Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HAV wildtype target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 1778 rescords (36 pages)previous   Page 2   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
51hsa-miR-324-5p51485172-17.2121
uguggUUACGGG-AUCC-CCUACgc
|:|||:| | || |||||
cttggAGTGCTCGTTGGAGGATGgt
NONO
52hsa-miR-324-5p53745395-19.2121
ugUGGUUACGGGAUCCCCU-ACgc
|: ||||||:| |||| ||
ttATGAATGCCTT--GGGAGTGaa
NONO
53hsa-miR-32672467265-11.9121
gaccUCCUUCCCGGGUCUCC
|| || ||:||| ||
atttAGAAAATGCTCAGTGG
NONO
54hsa-miR-3313452-12.3121
aAGAUCCUAUCCGGGUCCCcg
||| ||| | |:||| ||
cTCTTGGA-A-GTCCATGGtg
NONO
55hsa-miR-33518621882-11121
UGUAAAAAGCAAUAACGAGAACu
|| | |||:||| |||:|| ||
AC-TGTTTTGTT-TTGTTCCTGg
NONO
56hsa-miR-337458481-12.6121
UUUCCGUAGUAUAUC--CUCGACcu
|: |||: |||| | |||:||
AGCGGCG-GATATTGGTGAGTTGtt
NONO
57hsa-miR-33736663683-11.7121
UUUCCGUAGUAUAUCCUCGACCU
|||| | || ||| |:||||
AAAG--AACA---AGGTGTTGGA
NONO
58hsa-miR-33836243644-10.4121
AGUUGUUUUAGUGACUACG-ACCU
|:|:||:| | |||| ||||
TTAGCAGATAGA---ATGCTTGGA
NONO
59hsa-miR-34069566986-15.82121
CCGAUAUUU--------CAUUGACUCUGCcu
|||| |:|| || |: ||||:|
GGCTTTGAAGATTCTCTGTTATGGAGATGat
NONO
60hsa-miR-34b46424663-10.7121
GUUAGUC-GAUUACUGUGACGGAu
|||| || :||| |||: ||||
CAATGAGATTAA--ACATGGCCTc
7.593NO
61hsa-miR-34c19051935-12.4121
CGUUAG-------UCGAUUGAU-GUGACGga
| |||| ||| |:| | :|||||
GGAATCACATTAAAGCAAGCAACTACTGCtc
6.403NO
62hsa-miR-36169546977-10.51121
caugGGGACCUCUA--AGACUAUu
|::|| |||| |||| ||
caggCTTTGAAGATTCTCTGTTAt
NONO
63hsa-miR-37154635482-12.6121
ugugAGUUUUCUACCGCCGUG
|:|| ||| ||:|| ||
tattTTAATAGA-GGTGGAAC
NONO
64hsa-miR-37710281057-12.5121
uGU-UUUCAACG---GAA---ACA-CACUa
|| :||||||| || ||| ||||
cCATGAAGTTGCAAAATTGGATGTGGTGAa
NONO
65hsa-miR-37732823307-11.7121
UGUUUUCAACGGA----AACACACUa
|::||: || ||| ||||||
ATGAAGTTTTCCTGGAGAGGTGTGAc
NONO
66hsa-miR-37827152736-14.22121
ugugucCUGGACCUCAGUCcuc
|| ||||||||
tgggtaGAGAAGGAGTCAGctt
NONO
67hsa-miR-37815501571-12.9121
uguguccuGGACCUCAGUCCUc
|:| |: ||||||
gtcttttgCTTTGGATCAGGAa
NONO
68hsa-miR-38164896512-13.32121
UGUCUCUCG--AAC-GGGAACAuau
||| ||||| ||| : |||||
ACA-AGAGCTATTGATGCTTGTcct
NONO
69hsa-miR-38219051930-13.2121
gCUUAG-GUGGU---GCUUGUUGAag
||||| ||::| | |:|||||
gGAATCACATTAAAGCAAGCAACTac
NONO
70hsa-miR-38247234747-14.1121
GCUUAGGU---GGUGCUUGUUGAAg
| |||||| ||| ||||::||
CAAATCCAAGTCCAAAAACAGTTTa
NONO
71hsa-miR-42314851507-14.3121
gACUCCCCGGAGUC----UGGCUCga
| |||| |||| ||:|||
tTTAGGG---TCAGTACTACTGAGaa
NONO
72hsa-miR-431832854-14.9121
acguACUG-CCGGACGUU-CUGu
|||: || |||||: |||
cagtTGATAGGACTGCAGTGACt
NONO
73hsa-miR-44910031023-11.8121
UGGUCGAUUGUUAUGUG-ACGgu
|:::||| || ||||| |||
ATTGGCTTAC--TACACATGCtc
NONO
74hsa-miR-45224802500-15.46121
CAGAGUCAAAGGAGACGUuugu
|||||| ||||:| ||||
GTCTCA-TTTCTTGTGCActtt
NONO
75hsa-miR-4529841005-14.2121
cAGAGUCAAAG-GAGACGUUUgu
|||: | ||| :||||||:|
tTCTT-GATTCATTCTGCAGAtt
NONO
76hsa-miR-48413391364-15.5121
uAGCCCUCCCCUG---A-CUCGGACu
|:|||| ||| | |||::||
tTTGGGAATTGACAATTAGAGTTTGg
NONO
77hsa-miR-485-3p11651189-19.8121
UCUCUCCU--CUCGGCAC-AUACug
||:|:||| || |:||| ||||
AGGGGGGATTGATCTGTGCTATGgt
NONO
78hsa-miR-48665706593-11.9121
gagccccGUC--GAGUCAUGUCCu
||| :|| ||||||
ttgaatcCAGGTTTCCATACAGGt
NONO
79hsa-miR-49169236943-10.9121
aggaguACCUUCCCAAGGGGUga
||||| | ||:|||
gatattTGGAAAG--TCTCCAgt
NONO
80hsa-miR-49265706596-13.9121
uuCUUAGAAC---AGG-GCGUCCAgga
||||| | ||| : |||||
ttGAATCCAGGTTTCCATACAGGTgtt
NONO
81hsa-miR-49270627085-11.3121
UUCUUAGAACAGGGC-GUCCAGGA
||||| |||| | :| ||| | ||
AAGAAACTTGGCATGACAGCTACT
NONO
82hsa-miR-503844864-17.6121
GACGUC-UUGACAAGGGCGACGAu
|||||| :|||| :||| ||
CTGCAGTGACTG---GTGCTTCTt
NONO
83hsa-miR-505524546-11.9121
CUCCUUUGGUCGUUCAC--AACUG
| ||| : || ::|||| |||||
GTGGATG-CATTGAGTGGATTGAC
NONO
84hsa-miR-50917221747-10.1121
AGAUGGGUGU-CUG--CAUGGUUAGu
|:| :||| | ||| ||| ||||
TTTTTCCAAATGACAAATACGAATCc
NONO
85hsa-miR-51050195041-11.3121
acACUAACG-GUGAGAGGACUCAu
|||| |: || | ||||||
aaTGATAGTGCAGT-AGCTGAGTt
NONO
86hsa-miR-512-5p42644288-10.5121
CUU-UCACGGGAGUU-CCGACUCac
||| || | :|||| |||| ||
GAACTGTTCATTCAATGGCTCAGgt
NONO
87hsa-miR-513777798-10.42121
uauuuACUGUGGAGGGACAcuu
|||| | :|||||
ggtctTGACCACATCCTGTctt
NONO
88hsa-miR-51348664886-11.6121
UAUUUACUGUGGAGGGACACuu
|| || ||:|: | |:||||
ATCAAAGATATGT-CTTGTGtt
NONO
89hsa-miR-51356585677-12.6121
uAUUUACUGUGGAGGGACACuu
||||||: || |||| ||
gTAAATGGAAC--CCCTATGtt
NONO
90hsa-miR-51368176842-14.2121
UAUU---UACUGUGG-AGGGACACuu
|||| || :||| | :|||||
ATAACTGTTGTTACCATGTCTGTGgt
NONO
91hsa-miR-516-5p45134536-10.9121
uuucacgaaGA-AUGGAGGUCUAc
|| |: ||:|||||
atactaaacCTGTGGCTTCAGATt
NONO
92hsa-miR-516-5p65896618-10.6121
uUUCACGAAGA-------AUGGAGGUCUAc
|:|||:| || || ||| |||
cAGGTGTTGCTATTGGCATAGATCCTGATa
NONO
93hsa-miR-517*35333555-13.4121
UCUGUCACGAAGGU--AGAUCUCC
||| | |||| ||| |||| |||
AGAAATTGCTGCCAATTCTA-AGG
NONO
94hsa-miR-517c51435162-14.7121
uGUGAGAUUUUCCUACGUGCua
||:||| ::|| ||| ||
gCATTCTTGGAG--TGCTCGtt
NONO
95hsa-miR-518c12961313-11121
gUGAGAUUUCUCUUCGCGAAac
|| | ||||| |:||||
tACAC--AAGAG--GTGCTTac
NONO
96hsa-miR-518c*46234649-15.1121
GUCUUUCACGAAG----GGAGGU--CUCU
||| |||| || : |||| ||||
CAGTTAGTG--TCAGGATGTCCAATGAGA
NONO
97hsa-miR-518c*52505284-12.39121
gUCUUUCACGAA--------GGG---AGGUC-UCU
|| ||||| || : | ||||| |||
aAGCAAGTGATTAAATTAGATGCAGATCCAGTAGA
NONO
98hsa-miR-518f12911312-11.2121
AGGAGAU-UUCUCUUCGCGAAa
|: |:|| | |||:|:||||
TTATTTACACAAGAGGTGCTTa
NONO
99hsa-miR-518f44204448-10.4121
aggaGAUUUCUC--------UUCGCGAAa
| |||||| ||| ||||
atggCAAAAGAGGGGGAGGAAAGAGCTTa
NONO
100hsa-miR-518f*68316858-14.5121
ucucuuuCACGAA-----GGGAGAUCuc
||| || ||||||:|
catgtctGTGGTTCAATGCCCTCTGGgt
NONO
miR-324-5p
Target on HAV 
Binding site 5148-5172
mfe : -17.2
Hybrid sequence
uguggUUACGGG-AUCC-CCUACgc
cttggAGTGCTCGTTGGAGGATGgt miR-324-5p
Target on HAV 
Binding site 5374-5395
mfe : -19.2
Hybrid sequence
ugUGGUUACGGGAUCCCCU-ACgc
ttATGAATGCCTT--GGGAGTGaa miR-326
Target on HAV 
Binding site 7246-7265
mfe : -11.9
Hybrid sequence
gaccUCCUUCCCGGGUCUCC
atttAGAAAATGCTCAGTGG miR-331
Target on HAV 
Binding site 34-52
mfe : -12.3
Hybrid sequence
aAGAUCCUAUCCGGGUCCCcg
cTCTTGGA-A-GTCCATGGtg miR-335
Target on HAV 
Binding site 1862-1882
mfe : -11
Hybrid sequence
UGUAAAAAGCAAUAACGAGAACu
AC-TGTTTTGTT-TTGTTCCTGg miR-337
Target on HAV 
Binding site 458-481
mfe : -12.6
Hybrid sequence
UUUCCGUAGUAUAUC--CUCGACcu
AGCGGCG-GATATTGGTGAGTTGtt miR-337
Target on HAV 
Binding site 3666-3683
mfe : -11.7
Hybrid sequence
UUUCCGUAGUAUAUCCUCGACCU
AAAG--AACA---AGGTGTTGGA miR-338
Target on HAV 
Binding site 3624-3644
mfe : -10.4
Hybrid sequence
AGUUGUUUUAGUGACUACG-ACCU
TTAGCAGATAGA---ATGCTTGGA miR-340
Target on HAV 
Binding site 6956-6986
mfe : -15.82
Hybrid sequence
CCGAUAUUU--------CAUUGACUCUGCcu
GGCTTTGAAGATTCTCTGTTATGGAGATGat miR-34b
Target on HAV 
Binding site 4642-4663
mfe : -10.7
Hybrid sequence
GUUAGUC-GAUUACUGUGACGGAu
CAATGAGATTAA--ACATGGCCTc miR-34c
Target on HAV 
Binding site 1905-1935
mfe : -12.4
Hybrid sequence
CGUUAG-------UCGAUUGAU-GUGACGga
GGAATCACATTAAAGCAAGCAACTACTGCtc miR-361
Target on HAV 
Binding site 6954-6977
mfe : -10.51
Hybrid sequence
caugGGGACCUCUA--AGACUAUu
caggCTTTGAAGATTCTCTGTTAt miR-371
Target on HAV 
Binding site 5463-5482
mfe : -12.6
Hybrid sequence
ugugAGUUUUCUACCGCCGUG
tattTTAATAGA-GGTGGAAC miR-377
Target on HAV 
Binding site 1028-1057
mfe : -12.5
Hybrid sequence
uGU-UUUCAACG---GAA---ACA-CACUa
cCATGAAGTTGCAAAATTGGATGTGGTGAa miR-377
Target on HAV 
Binding site 3282-3307
mfe : -11.7
Hybrid sequence
UGUUUUCAACGGA----AACACACUa
ATGAAGTTTTCCTGGAGAGGTGTGAc miR-378
Target on HAV 
Binding site 2715-2736
mfe : -14.22
Hybrid sequence
ugugucCUGGACCUCAGUCcuc
tgggtaGAGAAGGAGTCAGctt miR-378
Target on HAV 
Binding site 1550-1571
mfe : -12.9
Hybrid sequence
uguguccuGGACCUCAGUCCUc
gtcttttgCTTTGGATCAGGAa miR-381
Target on HAV 
Binding site 6489-6512
mfe : -13.32
Hybrid sequence
UGUCUCUCG--AAC-GGGAACAuau
ACA-AGAGCTATTGATGCTTGTcct miR-382
Target on HAV 
Binding site 1905-1930
mfe : -13.2
Hybrid sequence
gCUUAG-GUGGU---GCUUGUUGAag
gGAATCACATTAAAGCAAGCAACTac miR-382
Target on HAV 
Binding site 4723-4747
mfe : -14.1
Hybrid sequence
GCUUAGGU---GGUGCUUGUUGAAg
CAAATCCAAGTCCAAAAACAGTTTa miR-423
Target on HAV 
Binding site 1485-1507
mfe : -14.3
Hybrid sequence
gACUCCCCGGAGUC----UGGCUCga
tTTAGGG---TCAGTACTACTGAGaa miR-431
Target on HAV 
Binding site 832-854
mfe : -14.9
Hybrid sequence
acguACUG-CCGGACGUU-CUGu
cagtTGATAGGACTGCAGTGACt miR-449
Target on HAV 
Binding site 1003-1023
mfe : -11.8
Hybrid sequence
UGGUCGAUUGUUAUGUG-ACGgu
ATTGGCTTAC--TACACATGCtc miR-452
Target on HAV 
Binding site 2480-2500
mfe : -15.46
Hybrid sequence
CAGAGUCAAAGGAGACGUuugu
GTCTCA-TTTCTTGTGCActtt miR-452
Target on HAV 
Binding site 984-1005
mfe : -14.2
Hybrid sequence
cAGAGUCAAAG-GAGACGUUUgu
tTCTT-GATTCATTCTGCAGAtt miR-484
Target on HAV 
Binding site 1339-1364
mfe : -15.5
Hybrid sequence
uAGCCCUCCCCUG---A-CUCGGACu
tTTGGGAATTGACAATTAGAGTTTGg miR-485-3p
Target on HAV 
Binding site 1165-1189
mfe : -19.8
Hybrid sequence
UCUCUCCU--CUCGGCAC-AUACug
AGGGGGGATTGATCTGTGCTATGgt miR-486
Target on HAV 
Binding site 6570-6593
mfe : -11.9
Hybrid sequence
gagccccGUC--GAGUCAUGUCCu
ttgaatcCAGGTTTCCATACAGGt miR-491
Target on HAV 
Binding site 6923-6943
mfe : -10.9
Hybrid sequence
aggaguACCUUCCCAAGGGGUga
gatattTGGAAAG--TCTCCAgt miR-492
Target on HAV 
Binding site 6570-6596
mfe : -13.9
Hybrid sequence
uuCUUAGAAC---AGG-GCGUCCAgga
ttGAATCCAGGTTTCCATACAGGTgtt miR-492
Target on HAV 
Binding site 7062-7085
mfe : -11.3
Hybrid sequence
UUCUUAGAACAGGGC-GUCCAGGA
AAGAAACTTGGCATGACAGCTACT miR-503
Target on HAV 
Binding site 844-864
mfe : -17.6
Hybrid sequence
GACGUC-UUGACAAGGGCGACGAu
CTGCAGTGACTG---GTGCTTCTt miR-505
Target on HAV 
Binding site 524-546
mfe : -11.9
Hybrid sequence
CUCCUUUGGUCGUUCAC--AACUG
GTGGATG-CATTGAGTGGATTGAC miR-509
Target on HAV 
Binding site 1722-1747
mfe : -10.1
Hybrid sequence
AGAUGGGUGU-CUG--CAUGGUUAGu
TTTTTCCAAATGACAAATACGAATCc miR-510
Target on HAV 
Binding site 5019-5041
mfe : -11.3
Hybrid sequence
acACUAACG-GUGAGAGGACUCAu
aaTGATAGTGCAGT-AGCTGAGTt miR-512-5p
Target on HAV 
Binding site 4264-4288
mfe : -10.5
Hybrid sequence
CUU-UCACGGGAGUU-CCGACUCac
GAACTGTTCATTCAATGGCTCAGgt miR-513
Target on HAV 
Binding site 777-798
mfe : -10.42
Hybrid sequence
uauuuACUGUGGAGGGACAcuu
ggtctTGACCACATCCTGTctt miR-513
Target on HAV 
Binding site 4866-4886
mfe : -11.6
Hybrid sequence
UAUUUACUGUGGAGGGACACuu
ATCAAAGATATGT-CTTGTGtt miR-513
Target on HAV 
Binding site 5658-5677
mfe : -12.6
Hybrid sequence
uAUUUACUGUGGAGGGACACuu
gTAAATGGAAC--CCCTATGtt miR-513
Target on HAV 
Binding site 6817-6842
mfe : -14.2
Hybrid sequence
UAUU---UACUGUGG-AGGGACACuu
ATAACTGTTGTTACCATGTCTGTGgt miR-516-5p
Target on HAV 
Binding site 4513-4536
mfe : -10.9
Hybrid sequence
uuucacgaaGA-AUGGAGGUCUAc
atactaaacCTGTGGCTTCAGATt miR-516-5p
Target on HAV 
Binding site 6589-6618
mfe : -10.6
Hybrid sequence
uUUCACGAAGA-------AUGGAGGUCUAc
cAGGTGTTGCTATTGGCATAGATCCTGATa miR-517*
Target on HAV 
Binding site 3533-3555
mfe : -13.4
Hybrid sequence
UCUGUCACGAAGGU--AGAUCUCC
AGAAATTGCTGCCAATTCTA-AGG miR-517c
Target on HAV 
Binding site 5143-5162
mfe : -14.7
Hybrid sequence
uGUGAGAUUUUCCUACGUGCua
gCATTCTTGGAG--TGCTCGtt miR-518c
Target on HAV 
Binding site 1296-1313
mfe : -11
Hybrid sequence
gUGAGAUUUCUCUUCGCGAAac
tACAC--AAGAG--GTGCTTac miR-518c*
Target on HAV 
Binding site 4623-4649
mfe : -15.1
Hybrid sequence
GUCUUUCACGAAG----GGAGGU--CUCU
CAGTTAGTG--TCAGGATGTCCAATGAGA miR-518c*
Target on HAV 
Binding site 5250-5284
mfe : -12.39
Hybrid sequence
gUCUUUCACGAA--------GGG---AGGUC-UCU
aAGCAAGTGATTAAATTAGATGCAGATCCAGTAGA miR-518f
Target on HAV 
Binding site 1291-1312
mfe : -11.2
Hybrid sequence
AGGAGAU-UUCUCUUCGCGAAa
TTATTTACACAAGAGGTGCTTa miR-518f
Target on HAV 
Binding site 4420-4448
mfe : -10.4
Hybrid sequence
aggaGAUUUCUC--------UUCGCGAAa
atggCAAAAGAGGGGGAGGAAAGAGCTTa miR-518f*
Target on HAV 
Binding site 6831-6858
mfe : -14.5
Hybrid sequence
ucucuuuCACGAA-----GGGAGAUCuc
catgtctGTGGTTCAATGCCCTCTGGgt