Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HEV target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
 Browse   Structural and nonstructural protein mRNA, complete cds   Complete cds   mexican strain) structural proteins and a nonstructural polyprotein genes, complete cds   nonstructural polyprotein and putative capsid protein genes, complete cds   
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 3298 rescords (66 pages)previous   Page 2   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
51hsa-miR-1665156541-14.4121
GCGGUU--AUAAAUGCACGA---CGAu
| ||:| || | |:||||| |||
CTCCGAGCTAATGATGTGCTTTGGCTt
11.196NO
52hsa-miR-1668216848-10.3121
gcGGUU----AUAAAUGC--ACGACGAu
|||| | ||: | ||| |||
gaCCAACTGCTCGTTGAGAATGCCGCTg
11.196NO
53hsa-miR-17-5p389410-14.3121
UGAUGGACGUGACAUUCGUGAaac
|:|:|| ||:: | |||||
ATTGCCGGCGT--TCCGCACTgcg
8.771NO
54hsa-miR-17-5p60816103-11.32121
uGAUGGACGUGACAUUCGUGAaac
|| || :||| ||||||
tCTCCCGTTACT-CCAGCACTgcc
8.771NO
55hsa-miR-17-5p607631-13.3121
UG-AUGGACGUGACAU-UCGUGAAac
|| |||| |||| | : |:||||
ACATACC-GCACCGCGTCGTACTTgc
8.771NO
56hsa-miR-17-5p62096234-12121
ugaUGGAC-GUGACAU-UCGUGAAac
|:| | |:| | | |||:|||
gagATCGGCCGCGGGATAGCGCTTac
8.771NO
57hsa-miR-17-5p23242350-10.09121
ugauGGACGU---GACAUUCGUGAAAc
|| ||| | | || ||||
cggcCCGGCATCGCCGCCTGCTCTTTa
8.771NO
58hsa-miR-17-5p769793-13.4121
ugauggacGUGACAUUC-GUGAAAC
||:|| | |||||||
gttagggcCATTGGCTGCCACTTTG
8.771NO
59hsa-miR-181d27932817-15.8121
UUGGGUG-GCUGUUGUUACUUACAA
|||:| | | |:||| : |:|||||
AACTCTCACTATAACTGAGGATGTT
NONO
60hsa-miR-182*45724595-15.5121
aucaACCGU---UCAGAUCUUGgu
||| | |||||:||||
tctaTGGAATACAGTCTGGAACat
5.173NO
61hsa-miR-18332313253-11.4121
gucacuuaaGAUGGUCACGGUAu
|| |::||| |||
ggcccccacCTCCTGGTGGCATg
5.000NO
62hsa-miR-18461016121-15.7121
uGGGAAUAGUCAAGAGGCAGgu
||| | | | ||:||||
gCCCGTCACCG-CCTTCGTCgc
5.000NO
63hsa-miR-18434843502-14.6121
ugGGAAU-AGUCAAGAGGCAGGu
||| | |||| :|||||
ggCCTCATTCAG----TCGTCCc
5.000NO
64hsa-miR-18467076738-17.7121
UGGG----AAU-AG--UC---AAGAGGCAGGu
|||| || || || ||||::||||
ACCCAGCAGTATTCAAAGACCTTCTTTGTCCt
5.000NO
65hsa-miR-18527842801-14.4121
CUUGACGGAAAGAGAGgu
|| ||||| |||||
GACCTGCCCAACTCTCac
6.327NO
66hsa-miR-18a14601479-11.82121
aUAGACGUGAUCUACGUGGAAu
| ||||| || ||:|| |
aACCTGCAGAAG--GCGCCGTc
NONO
67hsa-miR-18a*10491068-13.1121
UCUUCCUCGUGAAUCCCGUca
| |||| :||| |||||
ACAAGG-TTACTGTGGGCAcc
NONO
68hsa-miR-18a*14241441-11.1121
uCUUCCUCGUGAAUCCCGUCa
|||| :|| |:|| |||
tGAAGTGGC---TGGGCCAGg
NONO
69hsa-miR-18b14601479-11.62121
aUUGACGUGAUCUACGUGGAAu
| ||||| || ||:|| |
aACCTGCAGAAG--GCGCCGTc
NONO
70hsa-miR-19152195237-12.9121
uCGACGAAAACC-CUAAGGCaac
|| || || |:|||||
cGCAGC----GGCGGTTCCGgcg
NONO
71hsa-miR-19171097137-11.72121
UCGACGAAAAC-------CCUAAGGCAAC
| :||||| || |||:||||
ATTTGCTTGTGCCCCCCTTCTTTCTGTTG
NONO
72hsa-miR-191*12871314-13.6121
CCCC----UGC--UUUAGGUUCGCGUCg
|| | ||| |:| :|:|||| |
GGAGTTCTACGCTCAGTGTAGGCGCTGg
NONO
73hsa-miR-193a66366652-10.4121
GACCCUGAAACAUCCGGUCAA
| || :| | ||||| |||
CCGGCGC---GCAGGCC-GTT
NONO
74hsa-miR-196a22782297-13.7121
GGUUGUUGUACUUUGAUGGau
||::| | ||: :|||||
CCGGC-TCCTGGCGCTACCgc
NONO
75hsa-miR-196b348368-14.6121
gGUUGUUGUCCUUUGAUGGau
||:|: ::| | |||:||
tCAGCGTTGGTATACTGCCcc
NONO
76hsa-miR-19744394457-17.9121
cgacCCACCUCUUCCACCACUu
||||||| |||| ||
ttatGGTGGAG--TGTGG-GAt
6.957NO
77hsa-miR-19748604893-15.5121
CGACCCACCUCUUC------------CAC-CACUu
|| ||| | || || ||| ||||
GC-GGGCGAAGCAGCTCCGCCTCGCTGTGAGTGAt
6.957NO
78hsa-miR-199a68246850-14.5121
cUUGUCCAUCAGACU-----UGUGACCC
||| | | || ||| |:|||||
cAACTGCTCGT-TGAGAATGCCGCTGGG
10.003NO
79hsa-miR-20226262646-15.2121
aaaAGGGUACGG-GAUAUGGAGA
|||| ||| | :|||| ||
tgcTCCC--GCCTCGGTACCGCT
NONO
80hsa-miR-20547084739-16.72121
GUCUGA-GGC---CACC------UUACUUCCu
| ||:| |:| |||| : ||||||
CTGATTGCTGGCTGTGGCCTAAAGTTGAAGGt
5.000NO
81hsa-miR-20a12931315-16.92121
GAUG-GACGUGAUAUUCGUGAaau
|||| || || |:||:||:||
CTACGCT-CAGTGTAGGCGCTggc
NONO
82hsa-miR-20a60826103-10.12121
GAUGGACGUGAUAUUCGUGAaau
|| || :||| ||||||
CTCCCGTTACT-CCAGCACTgcc
NONO
83hsa-miR-20a62146234-13.2121
GAUGGACGUGAUAUUCGUGAAau
| :|| ||: || |||:|||
CGGCC-GCGGGAT-AGCGCTTac
NONO
84hsa-miR-20b60826103-10.12121
GAUGGACGUGAUACUCGUGAaac
|| || :||| ||||||
CTCCCGTTACT-CCAGCACTgcc
NONO
85hsa-miR-20b62146234-13.2121
GAUGGACGUGAUACUCGUGAAac
| :|| ||: || |||:|||
CGGCC-GCGGGAT-AGCGCTTac
NONO
86hsa-miR-20b18411867-17.9121
GAUG--GACGUGA--UACUCGUGAAAC
||:| ||| :|| | | ||:|| ||
CTGCTGCTGGGCTGGAGGTGCGCTATG
NONO
87hsa-miR-210389408-15.9121
aguCGGCGACAGUGUGCGUGuc
|||| ||: |||||
attGCCGGCGTTC--CGCACtg
6.639NO
88hsa-miR-21069666985-13.5121
agucGGCGACAGUGUGCGUGUc
|| ||| | |:||| ||
actaCC-CTG-CCCGCGCCCAt
6.639NO
89hsa-miR-21016361657-21.4121
aGU-CGG-CGACAGUGUGC-GUGUC
|| ||| |||| | || |||||
gCAGGCCGGCTGAC---CGCCACAG
6.639NO
90hsa-miR-21445074534-14.2121
GACGGACAG-------ACACGGACGaca
|||| | | || |||||
CTGCAGGCCCCGAAGGAGTCCCTGCgag
8.407NO
91hsa-miR-21422642285-10.8121
GACGGACA-GACACGGACGAca
| || || || ||| |||
CGGCGCGTGGTGAGCCGGCTcc
8.407NO
92hsa-miR-2263206346-11.3121
uGUCA--AGAAGUUG---ACCG-UCGaa
| || || |||:| |||| |||
cCCGTCGTC-TCAGCCAATGGCGAGCcg
10.264NO
93hsa-miR-2216591686-15.62121
UGUCAAGA------AGUUGACCGUCGAa
| || ||| ||:|| |||:| |
AAAGGTCTCCCAGGTCGACGGGCGGATc
10.264NO
94hsa-miR-22044464467-18.7121
uuUCACAGUCUAU-GCCACACC
||||| :|||: || ||||
ggAGTGTGGGATGCCGCAGTGG
5.000NO
95hsa-miR-22049124933-17.4121
UUUCA-C-AGUCUAUGC-CACACC
|| || | |||| |:| ||||||
AATGTAGCTCAG--ATGTGTGTGG
5.000NO
96hsa-miR-22231143137-11.4121
cucugggucaucGGUCUACAUCGa
||| ||| |||
cttgctgctgctCCACATGCAGCg
5.000NO
97hsa-miR-22426052627-13.2121
aUUUGCCUUGGU-GAUCACUGAAC
|::| | |:| | :| ||||||
gAGGCTG-CCTACCGGGAGACTTG
7.182NO
98hsa-miR-2420082036-15.7121
gaCAAGG-ACGACUU------GACUCGGu
||||| | ||||: || :|||
tgGTTCCATCCTGAGGGGCTCCTTGGCCc
11.006NO
99hsa-miR-2423792397-16.8121
GACAAGGACGACUUGACUCGGu
| | || |||| :||||:|
CGGCTC--GCTG-TTTGAGTCg
11.006NO
100hsa-miR-2538623884-10.7121
agucuggcUCUGU-UCACGUUAC
|||:| ||||| ||
gaattaacAGATATTGTGCACTG
9.003NO
miR-16
Target on HEV 
Binding site 6515-6541
mfe : -14.4
Hybrid sequence
GCGGUU--AUAAAUGCACGA---CGAu
CTCCGAGCTAATGATGTGCTTTGGCTt miR-16
Target on HEV 
Binding site 6821-6848
mfe : -10.3
Hybrid sequence
gcGGUU----AUAAAUGC--ACGACGAu
gaCCAACTGCTCGTTGAGAATGCCGCTg miR-17-5p
Target on HEV 
Binding site 389-410
mfe : -14.3
Hybrid sequence
UGAUGGACGUGACAUUCGUGAaac
ATTGCCGGCGT--TCCGCACTgcg miR-17-5p
Target on HEV 
Binding site 6081-6103
mfe : -11.32
Hybrid sequence
uGAUGGACGUGACAUUCGUGAaac
tCTCCCGTTACT-CCAGCACTgcc miR-17-5p
Target on HEV 
Binding site 607-631
mfe : -13.3
Hybrid sequence
UG-AUGGACGUGACAU-UCGUGAAac
ACATACC-GCACCGCGTCGTACTTgc miR-17-5p
Target on HEV 
Binding site 6209-6234
mfe : -12
Hybrid sequence
ugaUGGAC-GUGACAU-UCGUGAAac
gagATCGGCCGCGGGATAGCGCTTac miR-17-5p
Target on HEV 
Binding site 2324-2350
mfe : -10.09
Hybrid sequence
ugauGGACGU---GACAUUCGUGAAAc
cggcCCGGCATCGCCGCCTGCTCTTTa miR-17-5p
Target on HEV 
Binding site 769-793
mfe : -13.4
Hybrid sequence
ugauggacGUGACAUUC-GUGAAAC
gttagggcCATTGGCTGCCACTTTG miR-181d
Target on HEV 
Binding site 2793-2817
mfe : -15.8
Hybrid sequence
UUGGGUG-GCUGUUGUUACUUACAA
AACTCTCACTATAACTGAGGATGTT miR-182*
Target on HEV 
Binding site 4572-4595
mfe : -15.5
Hybrid sequence
aucaACCGU---UCAGAUCUUGgu
tctaTGGAATACAGTCTGGAACat miR-183
Target on HEV 
Binding site 3231-3253
mfe : -11.4
Hybrid sequence
gucacuuaaGAUGGUCACGGUAu
ggcccccacCTCCTGGTGGCATg miR-184
Target on HEV 
Binding site 6101-6121
mfe : -15.7
Hybrid sequence
uGGGAAUAGUCAAGAGGCAGgu
gCCCGTCACCG-CCTTCGTCgc miR-184
Target on HEV 
Binding site 3484-3502
mfe : -14.6
Hybrid sequence
ugGGAAU-AGUCAAGAGGCAGGu
ggCCTCATTCAG----TCGTCCc miR-184
Target on HEV 
Binding site 6707-6738
mfe : -17.7
Hybrid sequence
UGGG----AAU-AG--UC---AAGAGGCAGGu
ACCCAGCAGTATTCAAAGACCTTCTTTGTCCt miR-185
Target on HEV 
Binding site 2784-2801
mfe : -14.4
Hybrid sequence
CUUGACGGAAAGAGAGgu
GACCTGCCCAACTCTCac miR-18a
Target on HEV 
Binding site 1460-1479
mfe : -11.82
Hybrid sequence
aUAGACGUGAUCUACGUGGAAu
aACCTGCAGAAG--GCGCCGTc miR-18a*
Target on HEV 
Binding site 1049-1068
mfe : -13.1
Hybrid sequence
UCUUCCUCGUGAAUCCCGUca
ACAAGG-TTACTGTGGGCAcc miR-18a*
Target on HEV 
Binding site 1424-1441
mfe : -11.1
Hybrid sequence
uCUUCCUCGUGAAUCCCGUCa
tGAAGTGGC---TGGGCCAGg miR-18b
Target on HEV 
Binding site 1460-1479
mfe : -11.62
Hybrid sequence
aUUGACGUGAUCUACGUGGAAu
aACCTGCAGAAG--GCGCCGTc miR-191
Target on HEV 
Binding site 5219-5237
mfe : -12.9
Hybrid sequence
uCGACGAAAACC-CUAAGGCaac
cGCAGC----GGCGGTTCCGgcg miR-191
Target on HEV 
Binding site 7109-7137
mfe : -11.72
Hybrid sequence
UCGACGAAAAC-------CCUAAGGCAAC
ATTTGCTTGTGCCCCCCTTCTTTCTGTTG miR-191*
Target on HEV 
Binding site 1287-1314
mfe : -13.6
Hybrid sequence
CCCC----UGC--UUUAGGUUCGCGUCg
GGAGTTCTACGCTCAGTGTAGGCGCTGg miR-193a
Target on HEV 
Binding site 6636-6652
mfe : -10.4
Hybrid sequence
GACCCUGAAACAUCCGGUCAA
CCGGCGC---GCAGGCC-GTT miR-196a
Target on HEV 
Binding site 2278-2297
mfe : -13.7
Hybrid sequence
GGUUGUUGUACUUUGAUGGau
CCGGC-TCCTGGCGCTACCgc miR-196b
Target on HEV 
Binding site 348-368
mfe : -14.6
Hybrid sequence
gGUUGUUGUCCUUUGAUGGau
tCAGCGTTGGTATACTGCCcc miR-197
Target on HEV 
Binding site 4439-4457
mfe : -17.9
Hybrid sequence
cgacCCACCUCUUCCACCACUu
ttatGGTGGAG--TGTGG-GAt miR-197
Target on HEV 
Binding site 4860-4893
mfe : -15.5
Hybrid sequence
CGACCCACCUCUUC------------CAC-CACUu
GC-GGGCGAAGCAGCTCCGCCTCGCTGTGAGTGAt miR-199a
Target on HEV 
Binding site 6824-6850
mfe : -14.5
Hybrid sequence
cUUGUCCAUCAGACU-----UGUGACCC
cAACTGCTCGT-TGAGAATGCCGCTGGG miR-202
Target on HEV 
Binding site 2626-2646
mfe : -15.2
Hybrid sequence
aaaAGGGUACGG-GAUAUGGAGA
tgcTCCC--GCCTCGGTACCGCT miR-205
Target on HEV 
Binding site 4708-4739
mfe : -16.72
Hybrid sequence
GUCUGA-GGC---CACC------UUACUUCCu
CTGATTGCTGGCTGTGGCCTAAAGTTGAAGGt miR-20a
Target on HEV 
Binding site 1293-1315
mfe : -16.92
Hybrid sequence
GAUG-GACGUGAUAUUCGUGAaau
CTACGCT-CAGTGTAGGCGCTggc miR-20a
Target on HEV 
Binding site 6082-6103
mfe : -10.12
Hybrid sequence
GAUGGACGUGAUAUUCGUGAaau
CTCCCGTTACT-CCAGCACTgcc miR-20a
Target on HEV 
Binding site 6214-6234
mfe : -13.2
Hybrid sequence
GAUGGACGUGAUAUUCGUGAAau
CGGCC-GCGGGAT-AGCGCTTac miR-20b
Target on HEV 
Binding site 6082-6103
mfe : -10.12
Hybrid sequence
GAUGGACGUGAUACUCGUGAaac
CTCCCGTTACT-CCAGCACTgcc miR-20b
Target on HEV 
Binding site 6214-6234
mfe : -13.2
Hybrid sequence
GAUGGACGUGAUACUCGUGAAac
CGGCC-GCGGGAT-AGCGCTTac miR-20b
Target on HEV 
Binding site 1841-1867
mfe : -17.9
Hybrid sequence
GAUG--GACGUGA--UACUCGUGAAAC
CTGCTGCTGGGCTGGAGGTGCGCTATG miR-210
Target on HEV 
Binding site 389-408
mfe : -15.9
Hybrid sequence
aguCGGCGACAGUGUGCGUGuc
attGCCGGCGTTC--CGCACtg miR-210
Target on HEV 
Binding site 6966-6985
mfe : -13.5
Hybrid sequence
agucGGCGACAGUGUGCGUGUc
actaCC-CTG-CCCGCGCCCAt miR-210
Target on HEV 
Binding site 1636-1657
mfe : -21.4
Hybrid sequence
aGU-CGG-CGACAGUGUGC-GUGUC
gCAGGCCGGCTGAC---CGCCACAG miR-214
Target on HEV 
Binding site 4507-4534
mfe : -14.2
Hybrid sequence
GACGGACAG-------ACACGGACGaca
CTGCAGGCCCCGAAGGAGTCCCTGCgag miR-214
Target on HEV 
Binding site 2264-2285
mfe : -10.8
Hybrid sequence
GACGGACA-GACACGGACGAca
CGGCGCGTGGTGAGCCGGCTcc miR-22
Target on HEV 
Binding site 6320-6346
mfe : -11.3
Hybrid sequence
uGUCA--AGAAGUUG---ACCG-UCGaa
cCCGTCGTC-TCAGCCAATGGCGAGCcg miR-22
Target on HEV 
Binding site 1659-1686
mfe : -15.62
Hybrid sequence
UGUCAAGA------AGUUGACCGUCGAa
AAAGGTCTCCCAGGTCGACGGGCGGATc miR-220
Target on HEV 
Binding site 4446-4467
mfe : -18.7
Hybrid sequence
uuUCACAGUCUAU-GCCACACC
ggAGTGTGGGATGCCGCAGTGG miR-220
Target on HEV 
Binding site 4912-4933
mfe : -17.4
Hybrid sequence
UUUCA-C-AGUCUAUGC-CACACC
AATGTAGCTCAG--ATGTGTGTGG miR-222
Target on HEV 
Binding site 3114-3137
mfe : -11.4
Hybrid sequence
cucugggucaucGGUCUACAUCGa
cttgctgctgctCCACATGCAGCg miR-224
Target on HEV 
Binding site 2605-2627
mfe : -13.2
Hybrid sequence
aUUUGCCUUGGU-GAUCACUGAAC
gAGGCTG-CCTACCGGGAGACTTG miR-24
Target on HEV 
Binding site 2008-2036
mfe : -15.7
Hybrid sequence
gaCAAGG-ACGACUU------GACUCGGu
tgGTTCCATCCTGAGGGGCTCCTTGGCCc miR-24
Target on HEV 
Binding site 2379-2397
mfe : -16.8
Hybrid sequence
GACAAGGACGACUUGACUCGGu
CGGCTC--GCTG-TTTGAGTCg miR-25
Target on HEV 
Binding site 3862-3884
mfe : -10.7
Hybrid sequence
agucuggcUCUGU-UCACGUUAC
gaattaacAGATATTGTGCACTG