Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HGV target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
 Browse   strain Iowan, complete genome   wildtype(complete genome)   
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 4939 rescords (99 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7a59545978-13.5144
UUGAUAUGUUG-GA---UGAUGGAGu
|:||| ||||| || |||||| |
AGCTA-ACAACTCTGGCACTACCACt
11.678NO
2hsa-let-7a82298250-18144
UUGAUAUGUUGGAUGAUGGAGU
||||: ::||||:|||| |||
AACTGCTTGACCTGCTACATCA
11.678NO
3hsa-let-7a11561175-11.5137
uuGAUAUGUUGGAUGAUGGAGu
| | :|: || ||:||||
cgCAAGGCGCCC--CTGCCTCc
11.678NO
4hsa-let-7a16181640-13.5137
uuGAUAUGUUGGAU-GAUGGAGu
||: || ::| : ||:||||
ttCTGGACCGTCGGCCTGCCTCc
11.678NO
5hsa-let-7a65846603-17.4135
UUGAUAUGUUGGAUGAUGGAGu
|:||: :| |||||||| ||
AGCTGAGC--CCTACTACGTCg
11.678NO
6hsa-let-7a56105631-14.3133
uugauauGUUGGAUGAUGGAgu
|::|:| ||||||
gcagccgCGGCTTCCTACCTga
11.678NO
7hsa-let-7a62926312-12.7131
uugauaUGUUGGAUGAUGGAGu
| |::| :||:||||
atgttgAGAGTC-GCTGCCTCt
11.678NO
8hsa-let-7a89108935-11.8131
uugaUAUGU-UGGAU---GAUGGAGu
|| || :|||| || ||||
tggcATCCAGGCCTACGGCTTCCTCc
11.678NO
9hsa-let-7a10021026-12.7128
UUGAU-AUGUUGGA--UGAUGGAGu
||||| |: | :|| | ||||||
AACTACTGGATTCTGGAATACCTCt
11.678NO
10hsa-let-7a41884210-11.9126
uuGAUAUGUUGGAUGA--UGGAGu
||| :| ||| :|| |||||
ctCTACGCCACC-GCTACACCTCc
11.678NO
11hsa-let-7a86988716-12.9125
uUGAUAUGUUGGAUGAUGGAgu
|||: |||| |||:|||
cACTGGACAA---ACTGCCTaa
11.678NO
12hsa-let-7a66886706-14124
UUGAUAUGUUGGAUGAUGGAGU
|:| ||| ||| :|:|||||
AGCGCTAC-ACC--TTGCCTCA
11.678NO
13hsa-let-7a92559276-13.2124
uugauauguuggauGAUGGAGU
||||||:|
tcggtggcgggtcgCTACCTTA
11.678NO
14hsa-let-7a81258147-11.7121
uUGAUAUGUUGGAUGAU--GGAGU
||| |: :| ||||| |||||
cACT-TGGGAAATACTATGCCTCA
11.678NO
15hsa-let-7b82298250-19.3149
UUGGUGUGUUGGAUGAUGGAGU
|||::| ::||||:|||| |||
AACTGCTTGACCTGCTACATCA
11.726NO
16hsa-let-7b59545978-12.9140
UUGGUGUGUUG-GA---UGAUGGAGu
|:|:| ||||| || |||||| |
AGCTA-ACAACTCTGGCACTACCACt
11.726NO
17hsa-let-7b56105631-18.2139
uugguGUGUUGGAUGAUGGAgu
|:|::|:| ||||||
gcagcCGCGGCTTCCTACCTga
11.726NO
18hsa-let-7b11531175-15.4139
uugGUGUGUUG-GAUGAUGGAGu
|:|| ::| | ||:||||
tgtCGCAAGGCGCCCCTGCCTCc
11.726NO
19hsa-let-7b16231640-17.1136
uUGGUGUGUUGGAUGAUGGAGu
|||:: |::| ||:||||
gACCGT-CGGC---CTGCCTCc
11.726NO
20hsa-let-7b89108935-14.3133
uugGUGUGU-UGGAU---GAUGGAGu
||: || :|||| || ||||
tggCATCCAGGCCTACGGCTTCCTCc
11.726NO
21hsa-let-7b41884210-17.6131
uuGGUGUGUUGGAUGA--UGGAGu
|:||:| ||| :|| |||||
ctCTACGCCACC-GCTACACCTCc
11.726NO
22hsa-let-7b62926312-12.6131
uuggugUGUUGGAUGAUGGAGu
| |::| :||:||||
atgttgAGAGTC-GCTGCCTCt
11.726NO
23hsa-let-7b65846603-15.9131
UUGGUGUGUUGGAUGAUGGAGu
|:|:: :| |||||||| ||
AGCTGAGC--CCTACTACGTCg
11.726NO
24hsa-let-7b86958716-17.5128
uuGGUGUGUUGGAUGAUGGAgu
|||| :|| |||:|||
ttCCACTGGACAAACTGCCTaa
11.726NO
25hsa-let-7b34843509-18.3128
UUGGUGUGUUGG---A---UGAUGGAGu
| |||| | || | :||||:||
ATCCACTC--CCGGATGGGGCTACTTCg
11.726NO
26hsa-let-7b76077626-16.1126
uuGGUGUGUUGGAUGAUGGAgu
||:| ||| | ||:|||
ggCCGCTCAAGC--CTGCCTaa
11.726NO
27hsa-let-7b10021026-14.4126
UUGGUG-UGUUGGA--UGAUGGAGu
|||:|| : | :|| | ||||||
AACTACTGGATTCTGGAATACCTCt
11.726NO
28hsa-let-7b92489276-19126
uuGGUG-------UGUUGGAUGAUGGAGU
|||| :|:: : :||||||:|
tgCCACTTCGGTGGCGGGTCGCTACCTTA
11.726NO
29hsa-let-7b50525073-18.3124
uUGGUGUGUUGGAUGAUGGAgu
||||||:|:: || ||||
cACCACATAGTGGACGACCTgg
11.726NO
30hsa-let-7b63496377-10.02122
UUG-GUGUGUUGG----AU--GAUGGagu
||| || | |||| || |||||
AACTCAAAGAACCAGTTTACTCTACCaag
11.726NO
31hsa-let-7b66876706-16.1121
uUGGUG-UGUUGGAUGAUGGAGU
| |:| || ||| :|:|||||
gAGCGCTAC-ACC--TTGCCTCA
11.726NO
32hsa-let-7c16231640-18.4140
uUGGUAUGUUGGAUGAUGGAGu
|||:| |::| ||:||||
gACCGT-CGGC---CTGCCTCc
11.774NO
33hsa-let-7c59545978-12.9140
UUGGUAUGUUG-GA---UGAUGGAGu
|:|:| ||||| || |||||| |
AGCTA-ACAACTCTGGCACTACCACt
11.774NO
34hsa-let-7c82298250-15.2140
UUGGUAUGUUGGAUGAUGGAGU
|||:: ::||||:|||| |||
AACTGCTTGACCTGCTACATCA
11.774NO
35hsa-let-7c56125631-17.3139
UUGGUAUGUUGGAUGAUGGAgu
|:|| :|::|:| ||||||
AGCC--GCGGCTTCCTACCTga
11.774NO
36hsa-let-7c11561175-12.3137
uuGGUAUGUUGGAUGAUGGAGu
| | :|: || ||:||||
cgCAAGGCGCCC--CTGCCTCc
11.774NO
37hsa-let-7c89108935-14.6137
uugGUAUGU-UGGAU---GAUGGAGu
||| || :|||| || ||||
tggCATCCAGGCCTACGGCTTCCTCc
11.774NO
38hsa-let-7c62926312-12.7131
uugguaUGUUGGAUGAUGGAGu
| |::| :||:||||
atgttgAGAGTC-GCTGCCTCt
11.774NO
39hsa-let-7c65846603-15.5131
UUGGUAUGUUGGAUGAUGGAGu
|:|:: :| |||||||| ||
AGCTGAGC--CCTACTACGTCg
11.774NO
40hsa-let-7c10021026-12.1124
UUGGU-AUGUUGGA--UGAUGGAGu
|||:| |: | :|| | ||||||
AACTACTGGATTCTGGAATACCTCt
11.774NO
41hsa-let-7c66886706-14.6124
UUGGUAUGUUGGAUGAUGGAGU
|:| ||| ||| :|:|||||
AGCGCTAC-ACC--TTGCCTCA
11.774NO
42hsa-let-7c92559276-15124
uugguauguuggauGAUGGAGU
||||||:|
tcggtggcgggtcgCTACCTTA
11.774NO
43hsa-let-7c63496377-11.12122
UUG-GUAUGUUGG----AU--GAUGGagu
||| || | |||| || |||||
AACTCAAAGAACCAGTTTACTCTACCaag
11.774NO
44hsa-let-7c41884210-11.9122
uuGGUAUGUUGGAUGA--UGGAGu
|:| :| ||| :|| |||||
ctCTACGCCACC-GCTACACCTCc
11.774NO
45hsa-let-7c86988716-11.4121
uUGGUAUGUUGGAUGAUGGAgu
||:: |||| |||:|||
cACTGGACAA---ACTGCCTaa
11.774NO
46hsa-let-7d11571175-14.2143
uGAUACGUUGGAUGAUGGAGa
| | ||: || ||:||||
gCAAGGCGCCC--CTGCCTCc
7.888NO
47hsa-let-7d56115631-14.3139
ugauaCGUUGGAUGAUGGAga
||::|:| ||||||
cagccGCGGCTTCCTACCTga
7.888NO
48hsa-let-7d65856603-16.5137
uGAUACGUUGGAUGAUGGAGa
||: || |||||||| ||
gCTGAGC--CCTACTACGTCg
7.888NO
49hsa-let-7d59555978-12.4137
uGAUACGUUG-GA---UGAUGGAGA
||| |||| || |||||| ||
gCTA-ACAACTCTGGCACTACCACT
7.888NO
50hsa-let-7d62926312-13.8137
ugauACGUUGGAUGAUGGAGA
|| :| : :||:|||||
atgtTGAGAGTCGCTGCCTCT
7.888NO
let-7a
Target on HGV 
Binding site 5954-5978
mfe : -13.5
Hybrid sequence
UUGAUAUGUUG-GA---UGAUGGAGu
AGCTA-ACAACTCTGGCACTACCACt let-7a
Target on HGV 
Binding site 8229-8250
mfe : -18
Hybrid sequence
UUGAUAUGUUGGAUGAUGGAGU
AACTGCTTGACCTGCTACATCA let-7a
Target on HGV 
Binding site 1156-1175
mfe : -11.5
Hybrid sequence
uuGAUAUGUUGGAUGAUGGAGu
cgCAAGGCGCCC--CTGCCTCc let-7a
Target on HGV 
Binding site 1618-1640
mfe : -13.5
Hybrid sequence
uuGAUAUGUUGGAU-GAUGGAGu
ttCTGGACCGTCGGCCTGCCTCc let-7a
Target on HGV 
Binding site 6584-6603
mfe : -17.4
Hybrid sequence
UUGAUAUGUUGGAUGAUGGAGu
AGCTGAGC--CCTACTACGTCg let-7a
Target on HGV 
Binding site 5610-5631
mfe : -14.3
Hybrid sequence
uugauauGUUGGAUGAUGGAgu
gcagccgCGGCTTCCTACCTga let-7a
Target on HGV 
Binding site 6292-6312
mfe : -12.7
Hybrid sequence
uugauaUGUUGGAUGAUGGAGu
atgttgAGAGTC-GCTGCCTCt let-7a
Target on HGV 
Binding site 8910-8935
mfe : -11.8
Hybrid sequence
uugaUAUGU-UGGAU---GAUGGAGu
tggcATCCAGGCCTACGGCTTCCTCc let-7a
Target on HGV 
Binding site 1002-1026
mfe : -12.7
Hybrid sequence
UUGAU-AUGUUGGA--UGAUGGAGu
AACTACTGGATTCTGGAATACCTCt let-7a
Target on HGV 
Binding site 4188-4210
mfe : -11.9
Hybrid sequence
uuGAUAUGUUGGAUGA--UGGAGu
ctCTACGCCACC-GCTACACCTCc let-7a
Target on HGV 
Binding site 8698-8716
mfe : -12.9
Hybrid sequence
uUGAUAUGUUGGAUGAUGGAgu
cACTGGACAA---ACTGCCTaa let-7a
Target on HGV 
Binding site 6688-6706
mfe : -14
Hybrid sequence
UUGAUAUGUUGGAUGAUGGAGU
AGCGCTAC-ACC--TTGCCTCA let-7a
Target on HGV 
Binding site 9255-9276
mfe : -13.2
Hybrid sequence
uugauauguuggauGAUGGAGU
tcggtggcgggtcgCTACCTTA let-7a
Target on HGV 
Binding site 8125-8147
mfe : -11.7
Hybrid sequence
uUGAUAUGUUGGAUGAU--GGAGU
cACT-TGGGAAATACTATGCCTCA let-7b
Target on HGV 
Binding site 8229-8250
mfe : -19.3
Hybrid sequence
UUGGUGUGUUGGAUGAUGGAGU
AACTGCTTGACCTGCTACATCA let-7b
Target on HGV 
Binding site 5954-5978
mfe : -12.9
Hybrid sequence
UUGGUGUGUUG-GA---UGAUGGAGu
AGCTA-ACAACTCTGGCACTACCACt let-7b
Target on HGV 
Binding site 5610-5631
mfe : -18.2
Hybrid sequence
uugguGUGUUGGAUGAUGGAgu
gcagcCGCGGCTTCCTACCTga let-7b
Target on HGV 
Binding site 1153-1175
mfe : -15.4
Hybrid sequence
uugGUGUGUUG-GAUGAUGGAGu
tgtCGCAAGGCGCCCCTGCCTCc let-7b
Target on HGV 
Binding site 1623-1640
mfe : -17.1
Hybrid sequence
uUGGUGUGUUGGAUGAUGGAGu
gACCGT-CGGC---CTGCCTCc let-7b
Target on HGV 
Binding site 8910-8935
mfe : -14.3
Hybrid sequence
uugGUGUGU-UGGAU---GAUGGAGu
tggCATCCAGGCCTACGGCTTCCTCc let-7b
Target on HGV 
Binding site 4188-4210
mfe : -17.6
Hybrid sequence
uuGGUGUGUUGGAUGA--UGGAGu
ctCTACGCCACC-GCTACACCTCc let-7b
Target on HGV 
Binding site 6292-6312
mfe : -12.6
Hybrid sequence
uuggugUGUUGGAUGAUGGAGu
atgttgAGAGTC-GCTGCCTCt let-7b
Target on HGV 
Binding site 6584-6603
mfe : -15.9
Hybrid sequence
UUGGUGUGUUGGAUGAUGGAGu
AGCTGAGC--CCTACTACGTCg let-7b
Target on HGV 
Binding site 8695-8716
mfe : -17.5
Hybrid sequence
uuGGUGUGUUGGAUGAUGGAgu
ttCCACTGGACAAACTGCCTaa let-7b
Target on HGV 
Binding site 3484-3509
mfe : -18.3
Hybrid sequence
UUGGUGUGUUGG---A---UGAUGGAGu
ATCCACTC--CCGGATGGGGCTACTTCg let-7b
Target on HGV 
Binding site 7607-7626
mfe : -16.1
Hybrid sequence
uuGGUGUGUUGGAUGAUGGAgu
ggCCGCTCAAGC--CTGCCTaa let-7b
Target on HGV 
Binding site 1002-1026
mfe : -14.4
Hybrid sequence
UUGGUG-UGUUGGA--UGAUGGAGu
AACTACTGGATTCTGGAATACCTCt let-7b
Target on HGV 
Binding site 9248-9276
mfe : -19
Hybrid sequence
uuGGUG-------UGUUGGAUGAUGGAGU
tgCCACTTCGGTGGCGGGTCGCTACCTTA let-7b
Target on HGV 
Binding site 5052-5073
mfe : -18.3
Hybrid sequence
uUGGUGUGUUGGAUGAUGGAgu
cACCACATAGTGGACGACCTgg let-7b
Target on HGV 
Binding site 6349-6377
mfe : -10.02
Hybrid sequence
UUG-GUGUGUUGG----AU--GAUGGagu
AACTCAAAGAACCAGTTTACTCTACCaag let-7b
Target on HGV 
Binding site 6687-6706
mfe : -16.1
Hybrid sequence
uUGGUG-UGUUGGAUGAUGGAGU
gAGCGCTAC-ACC--TTGCCTCA let-7c
Target on HGV 
Binding site 1623-1640
mfe : -18.4
Hybrid sequence
uUGGUAUGUUGGAUGAUGGAGu
gACCGT-CGGC---CTGCCTCc let-7c
Target on HGV 
Binding site 5954-5978
mfe : -12.9
Hybrid sequence
UUGGUAUGUUG-GA---UGAUGGAGu
AGCTA-ACAACTCTGGCACTACCACt let-7c
Target on HGV 
Binding site 8229-8250
mfe : -15.2
Hybrid sequence
UUGGUAUGUUGGAUGAUGGAGU
AACTGCTTGACCTGCTACATCA let-7c
Target on HGV 
Binding site 5612-5631
mfe : -17.3
Hybrid sequence
UUGGUAUGUUGGAUGAUGGAgu
AGCC--GCGGCTTCCTACCTga let-7c
Target on HGV 
Binding site 1156-1175
mfe : -12.3
Hybrid sequence
uuGGUAUGUUGGAUGAUGGAGu
cgCAAGGCGCCC--CTGCCTCc let-7c
Target on HGV 
Binding site 8910-8935
mfe : -14.6
Hybrid sequence
uugGUAUGU-UGGAU---GAUGGAGu
tggCATCCAGGCCTACGGCTTCCTCc let-7c
Target on HGV 
Binding site 6292-6312
mfe : -12.7
Hybrid sequence
uugguaUGUUGGAUGAUGGAGu
atgttgAGAGTC-GCTGCCTCt let-7c
Target on HGV 
Binding site 6584-6603
mfe : -15.5
Hybrid sequence
UUGGUAUGUUGGAUGAUGGAGu
AGCTGAGC--CCTACTACGTCg let-7c
Target on HGV 
Binding site 1002-1026
mfe : -12.1
Hybrid sequence
UUGGU-AUGUUGGA--UGAUGGAGu
AACTACTGGATTCTGGAATACCTCt let-7c
Target on HGV 
Binding site 6688-6706
mfe : -14.6
Hybrid sequence
UUGGUAUGUUGGAUGAUGGAGU
AGCGCTAC-ACC--TTGCCTCA let-7c
Target on HGV 
Binding site 9255-9276
mfe : -15
Hybrid sequence
uugguauguuggauGAUGGAGU
tcggtggcgggtcgCTACCTTA let-7c
Target on HGV 
Binding site 6349-6377
mfe : -11.12
Hybrid sequence
UUG-GUAUGUUGG----AU--GAUGGagu
AACTCAAAGAACCAGTTTACTCTACCaag let-7c
Target on HGV 
Binding site 4188-4210
mfe : -11.9
Hybrid sequence
uuGGUAUGUUGGAUGA--UGGAGu
ctCTACGCCACC-GCTACACCTCc let-7c
Target on HGV 
Binding site 8698-8716
mfe : -11.4
Hybrid sequence
uUGGUAUGUUGGAUGAUGGAgu
cACTGGACAA---ACTGCCTaa let-7d
Target on HGV 
Binding site 1157-1175
mfe : -14.2
Hybrid sequence
uGAUACGUUGGAUGAUGGAGa
gCAAGGCGCCC--CTGCCTCc let-7d
Target on HGV 
Binding site 5611-5631
mfe : -14.3
Hybrid sequence
ugauaCGUUGGAUGAUGGAga
cagccGCGGCTTCCTACCTga let-7d
Target on HGV 
Binding site 6585-6603
mfe : -16.5
Hybrid sequence
uGAUACGUUGGAUGAUGGAGa
gCTGAGC--CCTACTACGTCg let-7d
Target on HGV 
Binding site 5955-5978
mfe : -12.4
Hybrid sequence
uGAUACGUUG-GA---UGAUGGAGA
gCTA-ACAACTCTGGCACTACCACT let-7d
Target on HGV 
Binding site 6292-6312
mfe : -13.8
Hybrid sequence
ugauACGUUGGAUGAUGGAGA
atgtTGAGAGTCGCTGCCTCT