Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HDV target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
 Browse    HDV RNA genome   HDVJS   
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 707 rescords (15 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7b12031226-11.6140
UUGGUGUGUU---GGAUGAUGGAGu
|||| | :|| ||| || ||||
AACCTCCTAAGTTCCT-CTTCCTCc
11.726NO
2hsa-let-7b12871308-10.3129
uugguguguuggAUGAUGGAGu
| ||:||||
cttcgtcggtgaTCCTGCCTCt
11.726NO
3hsa-let-7b599620-13.2121
uuGGUGUGUUGGAUGAUGGAGu
||:| ||| || || || |
ttCCGCCCAAGCTCCTTCCCCc
11.726NO
4hsa-let-7c12031226-10.9131
UUGGUAUGUU---GGAUGAUGGAGu
|||| :|| ||| || ||||
AACCTCCTAAGTTCCT-CTTCCTCc
11.774NO
5hsa-let-7c12871308-11.4129
uugguauguuggAUGAUGGAGu
| ||:||||
cttcgtcggtgaTCCTGCCTCt
11.774NO
6hsa-let-7c13411364-12.5123
uuGGUAUGUUGGAU---GAUGGAGu
|| || : || : ||||:||
ttCC-TAGGTCCGGAGTCTACTTCc
11.774NO
7hsa-let-7d12901308-12.5138
ugauaCGUUGGAUGAUGGAGA
|::|:| ||:|||||
cgtcgGTGATC--CTGCCTCT
7.888NO
8hsa-let-7d12081226-10.8130
uGAUACGUUGGAUGAUGGAGa
||| |: ||| || ||||
cCTAAGT-TCCT-CTTCCTCc
7.888NO
9hsa-let-7d13431364-10.4124
uGAUACGUUGGAU---GAUGGAGa
||| |: || : ||||:||
cCTAGGT--CCGGAGTCTACTTCc
7.888NO
10hsa-let-7e12881308-15.1138
ugauauguuggAGGAUGGAGu
||||:||||
ttcgtcggtgaTCCTGCCTCt
6.037NO
11hsa-let-7e11861209-13.14127
uGAUAUGUUGGAG---GAUGGAGu
|| | |||| | |||||
tCTCGTCTTCCTCGGTCAACCTCc
6.037NO
12hsa-let-7e13431364-10.8121
uGAU--AUGUUGGAGGAUGGAGu
||| | |:: | ||||:||
cCTAGGTCCGGAGT-CTACTTCc
6.037NO
13hsa-let-7f13421364-10.1121
uuGAU--AUGUUAGAUGAUGGAGu
||| | |:: | ||||:||
tcCTAGGTCCGGAGT-CTACTTCc
10.092NO
14hsa-let-7g13451364-10.2130
ugaCAUGUUUGAUGAUGGAGu
|| |::| | ||||:||
tagGTCCGGAGT-CTACTTCc
9.988NO
15hsa-miR-1717737-11.3136
auguaugaagaaaUGUAAGGu
|||||||
cgccggctgggcaACATTCCg
5.340NO
16hsa-miR-114781498-12.4135
aUGUAUGAAGAAAUGUAAGGu
|: | |||||| || ||||
gATTTTCTTCTTAACCTTCCg
5.340NO
17hsa-miR-10011451165-12.33122
GUGUUCAAGCCUAGAUGCCCaa
||| | | | ||:||||
CAC-ACCCCCAACCTGCGGGcc
9.137NO
18hsa-miR-10312401263-14.7133
AGUAUCGGGACAUGUUA-CGACGA
|| | ||| |:|| ||||||
TCTTTCCCCCCGCCGATAGCTGCT
9.493NO
19hsa-miR-10310761096-11.5131
aguaUCGGGACAUGUUACGACga
| :||| |:| ||||||
cgggACTCCT-TGC-ATGCTGgg
9.493NO
20hsa-miR-103573593-12.7128
aguaUCGGGACAUGUUACGACGA
|||| || :||||| ||
gtggAGCCATG--GGATGCTCCT
9.493NO
21hsa-miR-1055579-13.7130
ugucCUCAG--A---CUCGUAAACU
||||| | ||||||| ||
gggtGAGTCGGTAAAGAGCATTGGA
5.000NO
22hsa-miR-10710761096-12.3134
aCUAUCGGGACAUGUUACGACga
|: | :||| |:| ||||||
cGGGACTCCT-TGC-ATGCTGgg
9.255NO
23hsa-miR-10712411263-14.7132
acuaucGGGACAUGUUA-CGACGA
||| | |:|| ||||||
ctttccCCCCG-CCGATAGCTGCT
9.255NO
24hsa-miR-107574593-12.7130
ACUAUCGGGACAUGUUACGACGA
||: |||| || :||||| ||
TGG-AGCCATG--GGATGCTCCT
9.255NO
25hsa-miR-10712761305-16121
aCUAUCG---GGA--CA--UGUUACGACGa
|| :|| ||| || :::|| ||||
cGAGGGCCTTCCTTCGTCGGTGATCCTGCc
9.255NO
26hsa-miR-10a632662-21.91148
GUGUUUA-AGCCU-------AGAUGUCCCAu
|| :||| |||: |||:||||||
CAGGAATGGCGGGACCCCACTCTGCAGGGTc
7.071NO
27hsa-miR-10a534-17.51121
guGUUUAAG-------CCUAGAUGUCCCau
|||:||| ||||: :|:|||
gcCAAGTTCCGAACAAGGATTCGCGGGGag
7.071NO
28hsa-miR-10b641662-16.4142
uguuuaagccaAGAUGUCCCAu
|||:||||||
cgggaccccacTCTGCAGGGTc
6.727NO
29hsa-miR-122a218246-16.6147
uGUUUG-UGGU---AAC--AGUGUGAGGu
| ::| :||| ||| |||||||
cCCGGCGGCCAAGTTTGGAGGACACTCCg
12.384NO
30hsa-miR-122a712737-18.8133
uGUUUGUGGU--AACAG-UGUGAGGu
| ::|:||: | | | |||:|||
gCTGGCGCCGGCTGGGCAACATTCCg
12.384NO
31hsa-miR-122a11241153-19.94132
uguuuGUGGUAAC-------AGUGUGAGGu
|||| | | |||||| ||
cgttcCACCTTCGAGGGGGTTCACACCCCc
12.384NO
32hsa-miR-122a7699-15.2129
uguUUGUGGUAACAGUG-UGAGGu
|||::|: | :|| |||||
tggAACGTCGGAGATACAACTCCc
12.384NO
33hsa-miR-122a501521-10.9125
uguuuGUGGUAACAGUGUGAGGu
|| ||| | || |||||
gtcccCA-CATAG-CAGACTCCc
12.384NO
34hsa-miR-122a10981121-13.7124
UGUUU--GUGGUAACAGUGUGAGGu
||:|| |:|| | :|:||||
ACGAAGCCGCCCCCG-GGCGCTCCc
12.384NO
35hsa-miR-125a10511080-19.5155
GUGUCCA-----AUUU--CCCAGAGUCCCU
| | ||| |||| ||| ||| ||||
CCCCGGTCCGAGTAAAGGGGGACTCCGGGA
10.086NO
36hsa-miR-125a630661-18.2137
GUGUCC-AAUUUCCC-------AGA-GUCCCu
| |||| |:: ||| ||| |||||
CCCAGGAATGGCGGGACCCCACTCTGCAGGGt
10.086NO
37hsa-miR-125a957979-14.57129
GUG-UCCAAUUUCCCAGAGUCCCu
||| :|| | :| ||| |||
CACTGGGGTCGA-CAACTCTGGGg
10.086NO
38hsa-miR-125a533-13.2128
guGUCCAA----U-UUCC-CAGAGUCCCU
|| ||| | |||| || |:||||
gcCAAGTTCCGAACAAGGATTCGCGGGGA
10.086NO
39hsa-miR-125a465488-14.7124
gUGUCCAAUUUCC---CAGAGUCCCU
||: || :||| || |:||||
gACGAGT--GAGGCTTATCCCGGGGA
10.086NO
40hsa-miR-125b10571080-19.8154
AGUGUUCAAU---CCCAGAGUCCCU
|| |:||| | ||| ||| ||||
TC-CGAGTAAAGGGGGACTCCGGGA
10.846NO
41hsa-miR-125b956979-16.8138
AGUGUUCAAUCCCA------GAGUCCCu
|||| |:|||| ||| |||
TCAC----TGGGGTCGACAACTCTGGGg
10.846NO
42hsa-miR-125b464488-19.5138
agUGUUCAAUCC---CAGAGUCCCU
||:||| ||| || |:||||
ggACGAGTGAGGCTTATCCCGGGGA
10.846NO
43hsa-miR-125b433-16.41129
aguGUUCAA-------UCC-CAGAGUCCCU
|||||| ||| || |:||||
agcCAAGTTCCGAACAAGGATTCGCGGGGA
10.846NO
44hsa-miR-125b639661-12.02124
aguguucaaucccAGA-GUCCCu
||| |||||
ggcgggaccccacTCTGCAGGGt
10.846NO
45hsa-miR-12610401061-11.1133
cguaauaauGA-GUGCCAUGCU
|| | |||| |||
gtccagtccCTCCCCGGTCCGA
10.720NO
46hsa-miR-127428-25.6169
UCGGUUCGAGUC-UG--CCUAGGCu
|||||||:|| | || ||||:||
AGCCAAGTTCCGAACAAGGATTCGc
5.000NO
47hsa-miR-127645665-18.2155
UCGGUUCGAGUCUGCCUAGGCu
| || | ||| | ||:||||
ACCCCA-CTCTGCAGGGTCCGc
5.000NO
48hsa-miR-12710561078-23.9143
ucGGUUCGAGUCUGCCU-AGGCu
||:||: ||: ||| ||||
gtCCGAGTAAAGGGGGACTCCGg
5.000NO
49hsa-miR-127224247-24.6142
uCGGUUCGAGUCUGCCU---AGGCu
||||||:|::|| ||| ||||
gGCCAAGTTTGGA-GGACACTCCGg
5.000NO
50hsa-miR-127194213-17.1141
UCGGUUC-GAGUCUGCCUAGGCU
|| |::| ||| | |||||||
AGGCGGGCCTC---CCGATCCGA
5.000NO
let-7b
Target on HDV 
Binding site 1203-1226
mfe : -11.6
Hybrid sequence
UUGGUGUGUU---GGAUGAUGGAGu
AACCTCCTAAGTTCCT-CTTCCTCc let-7b
Target on HDV 
Binding site 1287-1308
mfe : -10.3
Hybrid sequence
uugguguguuggAUGAUGGAGu
cttcgtcggtgaTCCTGCCTCt let-7b
Target on HDV 
Binding site 599-620
mfe : -13.2
Hybrid sequence
uuGGUGUGUUGGAUGAUGGAGu
ttCCGCCCAAGCTCCTTCCCCc let-7c
Target on HDV 
Binding site 1203-1226
mfe : -10.9
Hybrid sequence
UUGGUAUGUU---GGAUGAUGGAGu
AACCTCCTAAGTTCCT-CTTCCTCc let-7c
Target on HDV 
Binding site 1287-1308
mfe : -11.4
Hybrid sequence
uugguauguuggAUGAUGGAGu
cttcgtcggtgaTCCTGCCTCt let-7c
Target on HDV 
Binding site 1341-1364
mfe : -12.5
Hybrid sequence
uuGGUAUGUUGGAU---GAUGGAGu
ttCC-TAGGTCCGGAGTCTACTTCc let-7d
Target on HDV 
Binding site 1290-1308
mfe : -12.5
Hybrid sequence
ugauaCGUUGGAUGAUGGAGA
cgtcgGTGATC--CTGCCTCT let-7d
Target on HDV 
Binding site 1208-1226
mfe : -10.8
Hybrid sequence
uGAUACGUUGGAUGAUGGAGa
cCTAAGT-TCCT-CTTCCTCc let-7d
Target on HDV 
Binding site 1343-1364
mfe : -10.4
Hybrid sequence
uGAUACGUUGGAU---GAUGGAGa
cCTAGGT--CCGGAGTCTACTTCc let-7e
Target on HDV 
Binding site 1288-1308
mfe : -15.1
Hybrid sequence
ugauauguuggAGGAUGGAGu
ttcgtcggtgaTCCTGCCTCt let-7e
Target on HDV 
Binding site 1186-1209
mfe : -13.14
Hybrid sequence
uGAUAUGUUGGAG---GAUGGAGu
tCTCGTCTTCCTCGGTCAACCTCc let-7e
Target on HDV 
Binding site 1343-1364
mfe : -10.8
Hybrid sequence
uGAU--AUGUUGGAGGAUGGAGu
cCTAGGTCCGGAGT-CTACTTCc let-7f
Target on HDV 
Binding site 1342-1364
mfe : -10.1
Hybrid sequence
uuGAU--AUGUUAGAUGAUGGAGu
tcCTAGGTCCGGAGT-CTACTTCc let-7g
Target on HDV 
Binding site 1345-1364
mfe : -10.2
Hybrid sequence
ugaCAUGUUUGAUGAUGGAGu
tagGTCCGGAGT-CTACTTCc miR-1
Target on HDV 
Binding site 717-737
mfe : -11.3
Hybrid sequence
auguaugaagaaaUGUAAGGu
cgccggctgggcaACATTCCg miR-1
Target on HDV 
Binding site 1478-1498
mfe : -12.4
Hybrid sequence
aUGUAUGAAGAAAUGUAAGGu
gATTTTCTTCTTAACCTTCCg miR-100
Target on HDV 
Binding site 1145-1165
mfe : -12.33
Hybrid sequence
GUGUUCAAGCCUAGAUGCCCaa
CAC-ACCCCCAACCTGCGGGcc miR-103
Target on HDV 
Binding site 1240-1263
mfe : -14.7
Hybrid sequence
AGUAUCGGGACAUGUUA-CGACGA
TCTTTCCCCCCGCCGATAGCTGCT miR-103
Target on HDV 
Binding site 1076-1096
mfe : -11.5
Hybrid sequence
aguaUCGGGACAUGUUACGACga
cgggACTCCT-TGC-ATGCTGgg miR-103
Target on HDV 
Binding site 573-593
mfe : -12.7
Hybrid sequence
aguaUCGGGACAUGUUACGACGA
gtggAGCCATG--GGATGCTCCT miR-105
Target on HDV 
Binding site 55-79
mfe : -13.7
Hybrid sequence
ugucCUCAG--A---CUCGUAAACU
gggtGAGTCGGTAAAGAGCATTGGA miR-107
Target on HDV 
Binding site 1076-1096
mfe : -12.3
Hybrid sequence
aCUAUCGGGACAUGUUACGACga
cGGGACTCCT-TGC-ATGCTGgg miR-107
Target on HDV 
Binding site 1241-1263
mfe : -14.7
Hybrid sequence
acuaucGGGACAUGUUA-CGACGA
ctttccCCCCG-CCGATAGCTGCT miR-107
Target on HDV 
Binding site 574-593
mfe : -12.7
Hybrid sequence
ACUAUCGGGACAUGUUACGACGA
TGG-AGCCATG--GGATGCTCCT miR-107
Target on HDV 
Binding site 1276-1305
mfe : -16
Hybrid sequence
aCUAUCG---GGA--CA--UGUUACGACGa
cGAGGGCCTTCCTTCGTCGGTGATCCTGCc miR-10a
Target on HDV 
Binding site 632-662
mfe : -21.91
Hybrid sequence
GUGUUUA-AGCCU-------AGAUGUCCCAu
CAGGAATGGCGGGACCCCACTCTGCAGGGTc miR-10a
Target on HDV 
Binding site 5-34
mfe : -17.51
Hybrid sequence
guGUUUAAG-------CCUAGAUGUCCCau
gcCAAGTTCCGAACAAGGATTCGCGGGGag miR-10b
Target on HDV 
Binding site 641-662
mfe : -16.4
Hybrid sequence
uguuuaagccaAGAUGUCCCAu
cgggaccccacTCTGCAGGGTc miR-122a
Target on HDV 
Binding site 218-246
mfe : -16.6
Hybrid sequence
uGUUUG-UGGU---AAC--AGUGUGAGGu
cCCGGCGGCCAAGTTTGGAGGACACTCCg miR-122a
Target on HDV 
Binding site 712-737
mfe : -18.8
Hybrid sequence
uGUUUGUGGU--AACAG-UGUGAGGu
gCTGGCGCCGGCTGGGCAACATTCCg miR-122a
Target on HDV 
Binding site 1124-1153
mfe : -19.94
Hybrid sequence
uguuuGUGGUAAC-------AGUGUGAGGu
cgttcCACCTTCGAGGGGGTTCACACCCCc miR-122a
Target on HDV 
Binding site 76-99
mfe : -15.2
Hybrid sequence
uguUUGUGGUAACAGUG-UGAGGu
tggAACGTCGGAGATACAACTCCc miR-122a
Target on HDV 
Binding site 501-521
mfe : -10.9
Hybrid sequence
uguuuGUGGUAACAGUGUGAGGu
gtcccCA-CATAG-CAGACTCCc miR-122a
Target on HDV 
Binding site 1098-1121
mfe : -13.7
Hybrid sequence
UGUUU--GUGGUAACAGUGUGAGGu
ACGAAGCCGCCCCCG-GGCGCTCCc miR-125a
Target on HDV 
Binding site 1051-1080
mfe : -19.5
Hybrid sequence
GUGUCCA-----AUUU--CCCAGAGUCCCU
CCCCGGTCCGAGTAAAGGGGGACTCCGGGA miR-125a
Target on HDV 
Binding site 630-661
mfe : -18.2
Hybrid sequence
GUGUCC-AAUUUCCC-------AGA-GUCCCu
CCCAGGAATGGCGGGACCCCACTCTGCAGGGt miR-125a
Target on HDV 
Binding site 957-979
mfe : -14.57
Hybrid sequence
GUG-UCCAAUUUCCCAGAGUCCCu
CACTGGGGTCGA-CAACTCTGGGg miR-125a
Target on HDV 
Binding site 5-33
mfe : -13.2
Hybrid sequence
guGUCCAA----U-UUCC-CAGAGUCCCU
gcCAAGTTCCGAACAAGGATTCGCGGGGA miR-125a
Target on HDV 
Binding site 465-488
mfe : -14.7
Hybrid sequence
gUGUCCAAUUUCC---CAGAGUCCCU
gACGAGT--GAGGCTTATCCCGGGGA miR-125b
Target on HDV 
Binding site 1057-1080
mfe : -19.8
Hybrid sequence
AGUGUUCAAU---CCCAGAGUCCCU
TC-CGAGTAAAGGGGGACTCCGGGA miR-125b
Target on HDV 
Binding site 956-979
mfe : -16.8
Hybrid sequence
AGUGUUCAAUCCCA------GAGUCCCu
TCAC----TGGGGTCGACAACTCTGGGg miR-125b
Target on HDV 
Binding site 464-488
mfe : -19.5
Hybrid sequence
agUGUUCAAUCC---CAGAGUCCCU
ggACGAGTGAGGCTTATCCCGGGGA miR-125b
Target on HDV 
Binding site 4-33
mfe : -16.41
Hybrid sequence
aguGUUCAA-------UCC-CAGAGUCCCU
agcCAAGTTCCGAACAAGGATTCGCGGGGA miR-125b
Target on HDV 
Binding site 639-661
mfe : -12.02
Hybrid sequence
aguguucaaucccAGA-GUCCCu
ggcgggaccccacTCTGCAGGGt miR-126
Target on HDV 
Binding site 1040-1061
mfe : -11.1
Hybrid sequence
cguaauaauGA-GUGCCAUGCU
gtccagtccCTCCCCGGTCCGA miR-127
Target on HDV 
Binding site 4-28
mfe : -25.6
Hybrid sequence
UCGGUUCGAGUC-UG--CCUAGGCu
AGCCAAGTTCCGAACAAGGATTCGc miR-127
Target on HDV 
Binding site 645-665
mfe : -18.2
Hybrid sequence
UCGGUUCGAGUCUGCCUAGGCu
ACCCCA-CTCTGCAGGGTCCGc miR-127
Target on HDV 
Binding site 1056-1078
mfe : -23.9
Hybrid sequence
ucGGUUCGAGUCUGCCU-AGGCu
gtCCGAGTAAAGGGGGACTCCGg miR-127
Target on HDV 
Binding site 224-247
mfe : -24.6
Hybrid sequence
uCGGUUCGAGUCUGCCU---AGGCu
gGCCAAGTTTGGA-GGACACTCCGg miR-127
Target on HDV 
Binding site 194-213
mfe : -17.1
Hybrid sequence
UCGGUUC-GAGUCUGCCUAGGCU
AGGCGGGCCTC---CCGATCCGA