Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HEV target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
 Browse   Structural and nonstructural protein mRNA, complete cds   Complete cds   mexican strain) structural proteins and a nonstructural polyprotein genes, complete cds   nonstructural polyprotein and putative capsid protein genes, complete cds   
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 3298 rescords (66 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7a42724295-17.9144
uuGAUAUG--UUGGAUGAUGGAGU
|||| | : |||:|| |||||
ggCTATCCTGGCCCTGCTCCCTCA
11.678NO
2hsa-let-7a11131138-15.2141
UUGAUA----UGUUGGAUGAUGGAGU
|:||:| || :|| ||||||:|
AGCTGTCATCACTGCCGCCTACCTTA
11.678NO
3hsa-let-7a53965416-15.1139
uugauauGUUGGAUGAUGGAGU
| :|| :||:|||||
cagcgccCCGCC-GCTGCCTCA
11.678NO
4hsa-let-7a138161-15.2136
uugAUAUGUUGGAU---GAUGGAGu
||| :|||||| | |||||
cctTAT-TAACCTAATGCAACCTCg
11.678NO
5hsa-let-7a22382259-13.9136
uugauauguuGGAUGAUGGAGu
|||||| ||||
ggatccttccCCTACTCCCTCt
11.678NO
6hsa-let-7a24762502-13.3136
uUGAUAUGUUGG-----AUGAUGGAGu
|| :|| || |:||:||||
tACCCCGCATCCTTTGATGCTGCCTCt
11.678NO
7hsa-let-7a55325557-13.3136
UUGAUA--UGU--UGGAUGAUGGAGu
| |||| ||| || :||||||
ACCTATCAACATCTCCCCTTACCTCt
11.678NO
8hsa-let-7a56875708-11.3135
uugauAUGUUGGAUGAUGGAGu
|||||:: :||||| |
cgtgcTACAATTCGCTACCGCc
11.678NO
9hsa-let-7a557580-12.5133
uuGAUAUGU--UGGAUGAUGGAGu
|| |||: :|| | |||||
ggCTTTACGCTGCCCTCCACCTCc
11.678NO
10hsa-let-7a306328-11.1132
uugauAUGUUG-GAUGAUGGAGu
| || | ||:|| ||||
tgtggTCCACCGCTGCTTCCTCc
11.678NO
11hsa-let-7a60366056-12.2131
UUGAUAUGUUGGAUGAUGGAGU
|||| |: : :| :| ||||||
AACT-TGAGTTCCGCAACCTCA
11.678NO
12hsa-let-7a37973823-13.8130
UUG-AUAUGU--UGGA--UGAUGGAgu
|:| |: ||| :||| ||||||
AGCTTGAACAGGGCCTTCTCTACCTgc
11.678NO
13hsa-let-7a10091036-11.5130
uuGAU-AUGUUGGAU-----GAUGGAGu
||: | | :|||| :||||||
tgCTGCTCCCGCCTAATGACTTACCTCc
11.678NO
14hsa-let-7a897918-12.2128
uugauauGUUGGAUGAUGGAGU
| |::| | ||||||
cccctccCTATTTCCAACCTCA
11.678NO
15hsa-let-7a37653788-13.2127
uuGAUA-UGUUGG-AUGAUGGAGu
||:| :|::|: | ||||| |
ccCTGTCGCGGCTGTTCTACCGCc
11.678NO
16hsa-let-7a34263447-10.1125
uugauaUGUUGGAUGAUGGAgu
|||: :||||||
tgaggcACAGGGCGCTACCTac
11.678NO
17hsa-let-7a355375-14.2124
uugAUAUGUUGGAUGAUGGagu
||||| :|| |||||
tggTATACTGCC-CCTACCcgc
11.678NO
18hsa-let-7a423445-17.2124
uuGAUAUGU-UGGAUGAUGGAGu
||: |: ||:||||:|:||
tgCTGACCGCACTTACTGCTTCg
11.678NO
19hsa-let-7a22082228-11.9124
uugauauguuGGAUGAUGGAGu
||| ||||| |
cccggcggccCCT-CTACCCCc
11.678NO
20hsa-let-7a61436166-14.7121
uugauaUGUUG--GAUGAUGGagu
|| || ||:|||||
ctcaccACCACGGCTGCTACCcgc
11.678NO
21hsa-let-7a69536974-10.2121
uugaUAUGUUGGAUGAUGGagu
|||| |: ||||||
gaggATACCATGGACTACCctg
11.678NO
22hsa-let-7a15921615-11.1121
uuGAUAUG--UUGGAUGA--UGGAGu
|| ||| |:|| || |||||
cgCTTTACCAAGCC--CTTGACCTCc
11.678NO
23hsa-let-7a62956318-12.5121
uugauauGUUGG-AUGAUG-GAGu
||:|: | |||| |||
tggtggcCAGCTGTTCTACTCTCg
11.678NO
24hsa-let-7b24762502-20.4154
uUGGUGUGUUGG-----AUGAUGGAGu
||| |:|| || |:||:||||
tACCCCGCATCCTTTGATGCTGCCTCt
11.726NO
25hsa-let-7b53965416-18.8149
uUGGUGUGUUGGAUGAUGGAGU
| |:| | :|| :||:|||||
cAGCGCCCCGCC-GCTGCCTCA
11.726NO
26hsa-let-7b11161138-18145
uugGU-GUGUUGGAUGAUGGAGU
|| ||| :|| ||||||:|
tgtCATCACTGCCGCCTACCTTA
11.726NO
27hsa-let-7b64026422-18141
uuGGUGUGUUGGAUGAUGGAGu
||:||::|| | | |||||
tcCCGCATGACAT-CGACCTCg
11.726NO
28hsa-let-7b897918-13.5140
uuGGUGUGUUGGAUGAUGGAGU
|| | | |::| | ||||||
ccCCTCCCTATTTCCAACCTCA
11.726NO
29hsa-let-7b22402259-14.8139
UUGGUGUGUUGGAUGAUGGAGu
| || : | |||||| ||||
ATCCTTCC--CCTACTCCCTCt
11.726NO
30hsa-let-7b42764295-16.3139
UUGGUGUGUUGGAUGAUGGAGU
| || :| |||:|| |||||
ATCCTGGC--CCTGCTCCCTCA
11.726NO
31hsa-let-7b136161-16.5138
UUGGUGU-GUUGGAU---GAUGGAGu
| || :| :|||||| | |||||
ATCCTTATTAACCTAATGCAACCTCg
11.726NO
32hsa-let-7b55365557-14.8138
UUGGUGUGUUGGAUGAUGGAGu
| | |||: || :||||||
ATCAACATCTCCCCTTACCTCt
11.726NO
33hsa-let-7b310328-16.4136
uuGGUGUGUUGGAUGAUGGAGu
|||| |: ||:|| ||||
gtCCAC-CG--CTGCTTCCTCc
11.726NO
34hsa-let-7b559580-14.4135
uuggUGUGUUGGAUGAUGGAGu
||:| :|| | |||||
ctttACGCTGCCCTCCACCTCc
11.726NO
35hsa-let-7b61456166-22.7134
uUGGU-GUGUUGGAUGAUGGagu
|||| |||:: ||:|||||
cACCACCACGG-CTGCTACCcgc
11.726NO
36hsa-let-7b34283447-14.9134
UUGGUGUGUUGGAUGAUGGAgu
|: |||| ::| :||||||
AGGCACAGGGC--GCTACCTac
11.726NO
37hsa-let-7b38003823-17134
uuggUGUGUUGGA--UGAUGGAgu
||| ::||| ||||||
ttgaACAGGGCCTTCTCTACCTgc
11.726NO
38hsa-let-7b10151036-14.4134
uuGGUGUGUUGGAUGAUGGAGu
||:| :||: :||||||
tcCCGCCTAATGACTTACCTCc
11.726NO
39hsa-let-7b55955619-12.5133
uuGGUGUGUUG---GAUGAUGGAGu
|| | :|:| || ||||| |
ctCCTCTTAGCCCGCTTCTACCCCt
11.726NO
40hsa-let-7b427445-21.9132
uUGGUGUGUUGGAUGAUGGAGu
|||:| ||:||||:|:||
gACCGC---ACTTACTGCTTCg
11.726NO
41hsa-let-7b22052228-15.2131
uUGGUG-UGUU-GGAUGAUGGAGu
||| | :|:: || ||||| |
tACCCCGGCGGCCCCTCTACCCCc
11.726NO
42hsa-let-7b56875708-13.1131
uuggugUGUUGGAUGAUGGAGu
||||:: :||||| |
cgtgctACAATTCGCTACCGCc
11.726NO
43hsa-let-7b11371162-16.4130
uUGGU--GUGUUGGAUG--AUGGAGu
|||| ::| ||| :| ||||||
tACCATCTGCCACCAGCGGTACCTCc
11.726NO
44hsa-let-7b15891615-14.6129
UUGGUGUGUUGGAU---GA--UGGAGu
||||:| : ||| | || |||||
AACCGCTTTACCAAGCCCTTGACCTCc
11.726NO
45hsa-let-7b26402662-20.8129
uUGGUG-UGU-UGGAUGAUGGAGu
|||:| :|| ||| ||| ||||
tACCGCTGCATACCCACT-CCTCg
11.726NO
46hsa-let-7b37663788-14.5127
uugguGUGUUGG-AUGAUGGAGu
|:|::|: | ||||| |
cctgtCGCGGCTGTTCTACCGCc
11.726NO
47hsa-let-7b60366056-11.7127
UUGGUGUGUUGGAUGAUGGAGU
|||: | || :| ||||||
AACTTGAGTTCC-GCAACCTCA
11.726NO
48hsa-let-7b39463972-21.7126
uuGGUGUGUU---GGAUG--AUGGAGu
||:||||| :|||| |:||||
cgCCGCACAAAGCTCTACAATGCCTCc
11.726NO
49hsa-let-7b54105439-15.3125
uuGGUGUGUUGGAU---GAUGGAGU-----
|| |||: | || ||||| ||
tgCCTCACGTCGTAGACCTACCACAGCTGG
11.726NO
50hsa-let-7b40184041-17.4123
uuGGUG--UGUUGGAUGAUGGAgu
|||| |||: :||| ||||
ggCCACGTACAGGTTACAACCTgt
11.726NO
let-7a
Target on HEV 
Binding site 4272-4295
mfe : -17.9
Hybrid sequence
uuGAUAUG--UUGGAUGAUGGAGU
ggCTATCCTGGCCCTGCTCCCTCA let-7a
Target on HEV 
Binding site 1113-1138
mfe : -15.2
Hybrid sequence
UUGAUA----UGUUGGAUGAUGGAGU
AGCTGTCATCACTGCCGCCTACCTTA let-7a
Target on HEV 
Binding site 5396-5416
mfe : -15.1
Hybrid sequence
uugauauGUUGGAUGAUGGAGU
cagcgccCCGCC-GCTGCCTCA let-7a
Target on HEV 
Binding site 138-161
mfe : -15.2
Hybrid sequence
uugAUAUGUUGGAU---GAUGGAGu
cctTAT-TAACCTAATGCAACCTCg let-7a
Target on HEV 
Binding site 2238-2259
mfe : -13.9
Hybrid sequence
uugauauguuGGAUGAUGGAGu
ggatccttccCCTACTCCCTCt let-7a
Target on HEV 
Binding site 2476-2502
mfe : -13.3
Hybrid sequence
uUGAUAUGUUGG-----AUGAUGGAGu
tACCCCGCATCCTTTGATGCTGCCTCt let-7a
Target on HEV 
Binding site 5532-5557
mfe : -13.3
Hybrid sequence
UUGAUA--UGU--UGGAUGAUGGAGu
ACCTATCAACATCTCCCCTTACCTCt let-7a
Target on HEV 
Binding site 5687-5708
mfe : -11.3
Hybrid sequence
uugauAUGUUGGAUGAUGGAGu
cgtgcTACAATTCGCTACCGCc let-7a
Target on HEV 
Binding site 557-580
mfe : -12.5
Hybrid sequence
uuGAUAUGU--UGGAUGAUGGAGu
ggCTTTACGCTGCCCTCCACCTCc let-7a
Target on HEV 
Binding site 306-328
mfe : -11.1
Hybrid sequence
uugauAUGUUG-GAUGAUGGAGu
tgtggTCCACCGCTGCTTCCTCc let-7a
Target on HEV 
Binding site 6036-6056
mfe : -12.2
Hybrid sequence
UUGAUAUGUUGGAUGAUGGAGU
AACT-TGAGTTCCGCAACCTCA let-7a
Target on HEV 
Binding site 3797-3823
mfe : -13.8
Hybrid sequence
UUG-AUAUGU--UGGA--UGAUGGAgu
AGCTTGAACAGGGCCTTCTCTACCTgc let-7a
Target on HEV 
Binding site 1009-1036
mfe : -11.5
Hybrid sequence
uuGAU-AUGUUGGAU-----GAUGGAGu
tgCTGCTCCCGCCTAATGACTTACCTCc let-7a
Target on HEV 
Binding site 897-918
mfe : -12.2
Hybrid sequence
uugauauGUUGGAUGAUGGAGU
cccctccCTATTTCCAACCTCA let-7a
Target on HEV 
Binding site 3765-3788
mfe : -13.2
Hybrid sequence
uuGAUA-UGUUGG-AUGAUGGAGu
ccCTGTCGCGGCTGTTCTACCGCc let-7a
Target on HEV 
Binding site 3426-3447
mfe : -10.1
Hybrid sequence
uugauaUGUUGGAUGAUGGAgu
tgaggcACAGGGCGCTACCTac let-7a
Target on HEV 
Binding site 355-375
mfe : -14.2
Hybrid sequence
uugAUAUGUUGGAUGAUGGagu
tggTATACTGCC-CCTACCcgc let-7a
Target on HEV 
Binding site 423-445
mfe : -17.2
Hybrid sequence
uuGAUAUGU-UGGAUGAUGGAGu
tgCTGACCGCACTTACTGCTTCg let-7a
Target on HEV 
Binding site 2208-2228
mfe : -11.9
Hybrid sequence
uugauauguuGGAUGAUGGAGu
cccggcggccCCT-CTACCCCc let-7a
Target on HEV 
Binding site 6143-6166
mfe : -14.7
Hybrid sequence
uugauaUGUUG--GAUGAUGGagu
ctcaccACCACGGCTGCTACCcgc let-7a
Target on HEV 
Binding site 6953-6974
mfe : -10.2
Hybrid sequence
uugaUAUGUUGGAUGAUGGagu
gaggATACCATGGACTACCctg let-7a
Target on HEV 
Binding site 1592-1615
mfe : -11.1
Hybrid sequence
uuGAUAUG--UUGGAUGA--UGGAGu
cgCTTTACCAAGCC--CTTGACCTCc let-7a
Target on HEV 
Binding site 6295-6318
mfe : -12.5
Hybrid sequence
uugauauGUUGG-AUGAUG-GAGu
tggtggcCAGCTGTTCTACTCTCg let-7b
Target on HEV 
Binding site 2476-2502
mfe : -20.4
Hybrid sequence
uUGGUGUGUUGG-----AUGAUGGAGu
tACCCCGCATCCTTTGATGCTGCCTCt let-7b
Target on HEV 
Binding site 5396-5416
mfe : -18.8
Hybrid sequence
uUGGUGUGUUGGAUGAUGGAGU
cAGCGCCCCGCC-GCTGCCTCA let-7b
Target on HEV 
Binding site 1116-1138
mfe : -18
Hybrid sequence
uugGU-GUGUUGGAUGAUGGAGU
tgtCATCACTGCCGCCTACCTTA let-7b
Target on HEV 
Binding site 6402-6422
mfe : -18
Hybrid sequence
uuGGUGUGUUGGAUGAUGGAGu
tcCCGCATGACAT-CGACCTCg let-7b
Target on HEV 
Binding site 897-918
mfe : -13.5
Hybrid sequence
uuGGUGUGUUGGAUGAUGGAGU
ccCCTCCCTATTTCCAACCTCA let-7b
Target on HEV 
Binding site 2240-2259
mfe : -14.8
Hybrid sequence
UUGGUGUGUUGGAUGAUGGAGu
ATCCTTCC--CCTACTCCCTCt let-7b
Target on HEV 
Binding site 4276-4295
mfe : -16.3
Hybrid sequence
UUGGUGUGUUGGAUGAUGGAGU
ATCCTGGC--CCTGCTCCCTCA let-7b
Target on HEV 
Binding site 136-161
mfe : -16.5
Hybrid sequence
UUGGUGU-GUUGGAU---GAUGGAGu
ATCCTTATTAACCTAATGCAACCTCg let-7b
Target on HEV 
Binding site 5536-5557
mfe : -14.8
Hybrid sequence
UUGGUGUGUUGGAUGAUGGAGu
ATCAACATCTCCCCTTACCTCt let-7b
Target on HEV 
Binding site 310-328
mfe : -16.4
Hybrid sequence
uuGGUGUGUUGGAUGAUGGAGu
gtCCAC-CG--CTGCTTCCTCc let-7b
Target on HEV 
Binding site 559-580
mfe : -14.4
Hybrid sequence
uuggUGUGUUGGAUGAUGGAGu
ctttACGCTGCCCTCCACCTCc let-7b
Target on HEV 
Binding site 6145-6166
mfe : -22.7
Hybrid sequence
uUGGU-GUGUUGGAUGAUGGagu
cACCACCACGG-CTGCTACCcgc let-7b
Target on HEV 
Binding site 3428-3447
mfe : -14.9
Hybrid sequence
UUGGUGUGUUGGAUGAUGGAgu
AGGCACAGGGC--GCTACCTac let-7b
Target on HEV 
Binding site 3800-3823
mfe : -17
Hybrid sequence
uuggUGUGUUGGA--UGAUGGAgu
ttgaACAGGGCCTTCTCTACCTgc let-7b
Target on HEV 
Binding site 1015-1036
mfe : -14.4
Hybrid sequence
uuGGUGUGUUGGAUGAUGGAGu
tcCCGCCTAATGACTTACCTCc let-7b
Target on HEV 
Binding site 5595-5619
mfe : -12.5
Hybrid sequence
uuGGUGUGUUG---GAUGAUGGAGu
ctCCTCTTAGCCCGCTTCTACCCCt let-7b
Target on HEV 
Binding site 427-445
mfe : -21.9
Hybrid sequence
uUGGUGUGUUGGAUGAUGGAGu
gACCGC---ACTTACTGCTTCg let-7b
Target on HEV 
Binding site 2205-2228
mfe : -15.2
Hybrid sequence
uUGGUG-UGUU-GGAUGAUGGAGu
tACCCCGGCGGCCCCTCTACCCCc let-7b
Target on HEV 
Binding site 5687-5708
mfe : -13.1
Hybrid sequence
uuggugUGUUGGAUGAUGGAGu
cgtgctACAATTCGCTACCGCc let-7b
Target on HEV 
Binding site 1137-1162
mfe : -16.4
Hybrid sequence
uUGGU--GUGUUGGAUG--AUGGAGu
tACCATCTGCCACCAGCGGTACCTCc let-7b
Target on HEV 
Binding site 1589-1615
mfe : -14.6
Hybrid sequence
UUGGUGUGUUGGAU---GA--UGGAGu
AACCGCTTTACCAAGCCCTTGACCTCc let-7b
Target on HEV 
Binding site 2640-2662
mfe : -20.8
Hybrid sequence
uUGGUG-UGU-UGGAUGAUGGAGu
tACCGCTGCATACCCACT-CCTCg let-7b
Target on HEV 
Binding site 3766-3788
mfe : -14.5
Hybrid sequence
uugguGUGUUGG-AUGAUGGAGu
cctgtCGCGGCTGTTCTACCGCc let-7b
Target on HEV 
Binding site 6036-6056
mfe : -11.7
Hybrid sequence
UUGGUGUGUUGGAUGAUGGAGU
AACTTGAGTTCC-GCAACCTCA let-7b
Target on HEV 
Binding site 3946-3972
mfe : -21.7
Hybrid sequence
uuGGUGUGUU---GGAUG--AUGGAGu
cgCCGCACAAAGCTCTACAATGCCTCc let-7b
Target on HEV 
Binding site 5410-5439
mfe : -15.3
Hybrid sequence
uuGGUGUGUUGGAU---GAUGGAGU-----
tgCCTCACGTCGTAGACCTACCACAGCTGG let-7b
Target on HEV 
Binding site 4018-4041
mfe : -17.4
Hybrid sequence
uuGGUG--UGUUGGAUGAUGGAgu
ggCCACGTACAGGTTACAACCTgt