Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HBV wildtype target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    adr   adyw   unspecified   ayw   adr4   ayw(patient C)   adw2   wildtype    
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 1075 rescords (22 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7a31053135-17.32146
UUGAUAUGUU---------GGAUGAUGGAGu
||||:|:| | ||| ||:||||
AACTGTGCCAGCAGCTCCTCCTCCTGCCTCc
11.678NO
2hsa-let-7a402428-18130
uuGAUAUGUUG---GAUGAU--GGAGU
|| |:|| | ||:||| |||||
tcCTCTGCATCCTGCTGCTATGCCTCA
11.678NO
3hsa-let-7a18181838-13.3129
UUGAUAUGUUGGAUGAUGGAgu
|||| | : |||| ||:|||
AACTTTTTCACCT-CTGCCTaa
11.678NO
4hsa-let-7a31503171-19.6127
uugaUAUGUUGGAUGAUGGAGU
| :||:|||||| |||:|
aggaAGGCAGCCTACTCCCTTA
11.678NO
5hsa-let-7b31143135-14.9151
UUGGUGUGUUGGAUGAUGGAGu
|:| :| | ||| ||:||||
AGCAGCTCCTCCTCCTGCCTCc
11.726NO
6hsa-let-7b18101832-18.8129
uUGGUGUGUUGGAUGA-UGGAGu
||||::||||:| :| |||||
cACCATGCAACTTTTTCACCTCt
11.726NO
7hsa-let-7b31623182-10.3129
uUGGUGUGUUGGAUGAUGGAGu
||: | : |:|| | |||||
tACTCCCTTATCT-CCACCTCt
11.726NO
8hsa-let-7b401428-18.6126
uuGGUG-UGUUG---GAUGAU--GGAGU
|| | :|| | ||:||| |||||
ttCCTCTGCATCCTGCTGCTATGCCTCA
11.726NO
9hsa-let-7b88109-15.7125
uuGGUGUGUUGGAUGAUGGAGu
|::| ||: ||||::|||
ccCTGCTCAGAATACTGTCTCt
11.726NO
10hsa-let-7b14681489-12.9122
uuGGUGUG-UUGGAUGAUGGAGu
||:| : :: || ||||| |
ggCCGCTTGGGGCT-CTACCGCc
11.726NO
11hsa-let-7b22982320-16121
uUGGUGUGUU---GGAUGAUGGAGU
||||| ||| || |||:||:|
gACCAC-CAAATGCC-CCTATCTTA
11.726NO
12hsa-let-7c31103135-17.3143
uuGGUAUGUU-----GGAUGAUGGAGu
||| :||: ||| ||:||||
tgCCA-GCAGCTCCTCCTCCTGCCTCc
11.774NO
13hsa-let-7c18101832-21.8133
uUGGUAUGUUGGAUGA-UGGAGu
|||||:||||:| :| |||||
cACCATGCAACTTTTTCACCTCt
11.774NO
14hsa-let-7c31583182-14.4132
UUGGUAUGUUGG-AU---GAUGGAGu
|:|| ||| || || | |||||
AGCC-TACTCCCTTATCTCCACCTCt
11.774NO
15hsa-let-7c402428-18.9126
uuGGUAUGUUG---GAUGAU--GGAGU
|: |:|| | ||:||| |||||
tcCTCTGCATCCTGCTGCTATGCCTCA
11.774NO
16hsa-let-7c86109-14.1123
UUGGUAU--GUUGGAUGAUGGAGu
|:|| |: ||: ||||::|||
AGCCCTGCTCAGAATACTGTCTCt
11.774NO
17hsa-let-7c15731598-15.8122
uUGGUAUGU-UGGA-UGA--UGGAGu
|||:|::: ||:| :|| |||||
gACCGTGTGCACTTCGCTTCACCTCt
11.774NO
18hsa-let-7d31063135-18.72148
UGAUACGUU---------GGAUGAUGGAGa
|||:||| | ||| ||:||||
ACTGTGCCAGCAGCTCCTCCTCCTGCCTCc
7.888NO
19hsa-let-7d18111832-18134
UGAUACGUUGGAUGA-UGGAGA
|| |||||||:| :| ||||||
ACCATGCAACTTTTTCACCTCT
7.888NO
20hsa-let-7d403428-17.5132
uGAUACGUUG---GAUGAU--GGAGa
|| |||| | ||:||| ||||
cCTCTGCATCCTGCTGCTATGCCTCa
7.888NO
21hsa-let-7d31513171-19129
ugaUACGUUGGAUGAUGGAga
| |||:|||||| |||
ggaAGGCAGCCTACTCCCTta
7.888NO
22hsa-let-7d15761598-15.1126
ugAUACGUUGGAUGA--UGGAGA
|:|||| :: :|| ||||||
cgTGTGCACTTCGCTTCACCTCT
7.888NO
23hsa-let-7d89109-15.3124
uGAUACGUUGGAUGAUGGAGA
||: ||: ||||::||||
cCTGCTCAGAATACTGTCTCT
7.888NO
24hsa-let-7e31063135-22.92151
UGAUAUGUU---------GGAGGAUGGAGu
|||:|:| | ||||||:||||
ACTGTGCCAGCAGCTCCTCCTCCTGCCTCc
6.037NO
25hsa-let-7e403428-16.2130
uGAUAUGUUGGA-G--GAU--GGAGU
|| |:|| ||| | ||| |||||
cCTCTGCATCCTGCTGCTATGCCTCA
6.037NO
26hsa-let-7e18111832-17.4127
UGAUAUGUUGGAGGA-UGGAGu
|| ||:||||:|::| |||||
ACCATGCAACTTTTTCACCTCt
6.037NO
27hsa-let-7e31583182-15.7126
ugauAUGUUGGA----GGAUGGAGu
||| ||| :| |||||
agccTACTCCCTTATCTCCACCTCt
6.037NO
28hsa-let-7e15761598-14.3122
ugAUAUGUUGGAG-GA--UGGAGu
|:|:| ||:|| || |||||
cgTGTGC-ACTTCGCTTCACCTCt
6.037NO
29hsa-let-7f31053135-14138
UUGAUAUGUU--------A-GAUGAUGGAGu
||||:|:| | | || ||:||||
AACTGTGCCAGCAGCTCCTCCTCCTGCCTCc
10.092NO
30hsa-let-7g31063135-15.41142
UGACAUGUUU---------GAUGAUGGAGu
|||||:| |: || ||:||||
ACTGTGCCAGCAGCTCCTCCTCCTGCCTCc
9.988NO
31hsa-let-7g89109-15.4133
uGACAUGUUUGAUGAUGGAGu
||| ||:| ||||::|||
cCTGCTCAGAATACTGTCTCt
9.988NO
32hsa-let-7g405428-16127
uGACAU-GUUUGAUGAU--GGAGU
||| | | :||:||| |||||
tCTGCATCCTGCTGCTATGCCTCA
9.988NO
33hsa-let-7g15741598-11.3122
UGACAUGUUUGA--UGA--UGGAGu
|| ||::: ||| :|| |||||
ACCGTGTGCACTTCGCTTCACCTCt
9.988NO
34hsa-let-7i31153135-15.9151
uGUCGUGUUUGAUGAUGGAGu
|||| | || ||:||||
gCAGCTCCTCCTCCTGCCTCc
7.883NO
35hsa-let-7i89109-15135
uGUCGUGUUUGAUGAUGGAGu
| || ||:| ||||::|||
cCTGCTCAGAATACTGTCTCt
7.883NO
36hsa-let-7i405428-16.6129
uGUCGU-GUUUGAUGAU--GGAGU
| ||| | :||:||| |||||
tCTGCATCCTGCTGCTATGCCTCA
7.883NO
37hsa-let-7i23672386-10.7125
ugUCGUGUUUGAUGAUGGAGu
|| | :|| ||| ||||
ctAG-AAGAAGAACTCCCTCg
7.883NO
38hsa-let-7i31563182-12.37123
uGUCG--UGUUUG-AU---GAUGGAGu
|||| || | || | |||||
gCAGCCTACTCCCTTATCTCCACCTCt
7.883NO
39hsa-let-7i385407-11.34122
uGUCGU--GUUUGAUGAUGGAGu
|:||: : | | || ||||
gCGGCGTTTTATCATCTTCCTCt
7.883NO
40hsa-miR-125312555-10.1131
aUGUAUGAAGAAA-----UGUAAGgu
|| | ||||||| ||||||
aAC-TCCTTCTTTTCCTGACATTCat
5.340NO
41hsa-miR-114131434-14.1121
aUGUAUGAAG-AAAUGUAAGGu
||:| |||: |||||:| ||
gACGTCCTTTGTTTACGTCCCg
5.340NO
42hsa-miR-10027922818-16.9146
GUGUUCA-AGCCUAG----AUGCCCAa
|||| || || || |:|||||
CACACGTAGCGCCTCATTTTGCGGGTc
9.137NO
43hsa-miR-10024662491-15.2126
GUGUUCAAGCCU---AGAUG-CCCaa
||:||| | ||| |:||| |||
CATAAGGTGGGAAACTTTACTGGGct
9.137NO
44hsa-miR-100371392-14.9121
GUGUUCAAGCCUAGAUGCC-CAA
|:| :| | | :|||:||| |||
CGCTGGAT-GTGTCTGCGGCGTT
9.137NO
45hsa-miR-10313721395-18.7153
aGUAUCGG-GACAUGUUACGACGa
|||:||: || :| :||||||
cCATGGCTGCTAGGCTGTGCTGCc
9.493NO
46hsa-miR-103396420-18.6149
AGUAUCGGGACAUGU--UACGACGA
|||| :||| |:|| |||||||
TCATCTTCCTCTGCATCCTGCTGCT
9.493NO
47hsa-miR-1033961-25.2140
AGUAUCGGGACAUGUUACGACGA
||| :||||||||| | |||||
TCAGGGCCCTGTACCTTCCTGCT
9.493NO
48hsa-miR-103551569-12.7132
aguaucGGGACAUGUUACGACGA
|||| | |||:||||
atgtttCCCT---C-ATGTTGCT
9.493NO
49hsa-miR-10310281050-11.2128
AGUAUCGGGACAUGU-UACGACGA
||| || |||: | || |||||
TCA-CGCAATGTGGATATCCTGCT
9.493NO
50hsa-miR-10530193038-19138
uguCCUCAGACUCGUAAACu
||||| ||||||| |
gtgGGAGTGGGAGCATTCGg
5.000NO
let-7a
Target on HBV wildtype 
Binding site 3105-3135
mfe : -17.32
Hybrid sequence
UUGAUAUGUU---------GGAUGAUGGAGu
AACTGTGCCAGCAGCTCCTCCTCCTGCCTCc let-7a
Target on HBV wildtype 
Binding site 402-428
mfe : -18
Hybrid sequence
uuGAUAUGUUG---GAUGAU--GGAGU
tcCTCTGCATCCTGCTGCTATGCCTCA let-7a
Target on HBV wildtype 
Binding site 1818-1838
mfe : -13.3
Hybrid sequence
UUGAUAUGUUGGAUGAUGGAgu
AACTTTTTCACCT-CTGCCTaa let-7a
Target on HBV wildtype 
Binding site 3150-3171
mfe : -19.6
Hybrid sequence
uugaUAUGUUGGAUGAUGGAGU
aggaAGGCAGCCTACTCCCTTA let-7b
Target on HBV wildtype 
Binding site 3114-3135
mfe : -14.9
Hybrid sequence
UUGGUGUGUUGGAUGAUGGAGu
AGCAGCTCCTCCTCCTGCCTCc let-7b
Target on HBV wildtype 
Binding site 1810-1832
mfe : -18.8
Hybrid sequence
uUGGUGUGUUGGAUGA-UGGAGu
cACCATGCAACTTTTTCACCTCt let-7b
Target on HBV wildtype 
Binding site 3162-3182
mfe : -10.3
Hybrid sequence
uUGGUGUGUUGGAUGAUGGAGu
tACTCCCTTATCT-CCACCTCt let-7b
Target on HBV wildtype 
Binding site 401-428
mfe : -18.6
Hybrid sequence
uuGGUG-UGUUG---GAUGAU--GGAGU
ttCCTCTGCATCCTGCTGCTATGCCTCA let-7b
Target on HBV wildtype 
Binding site 88-109
mfe : -15.7
Hybrid sequence
uuGGUGUGUUGGAUGAUGGAGu
ccCTGCTCAGAATACTGTCTCt let-7b
Target on HBV wildtype 
Binding site 1468-1489
mfe : -12.9
Hybrid sequence
uuGGUGUG-UUGGAUGAUGGAGu
ggCCGCTTGGGGCT-CTACCGCc let-7b
Target on HBV wildtype 
Binding site 2298-2320
mfe : -16
Hybrid sequence
uUGGUGUGUU---GGAUGAUGGAGU
gACCAC-CAAATGCC-CCTATCTTA let-7c
Target on HBV wildtype 
Binding site 3110-3135
mfe : -17.3
Hybrid sequence
uuGGUAUGUU-----GGAUGAUGGAGu
tgCCA-GCAGCTCCTCCTCCTGCCTCc let-7c
Target on HBV wildtype 
Binding site 1810-1832
mfe : -21.8
Hybrid sequence
uUGGUAUGUUGGAUGA-UGGAGu
cACCATGCAACTTTTTCACCTCt let-7c
Target on HBV wildtype 
Binding site 3158-3182
mfe : -14.4
Hybrid sequence
UUGGUAUGUUGG-AU---GAUGGAGu
AGCC-TACTCCCTTATCTCCACCTCt let-7c
Target on HBV wildtype 
Binding site 402-428
mfe : -18.9
Hybrid sequence
uuGGUAUGUUG---GAUGAU--GGAGU
tcCTCTGCATCCTGCTGCTATGCCTCA let-7c
Target on HBV wildtype 
Binding site 86-109
mfe : -14.1
Hybrid sequence
UUGGUAU--GUUGGAUGAUGGAGu
AGCCCTGCTCAGAATACTGTCTCt let-7c
Target on HBV wildtype 
Binding site 1573-1598
mfe : -15.8
Hybrid sequence
uUGGUAUGU-UGGA-UGA--UGGAGu
gACCGTGTGCACTTCGCTTCACCTCt let-7d
Target on HBV wildtype 
Binding site 3106-3135
mfe : -18.72
Hybrid sequence
UGAUACGUU---------GGAUGAUGGAGa
ACTGTGCCAGCAGCTCCTCCTCCTGCCTCc let-7d
Target on HBV wildtype 
Binding site 1811-1832
mfe : -18
Hybrid sequence
UGAUACGUUGGAUGA-UGGAGA
ACCATGCAACTTTTTCACCTCT let-7d
Target on HBV wildtype 
Binding site 403-428
mfe : -17.5
Hybrid sequence
uGAUACGUUG---GAUGAU--GGAGa
cCTCTGCATCCTGCTGCTATGCCTCa let-7d
Target on HBV wildtype 
Binding site 3151-3171
mfe : -19
Hybrid sequence
ugaUACGUUGGAUGAUGGAga
ggaAGGCAGCCTACTCCCTta let-7d
Target on HBV wildtype 
Binding site 1576-1598
mfe : -15.1
Hybrid sequence
ugAUACGUUGGAUGA--UGGAGA
cgTGTGCACTTCGCTTCACCTCT let-7d
Target on HBV wildtype 
Binding site 89-109
mfe : -15.3
Hybrid sequence
uGAUACGUUGGAUGAUGGAGA
cCTGCTCAGAATACTGTCTCT let-7e
Target on HBV wildtype 
Binding site 3106-3135
mfe : -22.92
Hybrid sequence
UGAUAUGUU---------GGAGGAUGGAGu
ACTGTGCCAGCAGCTCCTCCTCCTGCCTCc let-7e
Target on HBV wildtype 
Binding site 403-428
mfe : -16.2
Hybrid sequence
uGAUAUGUUGGA-G--GAU--GGAGU
cCTCTGCATCCTGCTGCTATGCCTCA let-7e
Target on HBV wildtype 
Binding site 1811-1832
mfe : -17.4
Hybrid sequence
UGAUAUGUUGGAGGA-UGGAGu
ACCATGCAACTTTTTCACCTCt let-7e
Target on HBV wildtype 
Binding site 3158-3182
mfe : -15.7
Hybrid sequence
ugauAUGUUGGA----GGAUGGAGu
agccTACTCCCTTATCTCCACCTCt let-7e
Target on HBV wildtype 
Binding site 1576-1598
mfe : -14.3
Hybrid sequence
ugAUAUGUUGGAG-GA--UGGAGu
cgTGTGC-ACTTCGCTTCACCTCt let-7f
Target on HBV wildtype 
Binding site 3105-3135
mfe : -14
Hybrid sequence
UUGAUAUGUU--------A-GAUGAUGGAGu
AACTGTGCCAGCAGCTCCTCCTCCTGCCTCc let-7g
Target on HBV wildtype 
Binding site 3106-3135
mfe : -15.41
Hybrid sequence
UGACAUGUUU---------GAUGAUGGAGu
ACTGTGCCAGCAGCTCCTCCTCCTGCCTCc let-7g
Target on HBV wildtype 
Binding site 89-109
mfe : -15.4
Hybrid sequence
uGACAUGUUUGAUGAUGGAGu
cCTGCTCAGAATACTGTCTCt let-7g
Target on HBV wildtype 
Binding site 405-428
mfe : -16
Hybrid sequence
uGACAU-GUUUGAUGAU--GGAGU
tCTGCATCCTGCTGCTATGCCTCA let-7g
Target on HBV wildtype 
Binding site 1574-1598
mfe : -11.3
Hybrid sequence
UGACAUGUUUGA--UGA--UGGAGu
ACCGTGTGCACTTCGCTTCACCTCt let-7i
Target on HBV wildtype 
Binding site 3115-3135
mfe : -15.9
Hybrid sequence
uGUCGUGUUUGAUGAUGGAGu
gCAGCTCCTCCTCCTGCCTCc let-7i
Target on HBV wildtype 
Binding site 89-109
mfe : -15
Hybrid sequence
uGUCGUGUUUGAUGAUGGAGu
cCTGCTCAGAATACTGTCTCt let-7i
Target on HBV wildtype 
Binding site 405-428
mfe : -16.6
Hybrid sequence
uGUCGU-GUUUGAUGAU--GGAGU
tCTGCATCCTGCTGCTATGCCTCA let-7i
Target on HBV wildtype 
Binding site 2367-2386
mfe : -10.7
Hybrid sequence
ugUCGUGUUUGAUGAUGGAGu
ctAG-AAGAAGAACTCCCTCg let-7i
Target on HBV wildtype 
Binding site 3156-3182
mfe : -12.37
Hybrid sequence
uGUCG--UGUUUG-AU---GAUGGAGu
gCAGCCTACTCCCTTATCTCCACCTCt let-7i
Target on HBV wildtype 
Binding site 385-407
mfe : -11.34
Hybrid sequence
uGUCGU--GUUUGAUGAUGGAGu
gCGGCGTTTTATCATCTTCCTCt miR-1
Target on HBV wildtype 
Binding site 2531-2555
mfe : -10.1
Hybrid sequence
aUGUAUGAAGAAA-----UGUAAGgu
aAC-TCCTTCTTTTCCTGACATTCat miR-1
Target on HBV wildtype 
Binding site 1413-1434
mfe : -14.1
Hybrid sequence
aUGUAUGAAG-AAAUGUAAGGu
gACGTCCTTTGTTTACGTCCCg miR-100
Target on HBV wildtype 
Binding site 2792-2818
mfe : -16.9
Hybrid sequence
GUGUUCA-AGCCUAG----AUGCCCAa
CACACGTAGCGCCTCATTTTGCGGGTc miR-100
Target on HBV wildtype 
Binding site 2466-2491
mfe : -15.2
Hybrid sequence
GUGUUCAAGCCU---AGAUG-CCCaa
CATAAGGTGGGAAACTTTACTGGGct miR-100
Target on HBV wildtype 
Binding site 371-392
mfe : -14.9
Hybrid sequence
GUGUUCAAGCCUAGAUGCC-CAA
CGCTGGAT-GTGTCTGCGGCGTT miR-103
Target on HBV wildtype 
Binding site 1372-1395
mfe : -18.7
Hybrid sequence
aGUAUCGG-GACAUGUUACGACGa
cCATGGCTGCTAGGCTGTGCTGCc miR-103
Target on HBV wildtype 
Binding site 396-420
mfe : -18.6
Hybrid sequence
AGUAUCGGGACAUGU--UACGACGA
TCATCTTCCTCTGCATCCTGCTGCT miR-103
Target on HBV wildtype 
Binding site 39-61
mfe : -25.2
Hybrid sequence
AGUAUCGGGACAUGUUACGACGA
TCAGGGCCCTGTACCTTCCTGCT miR-103
Target on HBV wildtype 
Binding site 551-569
mfe : -12.7
Hybrid sequence
aguaucGGGACAUGUUACGACGA
atgtttCCCT---C-ATGTTGCT miR-103
Target on HBV wildtype 
Binding site 1028-1050
mfe : -11.2
Hybrid sequence
AGUAUCGGGACAUGU-UACGACGA
TCA-CGCAATGTGGATATCCTGCT miR-105
Target on HBV wildtype 
Binding site 3019-3038
mfe : -19
Hybrid sequence
uguCCUCAGACUCGUAAACu
gtgGGAGTGGGAGCATTCGg