Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HAV wildtype target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 1778 rescords (36 pages)Page 1   next
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-miR-931473167-11.6121
AGUAUGUCGAUCUAUUGGUUUCU
|:| | ||:|:|: || ||||||
TTAGA-AGTTGGG-AAACAAAGA
5.114NO
2hsa-let-7a16101631-11.7121
UUGAUAUGUUGGAUGAUGGAgu
||:|| || ::||||||:|
AATTACTCATTTTACTACTTgg
11.678NO
3hsa-let-7g70897109-16.8121
uGACAUGUUUGAUGAUGGAGU-
||| ||||: |||||||
gCTG-ACAAGAATGTACCTCAG
9.988NO
4hsa-miR-10765786599-14.8121
aCUAUCGGGACAUGU-UACGACGA
|:| || |||| :||:||||
aGGTTTCC--ATACAGGTGTTGCT
9.255NO
5hsa-miR-10a49825004-17.2121
GUGUUUAAGC-CUAGAUGUCCCau
||:::| |:| |:|| |||||
CATGGAGTTGTGGTC-TCAGGGaa
7.071NO
6hsa-miR-132489515-10.42121
gcUGGUA-----CCGACAUCUGACaau
||||| | | | :|||||
aaACCATTCAACGCCGGAGGACTGact
5.000NO
7hsa-miR-133a259281-13121
uGUCGAC-CAACUUCCCCUGGUU
| |:|| | :: |||::|||
gCCGTTGCGCCCGGCGGGGTCAA
5.000NO
8hsa-miR-13439353953-11.12121
gggaGACCAGUUGGUCAGugu
|||| || |||||
aatgCTGG--AAACAGTCttt
5.000NO
9hsa-miR-13471037124-16.2121
gGGAGACCA-GUUGGUCAGUGu
|||| | | |||||||: |
aCCTCAGCTGAAACCAGTTTCg
5.000NO
10hsa-miR-14437443764-10.2121
gAUCAUGUAGUAGAUAUGACAu
| | |: ||||| || ||||
tTTGGATTTCATC-ATTCTGTg
5.143NO
11hsa-miR-14515591579-17.4121
uucCCUAAGGACCCUUUUGACCUg
|||| | ||||:|:||||
tttGGAT--C-AGGAAGATTGGAa
11.062NO
12hsa-miR-15038603877-11.1121
gUGACCAUGUUCCCAACCCUCu
|:|||| : |||| |||
aATTGGTTT----GTTGAGAGt
7.336NO
13hsa-miR-15010791100-21.2121
guGACCAUGUUCCCAAC-CCUCU
|| || ||||||||| ||||
tgCT-GTTCAAGGGTTGTTGAGA
7.336NO
14hsa-miR-15a58555871-10.3121
guguUUGGUAAUACACGACGAu
| ||| ||:||||
gggcATCCA-----TGTTGCTg
9.991NO
15hsa-miR-181a515541-16.3121
uGAGU-GG---CUGUCGCAACUUACaa
|||| || |: || ||||:||
tCTCATCCAGTGGATGCATTGAGTGga
9.523NO
16hsa-miR-181b41674191-15.7121
gGGUGGCU--GUC-GUUACUUACAA
|||::|| || |:|||||| ||
gCCATTGAGGAAGCCGATGAATTTT
6.484NO
17hsa-miR-181c70837103-12.2121
UGA--GUGGCUGUCCAACUUACAa
||| ::|:|||| ||||||
ACTTCTGCTGACAA---GAATGTa
8.945NO
18hsa-miR-18220492066-16.92121
aCACUCAAGAUGGUAACGGUuu
|||||| | || |||||
gGTGAGTAC-AC---TGCCAtt
5.000NO
19hsa-miR-18365116537-10.6121
gucACUUAA-GAUGGU----CACGGuau
||:||| || | | |||||
ctcTGGATTACT-CAATTTTGTGCCgaa
5.000NO
20hsa-miR-18748584878-14121
gcCGACGUUGUGUUCUGUGCu
| |||||: ||||:|:|
atGATGCAATCAAAGATATGt
5.000NO
21hsa-miR-188421441-11.3121
ugggaGGUGGUACGUUCCCUAC
|: |:||| ||| ||||
taataCTTCTATG-AAGAGATG
5.000NO
22hsa-miR-18a841865-17.1121
auaGACGUGAU---CUACGUGGAAU
||||| |: |:||| :||||
ggaCTGCAGTGACTGGTGCTTCTTA
NONO
23hsa-miR-18a*19431968-11.11121
UC-UU-CC--UCGUG-AAUCCCGUCA
|| || || | :|| || |||||
AGTAATGGATATTACAGGAGTGCAGT
NONO
24hsa-miR-191730-17.4121
UCGACGAAAACCCU--AAGGCaac
|| |: | |||| |||||
AGGGGTCTCCGGGAATTTCCGgag
NONO
25hsa-miR-19119661987-10.7121
ucgacgaAAACCCUAAGGCAac
|||| ||||:|||
agtcaacTTTGAGATTTCGTgt
NONO
26hsa-miR-191*36793701-12.4121
ccCCUGCUU-UAGGUUCGCGUCg
|||: || | | :||:|:||
ttGGATTAATAGCAGAGTGTAGa
NONO
27hsa-miR-19242654286-16121
ccGACAGUUAAG-UAUCCAGUC
||||: |||| ||:| ||||
aaCTGTTCATTCAATGGCTCAG
11.589NO
28hsa-miR-19410631088-14.6121
AGGUGUACCUC----AACGACAAugu
| :||| ||| ||||||||
TATACAATGAGCAGTTTGCTGTTcaa
11.225NO
29hsa-miR-196a23792403-14.7121
GGUU---GUUG-UACUUUGAUGGAu
|||: :|:| | |||| |||||
CCAGTTTTAGCAAAGAAAGTACCTg
NONO
30hsa-miR-196b23792403-14.9121
GGUU---GUUG-UCCUUUGAUGGAu
|||: :|:| | |||| |||||
CCAGTTTTAGCAAAGAAAGTACCTg
NONO
31hsa-miR-19773217342-12.7121
cGACCCACCUCUUCCACCACUu
||| ||||||| | | |||
cCTGTTTGGAGAAAGAGATGAt
6.957NO
32hsa-miR-199a72157235-13.7121
cuuGUC-CAUCAGACUUGUGACcc
||| | ||| |||:|||
tggCAGAGAAGT---AACGCTGag
10.003NO
33hsa-miR-200a*15861607-13.4121
AGGUCGUGACAGGCCAUUCUAc
|||: | | | :|||::|||
TCCGTCCCAGGGTGGTGGGATc
NONO
34hsa-miR-21426862704-11121
GACGGACAGACACGGACGACA
|| || || || |:||| ||
CT-CCAGTAGGT-CTTGCCGT
8.407NO
35hsa-miR-21625682594-14.2121
GUGUC-AACGGU-----CGACUCUAau
||::| |||||| |||||:|
CATGGTTTGCCATCAACACTGAGGTgg
5.000NO
36hsa-miR-21661966214-12.1121
GUGUCAACGGUCGACU-CUAAu
| ||||| ||:||| ||||
CTCAGTT---AGTTGATGATTt
5.000NO
37hsa-miR-22432903310-12.3121
auuugCCUUGGUGAUCACUGAac
|||: | ||||||
ttcctGGAG--AGGTGTGACTgc
7.182NO
38hsa-miR-2468366860-13.8121
GACA--AGG--ACGACUUGACUCGGu
|||| |:| ||| |||:|:|
CTGTGGTTCAATGC-CCTCTGGGTCt
11.006NO
39hsa-miR-2571657184-10.1121
agUCUGGCUCUGUUCACGUUAc
||| : |||| ||||||
atAGAATTAGACC--TGCAATt
9.003NO
40hsa-miR-27a37453766-10.4121
cgCCUUGAAUCG-GUGACACUu
||| :| | | : ||||||
ttGGATTTCATCATTCTGTGAc
10.858NO
41hsa-miR-299-5p388413-13.4121
uacauaCACCC--UG-CCA-UUUGGu
|| || || ||| |||||
caagggGTAGGCTACGGGTGAAACCt
NONO
42hsa-miR-29a15851605-15.72121
UUGGCUAAAGU-CUACCACgau
| ||| | || |:|||||
ATCCG-TCCCAGGGTGGTGgga
11.686NO
43hsa-miR-29b11881215-11.6121
uuguGACUAAAGUU-----UACCACGAU
|||:| | | ||||| |||
gttcCTGGTGACCAGAGCTATGGTTCTA
11.394NO
44hsa-miR-302a53045330-14.8121
agUGGUUUUG--UA--CCUUCGUGAAu
| ||::|| :| ||||| ||||
atAGCAGGACTGGTTAGGAAGAACTTg
NONO
45hsa-miR-302b70657087-10.9121
gaUGAUUUUGUACCUUCG-UGAAu
||| ::|||| ||| ||||
aaACT-TGGCATGACAGCTACTTc
NONO
46hsa-miR-302c30193043-14.86121
GGUGACUUUGUACCU--UCGUgaau
|||||||| || || ||||
CCACTGAATCAATGATGAGCAgaat
NONO
47hsa-miR-302c53105330-15.4121
ggUGACUUUGUACCUUCGUGAAu
|||| : :| ||||| ||||
ggACTG-GTTA-GGAAGAACTTg
NONO
48hsa-miR-302c67646783-10.1121
GGUGACUUUGUACCUUCGUGAAU
|||:| ::|| ||| ||||
CCATTTTGGCA---CAGCTCTTA
NONO
49hsa-miR-324-3p33453361-10.5121
gguCGUCGUGGACCCCGUCacc
|| ||| |||||
ttgGCCGCA-----GGCAGaag
NONO
50hsa-miR-324-3p687709-14.76121
gGUCGUCGUG-GACCCCGUCAcc
| | :|:|| | |||||| |
tCTGAGGTACTCAGGGGCATTta
NONO
miR-9
Target on HAV 
Binding site 3147-3167
mfe : -11.6
Hybrid sequence
AGUAUGUCGAUCUAUUGGUUUCU
TTAGA-AGTTGGG-AAACAAAGA let-7a
Target on HAV 
Binding site 1610-1631
mfe : -11.7
Hybrid sequence
UUGAUAUGUUGGAUGAUGGAgu
AATTACTCATTTTACTACTTgg let-7g
Target on HAV 
Binding site 7089-7109
mfe : -16.8
Hybrid sequence
uGACAUGUUUGAUGAUGGAGU-
gCTG-ACAAGAATGTACCTCAG miR-107
Target on HAV 
Binding site 6578-6599
mfe : -14.8
Hybrid sequence
aCUAUCGGGACAUGU-UACGACGA
aGGTTTCC--ATACAGGTGTTGCT miR-10a
Target on HAV 
Binding site 4982-5004
mfe : -17.2
Hybrid sequence
GUGUUUAAGC-CUAGAUGUCCCau
CATGGAGTTGTGGTC-TCAGGGaa miR-132
Target on HAV 
Binding site 489-515
mfe : -10.42
Hybrid sequence
gcUGGUA-----CCGACAUCUGACaau
aaACCATTCAACGCCGGAGGACTGact miR-133a
Target on HAV 
Binding site 259-281
mfe : -13
Hybrid sequence
uGUCGAC-CAACUUCCCCUGGUU
gCCGTTGCGCCCGGCGGGGTCAA miR-134
Target on HAV 
Binding site 3935-3953
mfe : -11.12
Hybrid sequence
gggaGACCAGUUGGUCAGugu
aatgCTGG--AAACAGTCttt miR-134
Target on HAV 
Binding site 7103-7124
mfe : -16.2
Hybrid sequence
gGGAGACCA-GUUGGUCAGUGu
aCCTCAGCTGAAACCAGTTTCg miR-144
Target on HAV 
Binding site 3744-3764
mfe : -10.2
Hybrid sequence
gAUCAUGUAGUAGAUAUGACAu
tTTGGATTTCATC-ATTCTGTg miR-145
Target on HAV 
Binding site 1559-1579
mfe : -17.4
Hybrid sequence
uucCCUAAGGACCCUUUUGACCUg
tttGGAT--C-AGGAAGATTGGAa miR-150
Target on HAV 
Binding site 3860-3877
mfe : -11.1
Hybrid sequence
gUGACCAUGUUCCCAACCCUCu
aATTGGTTT----GTTGAGAGt miR-150
Target on HAV 
Binding site 1079-1100
mfe : -21.2
Hybrid sequence
guGACCAUGUUCCCAAC-CCUCU
tgCT-GTTCAAGGGTTGTTGAGA miR-15a
Target on HAV 
Binding site 5855-5871
mfe : -10.3
Hybrid sequence
guguUUGGUAAUACACGACGAu
gggcATCCA-----TGTTGCTg miR-181a
Target on HAV 
Binding site 515-541
mfe : -16.3
Hybrid sequence
uGAGU-GG---CUGUCGCAACUUACaa
tCTCATCCAGTGGATGCATTGAGTGga miR-181b
Target on HAV 
Binding site 4167-4191
mfe : -15.7
Hybrid sequence
gGGUGGCU--GUC-GUUACUUACAA
gCCATTGAGGAAGCCGATGAATTTT miR-181c
Target on HAV 
Binding site 7083-7103
mfe : -12.2
Hybrid sequence
UGA--GUGGCUGUCCAACUUACAa
ACTTCTGCTGACAA---GAATGTa miR-182
Target on HAV 
Binding site 2049-2066
mfe : -16.92
Hybrid sequence
aCACUCAAGAUGGUAACGGUuu
gGTGAGTAC-AC---TGCCAtt miR-183
Target on HAV 
Binding site 6511-6537
mfe : -10.6
Hybrid sequence
gucACUUAA-GAUGGU----CACGGuau
ctcTGGATTACT-CAATTTTGTGCCgaa miR-187
Target on HAV 
Binding site 4858-4878
mfe : -14
Hybrid sequence
gcCGACGUUGUGUUCUGUGCu
atGATGCAATCAAAGATATGt miR-188
Target on HAV 
Binding site 421-441
mfe : -11.3
Hybrid sequence
ugggaGGUGGUACGUUCCCUAC
taataCTTCTATG-AAGAGATG miR-18a
Target on HAV 
Binding site 841-865
mfe : -17.1
Hybrid sequence
auaGACGUGAU---CUACGUGGAAU
ggaCTGCAGTGACTGGTGCTTCTTA miR-18a*
Target on HAV 
Binding site 1943-1968
mfe : -11.11
Hybrid sequence
UC-UU-CC--UCGUG-AAUCCCGUCA
AGTAATGGATATTACAGGAGTGCAGT miR-191
Target on HAV 
Binding site 7-30
mfe : -17.4
Hybrid sequence
UCGACGAAAACCCU--AAGGCaac
AGGGGTCTCCGGGAATTTCCGgag miR-191
Target on HAV 
Binding site 1966-1987
mfe : -10.7
Hybrid sequence
ucgacgaAAACCCUAAGGCAac
agtcaacTTTGAGATTTCGTgt miR-191*
Target on HAV 
Binding site 3679-3701
mfe : -12.4
Hybrid sequence
ccCCUGCUU-UAGGUUCGCGUCg
ttGGATTAATAGCAGAGTGTAGa miR-192
Target on HAV 
Binding site 4265-4286
mfe : -16
Hybrid sequence
ccGACAGUUAAG-UAUCCAGUC
aaCTGTTCATTCAATGGCTCAG miR-194
Target on HAV 
Binding site 1063-1088
mfe : -14.6
Hybrid sequence
AGGUGUACCUC----AACGACAAugu
TATACAATGAGCAGTTTGCTGTTcaa miR-196a
Target on HAV 
Binding site 2379-2403
mfe : -14.7
Hybrid sequence
GGUU---GUUG-UACUUUGAUGGAu
CCAGTTTTAGCAAAGAAAGTACCTg miR-196b
Target on HAV 
Binding site 2379-2403
mfe : -14.9
Hybrid sequence
GGUU---GUUG-UCCUUUGAUGGAu
CCAGTTTTAGCAAAGAAAGTACCTg miR-197
Target on HAV 
Binding site 7321-7342
mfe : -12.7
Hybrid sequence
cGACCCACCUCUUCCACCACUu
cCTGTTTGGAGAAAGAGATGAt miR-199a
Target on HAV 
Binding site 7215-7235
mfe : -13.7
Hybrid sequence
cuuGUC-CAUCAGACUUGUGACcc
tggCAGAGAAGT---AACGCTGag miR-200a*
Target on HAV 
Binding site 1586-1607
mfe : -13.4
Hybrid sequence
AGGUCGUGACAGGCCAUUCUAc
TCCGTCCCAGGGTGGTGGGATc miR-214
Target on HAV 
Binding site 2686-2704
mfe : -11
Hybrid sequence
GACGGACAGACACGGACGACA
CT-CCAGTAGGT-CTTGCCGT miR-216
Target on HAV 
Binding site 2568-2594
mfe : -14.2
Hybrid sequence
GUGUC-AACGGU-----CGACUCUAau
CATGGTTTGCCATCAACACTGAGGTgg miR-216
Target on HAV 
Binding site 6196-6214
mfe : -12.1
Hybrid sequence
GUGUCAACGGUCGACU-CUAAu
CTCAGTT---AGTTGATGATTt miR-224
Target on HAV 
Binding site 3290-3310
mfe : -12.3
Hybrid sequence
auuugCCUUGGUGAUCACUGAac
ttcctGGAG--AGGTGTGACTgc miR-24
Target on HAV 
Binding site 6836-6860
mfe : -13.8
Hybrid sequence
GACA--AGG--ACGACUUGACUCGGu
CTGTGGTTCAATGC-CCTCTGGGTCt miR-25
Target on HAV 
Binding site 7165-7184
mfe : -10.1
Hybrid sequence
agUCUGGCUCUGUUCACGUUAc
atAGAATTAGACC--TGCAATt miR-27a
Target on HAV 
Binding site 3745-3766
mfe : -10.4
Hybrid sequence
cgCCUUGAAUCG-GUGACACUu
ttGGATTTCATCATTCTGTGAc miR-299-5p
Target on HAV 
Binding site 388-413
mfe : -13.4
Hybrid sequence
uacauaCACCC--UG-CCA-UUUGGu
caagggGTAGGCTACGGGTGAAACCt miR-29a
Target on HAV 
Binding site 1585-1605
mfe : -15.72
Hybrid sequence
UUGGCUAAAGU-CUACCACgau
ATCCG-TCCCAGGGTGGTGgga miR-29b
Target on HAV 
Binding site 1188-1215
mfe : -11.6
Hybrid sequence
uuguGACUAAAGUU-----UACCACGAU
gttcCTGGTGACCAGAGCTATGGTTCTA miR-302a
Target on HAV 
Binding site 5304-5330
mfe : -14.8
Hybrid sequence
agUGGUUUUG--UA--CCUUCGUGAAu
atAGCAGGACTGGTTAGGAAGAACTTg miR-302b
Target on HAV 
Binding site 7065-7087
mfe : -10.9
Hybrid sequence
gaUGAUUUUGUACCUUCG-UGAAu
aaACT-TGGCATGACAGCTACTTc miR-302c
Target on HAV 
Binding site 3019-3043
mfe : -14.86
Hybrid sequence
GGUGACUUUGUACCU--UCGUgaau
CCACTGAATCAATGATGAGCAgaat miR-302c
Target on HAV 
Binding site 5310-5330
mfe : -15.4
Hybrid sequence
ggUGACUUUGUACCUUCGUGAAu
ggACTG-GTTA-GGAAGAACTTg miR-302c
Target on HAV 
Binding site 6764-6783
mfe : -10.1
Hybrid sequence
GGUGACUUUGUACCUUCGUGAAU
CCATTTTGGCA---CAGCTCTTA miR-324-3p
Target on HAV 
Binding site 3345-3361
mfe : -10.5
Hybrid sequence
gguCGUCGUGGACCCCGUCacc
ttgGCCGCA-----GGCAGaag miR-324-3p
Target on HAV 
Binding site 687-709
mfe : -14.76
Hybrid sequence
gGUCGUCGUG-GACCCCGUCAcc
tCTGAGGTACTCAGGGGCATTta