Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HCV wildtype target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    
Subtypes1a  1b  2a  3a  4a  5a  6a  10a  11a 
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 4725 rescords (95 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7a89558983-13.9159
uUGA--UAUGUUG--GAU---GAUGGAGu
||| ||| ||| ||: |||||||
tACTCCATAGAACCACTGGATCTACCTCc
11.678NO
2hsa-let-7a93429363-10.7145
uugauaugUUGGAUGAUGGAGu
|: | |||||||
gcaggggtAGGCATCTACCTCc
11.678NO
3hsa-let-7a45754599-17.7142
UUGAUAUG---UUGGAUGAUGGAGu
| | ||:| ::||||||||| |
ATCAATGCCGTGGCCTACTACCGCg
11.678NO
4hsa-let-7a87338754-18.2140
uugaUAUGUUGGAUGAUGGAGU
| | :::|||||||||:|
ggaaAGAGGGTCTACTACCTTA
11.678NO
5hsa-let-7a47264751-14.4131
uugauAUGUUGGA--U--GAUGGAgu
| ||:||| | ||||||
tcgatTTCAGCCTTGACCCTACCTtt
11.678NO
6hsa-let-7a30583078-11.6131
uuGAUAUGUUGGAUGAUGGAGu
|| || |::| ||||:||
tgCT-TAAAGTCCCCTACTTCg
11.678NO
7hsa-let-7a719741-16.6129
uUGAUAUGUUGGA--UGAUGGAGU
|| :|:|::|:| | ||||||
tAC-GTGCGGCTTCGCCGACCTCA
11.678NO
8hsa-let-7a28392859-10.8129
uugauAUGUUGGAUGAUGGAGU
||||| | :|||| |||
catatTACAAGC-GCTACATCA
11.678NO
9hsa-let-7a35683591-12128
uugAUAUG--UUGGAUGAUGGAGu
|||:| :||: ||||| |
gggTATGCTGGACTGTCTACCACg
11.678NO
10hsa-let-7a79978016-10.4128
UUGAUAUGUUGGAUGAUGG-AGU
| | ||| :|| |||||| |||
ACCAATA-GAC--ACTACCATCA
11.678NO
11hsa-let-7a84108433-10.5128
uugauaUGUUG--GAUGAUGGAGU
| ||| | :||||| ||
ggggggAAAACTGCGGCTACCGCA
11.678NO
12hsa-let-7a84638493-13.8128
UUGAUA----UGU-----UGGAUGAUGGAGU
|:||:| ||| ||:|:|||| |||
AGCTGTGGTAACACCCTCACTTGCTACATCA
11.678NO
13hsa-let-7a73527373-14.5127
UUGAUAUGUUGGAUGAUGGAgu
| | | | |:|||||:|||
ATCAACCCTATCTACTGCCTtg
11.678NO
14hsa-let-7a43724394-13127
uugauauGUUG-GAUGAUGGAGu
|: | ||:||||| |
ttgtgctCGCCACTGCTACCCCt
11.678NO
15hsa-let-7a23952418-11.6126
uugauauGUUGGA-U-GAUGGAGu
|::||| | | |||||
tgtccacCGGCCTCATCCACCTCc
11.678NO
16hsa-let-7a64106432-14.6125
uUGAUAUGU-UGGAUGAUGGAGu
|:|||:|| ||: :||:|| |
cATTATGCACACTCGCTGCCACt
11.678NO
17hsa-let-7a63346355-13124
UUGA-UAUGUUGGAUGAUGGAgu
|:|| ||:| | | |||:|||
AGCTCATGCCA-CAACTGCCTgg
11.678NO
18hsa-let-7a17911813-11.59124
uuGAU-AUGUUGGAUGAU-GGAGu
||| |:| : | |||| ||||
ccCTACTGCTGGC-ACTACCCTCc
11.678NO
19hsa-let-7a494517-13.8122
uUGAUAUGUUGG--A-UGAUGGAGu
||| | |:| | | :| |||||
gACT-TCCGAGCGGTCGCAACCTCg
11.678NO
20hsa-let-7b89578983-19.6163
uuGGUGUGUUG--GAU---GAUGGAGu
|||:| ||| ||: |||||||
ctCCATAGAACCACTGGATCTACCTCc
11.726NO
21hsa-let-7b93389363-15.9147
uuGGUGU----GUUGGAUGAUGGAGu
|::|| :|: | |||||||
cgCTGCAGGGGTAGGCATCTACCTCc
11.726NO
22hsa-let-7b45784599-21.4144
UUGGUGUGUUGGAUGAUGGAGu
||: |::::||||||||| |
AATGCCGTGGCCTACTACCGCg
11.726NO
23hsa-let-7b23962418-19.1140
uuGGUGUGUUGGA-U-GAUGGAGu
|||| |::||| | | |||||
gtCCAC-CGGCCTCATCCACCTCc
11.726NO
24hsa-let-7b87338754-18.5140
uuggUGUGUUGGAUGAUGGAGU
| | :::|||||||||:|
ggaaAGAGGGTCTACTACCTTA
11.726NO
25hsa-let-7b73517373-18138
UUGG-UGUGUUGGAUGAUGGAgu
||:| || | |:|||||:|||
AATCAACCCTATCTACTGCCTtg
11.726NO
26hsa-let-7b72727294-12.7136
uuGGUG-UGUUGGAUGAUGGAGu
|||: :| :|| :||||| |
gtCCATGGCTGCCCGCTACCACc
11.726NO
27hsa-let-7b84728493-15.1136
UUG-GUGUGUUGGAUGAUGGAGU
||| | | | ||:|:|||| |||
AACACCCTC-ACTTGCTACATCA
11.726NO
28hsa-let-7b79968016-14.7135
uUGGUGUGUUGGAUGAUGG-AGU
|||| |:|: | |||||| |||
cACCA-ATAGAC-ACTACCATCA
11.726NO
29hsa-let-7b43744394-13.6134
uugGUGUGUUGGAUGAUGGAGu
| |:| | ||:||||| |
gtgCTCGCCA-CTGCTACCCCt
11.726NO
30hsa-let-7b47634790-19.8132
UUGGUGUGUUGG------AUGAUGGAGu
||||||:| || |:||::|||
AACCACGCTCCCCCAGGATGCTGTCTCc
11.726NO
31hsa-let-7b47264751-15.6130
uugguguGUUGGA--U--GAUGGAgu
||:||| | ||||||
tcgatttCAGCCTTGACCCTACCTtt
11.726NO
32hsa-let-7b497517-18.5129
uuGGUGUGUUGGAUGAUGGAGu
||: :|:::| :| |||||
ttCCGAGCGGTC-GCAACCTCg
11.726NO
33hsa-let-7b26232649-19.6129
uugGUGUGUUGG-----AUGAUGGAGu
|:|||:::| | || ||||
ggaCGCACGGTCTTGTGTCCTTCCTCg
11.726NO
34hsa-let-7b58055825-12.8129
uuGGUGUGUUGGAUGAUGGAGu
|| |: :|| :||||| |
gcCCCCGGTGCC-GCTACCGCc
11.726NO
35hsa-let-7b718741-18.3129
uugGUGUGUUGGA--UGAUGGAGU
|:::|::|:| | ||||||
ttaCGTGCGGCTTCGCCGACCTCA
11.726NO
36hsa-let-7b28362859-14.3129
uuGGU---GUGUUGGAUGAUGGAGU
||| :|||| | :|||| |||
cgCCATATTACAAGC-GCTACATCA
11.726NO
37hsa-let-7b17861813-15.09128
UUGGUGUGUUG--GA---UGAU-GGAGu
||| | | || || |||| ||||
AACGCCCCTACTGCTGGCACTACCCTCc
11.726NO
38hsa-let-7b30573078-10.7128
uugGUGUGUUGGAUGAUGGAGu
| :| |::| ||||:||
ttgCTTAAAGTCCCCTACTTCg
11.726NO
39hsa-let-7b84108433-10.5128
uuggugUGUUG--GAUGAUGGAGU
| ||| | :||||| ||
ggggggAAAACTGCGGCTACCGCA
11.726NO
40hsa-let-7b18951922-18.54126
uUGG-UGU---G-UUG-GAUGAUGGAgu
||| ||| | ::| | ||||||
gACCGACAGGTCGGGCGCGCCTACCTac
11.726NO
41hsa-let-7b338364-19126
uUGGU----GUG-UUGGAUGA--UGGAGU
|||| ||| ||:| || ||||||
cACCATGAGCACGAATC--CTAAACCTCA
11.726NO
42hsa-let-7b20672088-12.8125
UUGGUGUGUUGGAU--GAUGGAGU
||| |||| |:|: ||:|| ||
AACAACAC--CTTGCTCTGCCCCA
11.726NO
43hsa-let-7b21532178-15.7124
UUGGU----GUGUUGGAUGAUGGagu
| ||| ||::::| ||||||
ACCCAGGTGCATGGTCGACTACCcgt
11.726NO
44hsa-let-7b63336355-13.9124
UUGGUGUGUUG-GAUGAUGGAgu
|| | ||:: | | |||:|||
AAGCTCATGCCACAACTGCCTgg
11.726NO
45hsa-let-7b91559177-13.4124
uuGGUGUGU-UGGAUGAUGGAGu
|||:|:: : | | ||||||
tgCCATATGTGGCAAGTACCTCt
11.726NO
46hsa-let-7b61766195-15.9123
uuGGUGUGUUGGAUGAUGGAGU
|||:|| :| :| :|||||
tgCCATAC--TCAGCAGCCTCA
11.726NO
47hsa-let-7b35213542-17.7122
uUGGUGUGUUGGAUGAUGGagu
|:|:::: | ||:|||||
gATCGTGTCAACTGCTACCcaa
11.726NO
48hsa-let-7b57445766-14.1122
UUGGUG--UG--UUGGAUGAUGGAGu
|||||| :| |||| || ||||
AACCACTGGCCAAACC--CT-CCTCt
11.726NO
49hsa-let-7b89408960-24122
UUGGUGUGUUGGAUGAUGGAGu
| |:||: |:|||:||| |||
ATCTACGGAGCCTGCTA-CTCc
11.726NO
50hsa-let-7c89578983-19.6167
uuGGUAUGUUG--GAU---GAUGGAGu
||||| ||| ||: |||||||
ctCCATAGAACCACTGGATCTACCTCc
11.774NO
let-7a
Target on hcv wildtype 
Binding site 8955-8983
mfe : -13.9
Hybrid sequence
uUGA--UAUGUUG--GAU---GAUGGAGu
tACTCCATAGAACCACTGGATCTACCTCc let-7a
Target on hcv wildtype 
Binding site 9342-9363
mfe : -10.7
Hybrid sequence
uugauaugUUGGAUGAUGGAGu
gcaggggtAGGCATCTACCTCc let-7a
Target on hcv wildtype 
Binding site 4575-4599
mfe : -17.7
Hybrid sequence
UUGAUAUG---UUGGAUGAUGGAGu
ATCAATGCCGTGGCCTACTACCGCg let-7a
Target on hcv wildtype 
Binding site 8733-8754
mfe : -18.2
Hybrid sequence
uugaUAUGUUGGAUGAUGGAGU
ggaaAGAGGGTCTACTACCTTA let-7a
Target on hcv wildtype 
Binding site 4726-4751
mfe : -14.4
Hybrid sequence
uugauAUGUUGGA--U--GAUGGAgu
tcgatTTCAGCCTTGACCCTACCTtt let-7a
Target on hcv wildtype 
Binding site 3058-3078
mfe : -11.6
Hybrid sequence
uuGAUAUGUUGGAUGAUGGAGu
tgCT-TAAAGTCCCCTACTTCg let-7a
Target on hcv wildtype 
Binding site 719-741
mfe : -16.6
Hybrid sequence
uUGAUAUGUUGGA--UGAUGGAGU
tAC-GTGCGGCTTCGCCGACCTCA let-7a
Target on hcv wildtype 
Binding site 2839-2859
mfe : -10.8
Hybrid sequence
uugauAUGUUGGAUGAUGGAGU
catatTACAAGC-GCTACATCA let-7a
Target on hcv wildtype 
Binding site 3568-3591
mfe : -12
Hybrid sequence
uugAUAUG--UUGGAUGAUGGAGu
gggTATGCTGGACTGTCTACCACg let-7a
Target on hcv wildtype 
Binding site 7997-8016
mfe : -10.4
Hybrid sequence
UUGAUAUGUUGGAUGAUGG-AGU
ACCAATA-GAC--ACTACCATCA let-7a
Target on hcv wildtype 
Binding site 8410-8433
mfe : -10.5
Hybrid sequence
uugauaUGUUG--GAUGAUGGAGU
ggggggAAAACTGCGGCTACCGCA let-7a
Target on hcv wildtype 
Binding site 8463-8493
mfe : -13.8
Hybrid sequence
UUGAUA----UGU-----UGGAUGAUGGAGU
AGCTGTGGTAACACCCTCACTTGCTACATCA let-7a
Target on hcv wildtype 
Binding site 7352-7373
mfe : -14.5
Hybrid sequence
UUGAUAUGUUGGAUGAUGGAgu
ATCAACCCTATCTACTGCCTtg let-7a
Target on hcv wildtype 
Binding site 4372-4394
mfe : -13
Hybrid sequence
uugauauGUUG-GAUGAUGGAGu
ttgtgctCGCCACTGCTACCCCt let-7a
Target on hcv wildtype 
Binding site 2395-2418
mfe : -11.6
Hybrid sequence
uugauauGUUGGA-U-GAUGGAGu
tgtccacCGGCCTCATCCACCTCc let-7a
Target on hcv wildtype 
Binding site 6410-6432
mfe : -14.6
Hybrid sequence
uUGAUAUGU-UGGAUGAUGGAGu
cATTATGCACACTCGCTGCCACt let-7a
Target on hcv wildtype 
Binding site 6334-6355
mfe : -13
Hybrid sequence
UUGA-UAUGUUGGAUGAUGGAgu
AGCTCATGCCA-CAACTGCCTgg let-7a
Target on hcv wildtype 
Binding site 1791-1813
mfe : -11.59
Hybrid sequence
uuGAU-AUGUUGGAUGAU-GGAGu
ccCTACTGCTGGC-ACTACCCTCc let-7a
Target on hcv wildtype 
Binding site 494-517
mfe : -13.8
Hybrid sequence
uUGAUAUGUUGG--A-UGAUGGAGu
gACT-TCCGAGCGGTCGCAACCTCg let-7b
Target on hcv wildtype 
Binding site 8957-8983
mfe : -19.6
Hybrid sequence
uuGGUGUGUUG--GAU---GAUGGAGu
ctCCATAGAACCACTGGATCTACCTCc let-7b
Target on hcv wildtype 
Binding site 9338-9363
mfe : -15.9
Hybrid sequence
uuGGUGU----GUUGGAUGAUGGAGu
cgCTGCAGGGGTAGGCATCTACCTCc let-7b
Target on hcv wildtype 
Binding site 4578-4599
mfe : -21.4
Hybrid sequence
UUGGUGUGUUGGAUGAUGGAGu
AATGCCGTGGCCTACTACCGCg let-7b
Target on hcv wildtype 
Binding site 2396-2418
mfe : -19.1
Hybrid sequence
uuGGUGUGUUGGA-U-GAUGGAGu
gtCCAC-CGGCCTCATCCACCTCc let-7b
Target on hcv wildtype 
Binding site 8733-8754
mfe : -18.5
Hybrid sequence
uuggUGUGUUGGAUGAUGGAGU
ggaaAGAGGGTCTACTACCTTA let-7b
Target on hcv wildtype 
Binding site 7351-7373
mfe : -18
Hybrid sequence
UUGG-UGUGUUGGAUGAUGGAgu
AATCAACCCTATCTACTGCCTtg let-7b
Target on hcv wildtype 
Binding site 7272-7294
mfe : -12.7
Hybrid sequence
uuGGUG-UGUUGGAUGAUGGAGu
gtCCATGGCTGCCCGCTACCACc let-7b
Target on hcv wildtype 
Binding site 8472-8493
mfe : -15.1
Hybrid sequence
UUG-GUGUGUUGGAUGAUGGAGU
AACACCCTC-ACTTGCTACATCA let-7b
Target on hcv wildtype 
Binding site 7996-8016
mfe : -14.7
Hybrid sequence
uUGGUGUGUUGGAUGAUGG-AGU
cACCA-ATAGAC-ACTACCATCA let-7b
Target on hcv wildtype 
Binding site 4374-4394
mfe : -13.6
Hybrid sequence
uugGUGUGUUGGAUGAUGGAGu
gtgCTCGCCA-CTGCTACCCCt let-7b
Target on hcv wildtype 
Binding site 4763-4790
mfe : -19.8
Hybrid sequence
UUGGUGUGUUGG------AUGAUGGAGu
AACCACGCTCCCCCAGGATGCTGTCTCc let-7b
Target on hcv wildtype 
Binding site 4726-4751
mfe : -15.6
Hybrid sequence
uugguguGUUGGA--U--GAUGGAgu
tcgatttCAGCCTTGACCCTACCTtt let-7b
Target on hcv wildtype 
Binding site 497-517
mfe : -18.5
Hybrid sequence
uuGGUGUGUUGGAUGAUGGAGu
ttCCGAGCGGTC-GCAACCTCg let-7b
Target on hcv wildtype 
Binding site 2623-2649
mfe : -19.6
Hybrid sequence
uugGUGUGUUGG-----AUGAUGGAGu
ggaCGCACGGTCTTGTGTCCTTCCTCg let-7b
Target on hcv wildtype 
Binding site 5805-5825
mfe : -12.8
Hybrid sequence
uuGGUGUGUUGGAUGAUGGAGu
gcCCCCGGTGCC-GCTACCGCc let-7b
Target on hcv wildtype 
Binding site 718-741
mfe : -18.3
Hybrid sequence
uugGUGUGUUGGA--UGAUGGAGU
ttaCGTGCGGCTTCGCCGACCTCA let-7b
Target on hcv wildtype 
Binding site 2836-2859
mfe : -14.3
Hybrid sequence
uuGGU---GUGUUGGAUGAUGGAGU
cgCCATATTACAAGC-GCTACATCA let-7b
Target on hcv wildtype 
Binding site 1786-1813
mfe : -15.09
Hybrid sequence
UUGGUGUGUUG--GA---UGAU-GGAGu
AACGCCCCTACTGCTGGCACTACCCTCc let-7b
Target on hcv wildtype 
Binding site 3057-3078
mfe : -10.7
Hybrid sequence
uugGUGUGUUGGAUGAUGGAGu
ttgCTTAAAGTCCCCTACTTCg let-7b
Target on hcv wildtype 
Binding site 8410-8433
mfe : -10.5
Hybrid sequence
uuggugUGUUG--GAUGAUGGAGU
ggggggAAAACTGCGGCTACCGCA let-7b
Target on hcv wildtype 
Binding site 1895-1922
mfe : -18.54
Hybrid sequence
uUGG-UGU---G-UUG-GAUGAUGGAgu
gACCGACAGGTCGGGCGCGCCTACCTac let-7b
Target on hcv wildtype 
Binding site 338-364
mfe : -19
Hybrid sequence
uUGGU----GUG-UUGGAUGA--UGGAGU
cACCATGAGCACGAATC--CTAAACCTCA let-7b
Target on hcv wildtype 
Binding site 2067-2088
mfe : -12.8
Hybrid sequence
UUGGUGUGUUGGAU--GAUGGAGU
AACAACAC--CTTGCTCTGCCCCA let-7b
Target on hcv wildtype 
Binding site 2153-2178
mfe : -15.7
Hybrid sequence
UUGGU----GUGUUGGAUGAUGGagu
ACCCAGGTGCATGGTCGACTACCcgt let-7b
Target on hcv wildtype 
Binding site 6333-6355
mfe : -13.9
Hybrid sequence
UUGGUGUGUUG-GAUGAUGGAgu
AAGCTCATGCCACAACTGCCTgg let-7b
Target on hcv wildtype 
Binding site 9155-9177
mfe : -13.4
Hybrid sequence
uuGGUGUGU-UGGAUGAUGGAGu
tgCCATATGTGGCAAGTACCTCt let-7b
Target on hcv wildtype 
Binding site 6176-6195
mfe : -15.9
Hybrid sequence
uuGGUGUGUUGGAUGAUGGAGU
tgCCATAC--TCAGCAGCCTCA let-7b
Target on hcv wildtype 
Binding site 3521-3542
mfe : -17.7
Hybrid sequence
uUGGUGUGUUGGAUGAUGGagu
gATCGTGTCAACTGCTACCcaa let-7b
Target on hcv wildtype 
Binding site 5744-5766
mfe : -14.1
Hybrid sequence
UUGGUG--UG--UUGGAUGAUGGAGu
AACCACTGGCCAAACC--CT-CCTCt let-7b
Target on hcv wildtype 
Binding site 8940-8960
mfe : -24
Hybrid sequence
UUGGUGUGUUGGAUGAUGGAGu
ATCTACGGAGCCTGCTA-CTCc let-7c
Target on hcv wildtype 
Binding site 8957-8983
mfe : -19.6
Hybrid sequence
uuGGUAUGUUG--GAU---GAUGGAGu
ctCCATAGAACCACTGGATCTACCTCc