGGCTGGGCAACATTCCGAGGGGACCgt
NONO
28hsa-miR-328540573-21.2121
UGCCUUCCC------------GUCUCUCCCGGUC
|| ||:||| || |:|| ||||
ACCGAGGGGGGTGACTTTGAACATTGGGGACCAG
NONO
29hsa-miR-330538559-10.2121
agaGACGUCCGGCACAC-GAAACg
| | :|| | ||| |||||
tgaCCGAGGG--GGGTGACTTTGa
NONO
30hsa-miR-339152170-15121
AC-UCGAGGACCUCCUGUCCCU
|| | |||: |||| :||||
TGAAACTCT---AGGAAGGGGA
NONO
31hsa-miR-3399781002-19.3121
aCUCGAGGACCUC----CUGUCCCU
||| |||| |:| ||||
gGAGAGGAGGGAGGGTCGGCTGGGA
NONO
32hsa-miR-340331354-11.2121
ccgaUAUUUCAUUG-ACUCUGCCU
| |: | | | |||| |||
acagAGAGCGCATCGCGAGAGGGA
NONO
33hsa-miR-346623647-16.49121
UCUC--C--GUCCGUACGCCCG-UCUGu
||:| | |||| || ||| :|||
AGGGTCGCCCAGGAAT---GGCGGGACc
NONO
34hsa-miR-34a685707-11.4121
uUGUUGGUCGAUUCUGUGACGGu
|:::||:|| :| | | |||
gATGGCCGGCATGGTCCCAGCCt
7.376NO
35hsa-miR-363*810834-15.4121
UUUAAC---GUAGCACUAGGUGGGC
||| || | | | | |||:|||
AAAGTGGCTCTCCCTTAGCCATCCG
NONO
36hsa-miR-378371394-22.5121
ugUGUCCUG-GA-CCUCAGUCCUC
| :|||: || |||||::||:|
ggAGGGGATGCTAGGAGTTGGGGG
NONO
37hsa-miR-38112511275-13.62121
uGUCUCU---CGAACGGGAACAuau
| || | |||| |:|||||
gCCGATAGCTGCTTTCTCTTGTtct
NONO
38hsa-miR-3827698-12.1121
gCUUAGGUGGUGCU-UGUUGAag
|:| | | : || ||||||
tGGAACGTCGGAGATACAACTcc
NONO
39hsa-miR-409-3p11381161-22.3121
uCCCCAAGUG-GCUCGUUGUAAGC
||||||||| | |||| | ||
gGGGGTTCACACCCCCAACCTGCG
NONO
40hsa-miR-4125271-10.5121
ugCCGAUCACCUGGUCCACUUCa
|| :||| ::| ||| |||
gaGG--GGTGAGTC-GGTAAAGa
NONO
41hsa-miR-423312338-14121
GACUCCCCGG--AGUC---UGGCUCga
| |||| || |||| || |||
CAGAGGACCCCTTCAGCGAACAGAGag
NONO
42hsa-miR-42310431064-14.8121
gacuccccGGAGUCUGGCUCga
|| |:| |||||
cagtccctCCCCGGTCCGAGta
NONO
43hsa-miR-425234253-20.2121
CCGCCUGUGCUGUAAGGGCUa
|| |||||| | |||||
GGAGGACAC-TCCGGCCCGAa
NONO
44hsa-miR-432*186213-18121
UCUGUACCUCCUC------GG-UAGGuc
||| | ||||| | || ||||
AGAGAAGGAGGCGGGCCTCCCGATCCga
NONO
45hsa-miR-432*12701289-12.9121
ucuguACCUCCUCGGUAGGuc
| |||| ||| |||
tgttcTCGAGG-GCCTTCCtt
NONO
46hsa-miR-432*307327-15.4121
ucuguacCUCCUCGGUAGGUC
||||| || |:|||
acctccaGAGGACCCCTTCAG
NONO
47hsa-miR-449225250-13.4121
uGG-UCGAUUGUUAUGUGA---CGGu
|| ||:| : |: ||||| |||
gCCAAGTTTGGAGGACACTCCGGCCc
NONO
48hsa-miR-49010601082-19.92121
gUCG-UACCUCAGGAGGUCCaac
||: | ||:| ||||:||
gAGTAAAGGGGGACTCCGGGact
NONO
49hsa-miR-490208233-11.7121
gucGUACCUCAGG----AGGUCCAAc
|: ||:| || ||| |||
atcCGAGGGGCCCGGCGGCCAAGTTt
NONO
50hsa-miR-515-5p369395-17.2121
gUCUUUC---ACGAAAGAAAACCUCUU
||:|:| |||| ||||:|:|
tAGGAGGGGATGCTAGGAGTTGGGGGA
NONO
let-7b
Target on HDV 
Binding site 599-620
mfe : -13.2
Hybrid sequence
uuGGUGUGUUGGAUGAUGGAGu
ttCCGCCCAAGCTCCTTCCCCc let-7e
Target on HDV 
Binding site 1343-1364
mfe : -10.8
Hybrid sequence
uGAU--AUGUUGGAGGAUGGAGu
cCTAGGTCCGGAGT-CTACTTCc let-7f
Target on HDV 
Binding site 1342-1364
mfe : -10.1
Hybrid sequence
uuGAU--AUGUUAGAUGAUGGAGu
tcCTAGGTCCGGAGT-CTACTTCc miR-107
Target on HDV 
Binding site 1276-1305
mfe : -16
Hybrid sequence
aCUAUCG---GGA--CA--UGUUACGACGa
cGAGGGCCTTCCTTCGTCGGTGATCCTGCc miR-10a
Target on HDV 
Binding site 5-34
mfe : -17.51
Hybrid sequence
guGUUUAAG-------CCUAGAUGUCCCau
gcCAAGTTCCGAACAAGGATTCGCGGGGag miR-127
Target on HDV 
Binding site 1354-1375
mfe : -12.6
Hybrid sequence
UCGGUUCGAGUCUGCCUAGGCu
AGTCTACTTCCATCTGGTCCGt miR-128a
Target on HDV 
Binding site 638-656
mfe : -10.5
Hybrid sequence
uuuuCUCUGGCCAAGUGACACu
tggcGGGACC---CCACTCTGc miR-128b
Target on HDV 
Binding site 638-656
mfe : -10.5
Hybrid sequence
cuuuCUCUGGCCAAGUGACACu
tggcGGGACC---CCACTCTGc miR-133b
Target on HDV 
Binding site 1364-1385
mfe : -12.5
Hybrid sequence
aUCGACCA-ACUUCCCCUGGuu
cATCTGGTCCGTTCGGGCCCtc miR-136
Target on HDV 
Binding site 820-842
mfe : -13.61
Hybrid sequence
AGGUAGUAGUUUUGUUUACCUca
TCCCTTAGCCATCCGAGTGGAcg miR-140
Target on HDV 
Binding site 1084-1108
mfe : -14.2
Hybrid sequence
GAUGGUAU--CCCAU--UUUGGUGa
CTTGCATGCTGGGGACGAAGCCGCc miR-141
Target on HDV 
Binding site 1438-1462
mfe : -10.4
Hybrid sequence
ggUAGAAAUGGUCUGUC---ACAAu
tgATGTTTCCCAGCCAGGGATGTTc miR-146b
Target on HDV 
Binding site 1250-1277
mfe : -10.33
Hybrid sequence
uCGGAUA-C--CUUAAG---UCAAGAGu
cGCCGATAGCTGCTTTCTCTTGTTCTCg miR-16
Target on HDV 
Binding site 1073-1094
mfe : -10.5
Hybrid sequence
GCGGUUAUAAAUGCACG-ACGAu
CTCCGGGA-CTCCTTGCATGCTg miR-181a
Target on HDV 
Binding site 239-265
mfe : -16.8
Hybrid sequence
UGAGUGGCUG----UCGCAACUUACAa
ACACTCCGGCCCGAAGGGTTGAGAGTa miR-191
Target on HDV 
Binding site 584-606
mfe : -11.62
Hybrid sequence
uCGACGA-AAACCCUAAGGCaac
gGATGCTCCTCCCGATTCCGccc miR-191
Target on HDV 
Binding site 711-740
mfe : -15.6
Hybrid sequence
uCGAC----GAAAACCC----UAAGGCaac
cGCTGGCGCCGGCTGGGCAACATTCCGagg miR-199b
Target on HDV 
Binding site 52-79
mfe : -13.7
Hybrid sequence
CUUGUCUAUCAG--AU---UUGUGACCc
GAGGGGTGAGTCGGTAAAGAGCATTGGa miR-202
Target on HDV 
Binding site 1536-1559
mfe : -20.7
Hybrid sequence
aaaaGGGU-ACGGG-AUAUGGAGA
ctcaCCCACTGCTCGAGAACCTCT miR-205
Target on HDV 
Binding site 92-107
mfe : -10.8
Hybrid sequence
GUCUGAGGCCACCUUACUUCCU
CA-ACTCC-----CAAGAAGGA miR-28
Target on HDV 
Binding site 569-594
mfe : -16.3
Hybrid sequence
gaGUUAUCU--G-ACACU-CGAGGaa
acCAGTGGAGCCATGGGATGCTCCtc miR-299-3p
Target on HDV 
Binding site 638-654
mfe : -14.22
Hybrid sequence
uuCGCCAAAUGGUAGGGUGuau
tgGCGG--GAC---CCCACtct miR-30d
Target on HDV 
Binding site 1444-1465
mfe : -17.6
Hybrid sequence
gAAGGUCAGCCCCUACAAAUgu
tTCCCAGCCAGGGATGTTCAtc miR-30e-5p
Target on HDV 
Binding site 1446-1465
mfe : -19.7
Hybrid sequence
aGGUCAGUUCCUACAAAUgu
cCCAGCCAGGGATGTTCAtc miR-324-5p
Target on HDV 
Binding site 1128-1146
mfe : -14.8
Hybrid sequence
uGUGGUUACGGGAUCCCCUACGc
cCACC----TTCGAGGGGGTTCa miR-326
Target on HDV 
Binding site 851-868
mfe : -12.3
Hybrid sequence
gaccuCCUUCCCGGGUCucc
ccttcGGA--TGCCCAGgtc miR-328
Target on HDV 
Binding site 719-747
mfe : -23.61
Hybrid sequence
uGCCUUCCCG-UCU----CUCCC--GGuc
cCGGCTGGGCAACATTCCGAGGGGACCgt miR-328
Target on HDV 
Binding site 540-573
mfe : -21.2
Hybrid sequence
UGCCUUCCC------------GUCUCUCCCGGUC
ACCGAGGGGGGTGACTTTGAACATTGGGGACCAG miR-330
Target on HDV 
Binding site 538-559
mfe : -10.2
Hybrid sequence
agaGACGUCCGGCACAC-GAAACg
tgaCCGAGGG--GGGTGACTTTGa miR-339
Target on HDV 
Binding site 152-170
mfe : -15
Hybrid sequence
AC-UCGAGGACCUCCUGUCCCU
TGAAACTCT---AGGAAGGGGA miR-339
Target on HDV 
Binding site 978-1002
mfe : -19.3
Hybrid sequence
aCUCGAGGACCUC----CUGUCCCU
gGAGAGGAGGGAGGGTCGGCTGGGA miR-340
Target on HDV 
Binding site 331-354
mfe : -11.2
Hybrid sequence
ccgaUAUUUCAUUG-ACUCUGCCU
acagAGAGCGCATCGCGAGAGGGA miR-346
Target on HDV 
Binding site 623-647
mfe : -16.49
Hybrid sequence
UCUC--C--GUCCGUACGCCCG-UCUGu
AGGGTCGCCCAGGAAT---GGCGGGACc miR-34a
Target on HDV 
Binding site 685-707
mfe : -11.4
Hybrid sequence
uUGUUGGUCGAUUCUGUGACGGu
gATGGCCGGCATGGTCCCAGCCt miR-363*
Target on HDV 
Binding site 810-834
mfe : -15.4
Hybrid sequence
UUUAAC---GUAGCACUAGGUGGGC
AAAGTGGCTCTCCCTTAGCCATCCG miR-378
Target on HDV 
Binding site 371-394
mfe : -22.5
Hybrid sequence
ugUGUCCUG-GA-CCUCAGUCCUC
ggAGGGGATGCTAGGAGTTGGGGG miR-381
Target on HDV 
Binding site 1251-1275
mfe : -13.62
Hybrid sequence
uGUCUCU---CGAACGGGAACAuau
gCCGATAGCTGCTTTCTCTTGTtct miR-382
Target on HDV 
Binding site 76-98
mfe : -12.1
Hybrid sequence
gCUUAGGUGGUGCU-UGUUGAag
tGGAACGTCGGAGATACAACTcc miR-409-3p
Target on HDV 
Binding site 1138-1161
mfe : -22.3
Hybrid sequence
uCCCCAAGUG-GCUCGUUGUAAGC
gGGGGTTCACACCCCCAACCTGCG miR-412
Target on HDV 
Binding site 52-71
mfe : -10.5
Hybrid sequence
ugCCGAUCACCUGGUCCACUUCa
gaGG--GGTGAGTC-GGTAAAGa miR-423
Target on HDV 
Binding site 312-338
mfe : -14
Hybrid sequence
GACUCCCCGG--AGUC---UGGCUCga
CAGAGGACCCCTTCAGCGAACAGAGag miR-423
Target on HDV 
Binding site 1043-1064
mfe : -14.8
Hybrid sequence
gacuccccGGAGUCUGGCUCga
cagtccctCCCCGGTCCGAGta miR-425
Target on HDV 
Binding site 234-253
mfe : -20.2
Hybrid sequence
CCGCCUGUGCUGUAAGGGCUa
GGAGGACAC-TCCGGCCCGAa miR-432*
Target on HDV 
Binding site 186-213
mfe : -18
Hybrid sequence
UCUGUACCUCCUC------GG-UAGGuc
AGAGAAGGAGGCGGGCCTCCCGATCCga miR-432*
Target on HDV 
Binding site 1270-1289
mfe : -12.9
Hybrid sequence
ucuguACCUCCUCGGUAGGuc
tgttcTCGAGG-GCCTTCCtt miR-432*
Target on HDV 
Binding site 307-327
mfe : -15.4
Hybrid sequence
ucuguacCUCCUCGGUAGGUC
acctccaGAGGACCCCTTCAG miR-449
Target on HDV 
Binding site 225-250
mfe : -13.4
Hybrid sequence
uGG-UCGAUUGUUAUGUGA---CGGu
gCCAAGTTTGGAGGACACTCCGGCCc miR-490
Target on HDV 
Binding site 1060-1082
mfe : -19.92
Hybrid sequence
gUCG-UACCUCAGGAGGUCCaac
gAGTAAAGGGGGACTCCGGGact miR-490
Target on HDV 
Binding site 208-233
mfe : -11.7
Hybrid sequence
gucGUACCUCAGG----AGGUCCAAc
atcCGAGGGGCCCGGCGGCCAAGTTt miR-515-5p
Target on HDV 
Binding site 369-395
mfe : -17.2
Hybrid sequence
gUCUUUC---ACGAAAGAAAACCUCUU
tAGGAGGGGATGCTAGGAGTTGGGGGA