Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HAV wildtype target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 1778 rescords (36 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7a70667088-11.1134
UUGAUAUGU-UGGAUGAUGGAGu
|||| :|| : | :||||:||
AACTTGGCATGACAGCTACTTCt
11.678NO
2hsa-let-7a25342558-13.2130
uuGAUAU---GUUGGAUGAUGGAGu
||||| : ::|| | |||||
tcCTATAACCTTGTCTTCAACCTCt
11.678NO
3hsa-let-7a19121936-12.3127
uUGAUAU-GUUGGAUGAUG--GAGu
|:|| | ||| | ||||| |||
cATTAAAGCAAGCAACTACTGCTCc
11.678NO
4hsa-let-7a4970-14.2126
uugauauguUGGAUGAUGGAGU
||:|: |||||||
ggtgaggggACTTGATACCTCA
11.678NO
5hsa-let-7a16101631-11.7121
UUGAUAUGUUGGAUGAUGGAgu
||:|| || ::||||||:|
AATTACTCATTTTACTACTTgg
11.678NO
6hsa-let-7b70667088-11.7133
UUGG--UGUGUUGGAUGAUGGAGu
|||: :||::| | :||||:||
AACTTGGCATGA-CAGCTACTTCt
11.726NO
7hsa-let-7b19071936-15.4132
UUGGUGU------GUUGGAUGAUG--GAGu
||:|||| ||| | ||||| |||
AATCACATTAAAGCAAGCAACTACTGCTCc
11.726NO
8hsa-let-7b25332558-15.9129
uuGGUGUGUUG-----GAUGAUGGAGu
|| :|:||| || | |||||
ttCC-TATAACCTTGTCTTCAACCTCt
11.726NO
9hsa-let-7b16101631-14.8126
UUGGUGUGUUGGAUGAUGGAgu
||::|| || ::||||||:|
AATTACTCATTTTACTACTTgg
11.726NO
10hsa-let-7b4970-14.8126
uugguguguUGGAUGAUGGAGU
||:|: |||||||
ggtgaggggACTTGATACCTCA
11.726NO
11hsa-let-7c25332558-16.5133
uuGGUAUGUUG-----GAUGAUGGAGu
|| ||:||| || | |||||
ttCC-TATAACCTTGTCTTCAACCTCt
11.774NO
12hsa-let-7c70667088-10.7130
UUGGUAUGU-UGGAUGAUGGAGu
|||: :|| : | :||||:||
AACTTGGCATGACAGCTACTTCt
11.774NO
13hsa-let-7c4970-14.2126
uugguauguUGGAUGAUGGAGU
||:|: |||||||
ggtgaggggACTTGATACCTCA
11.774NO
14hsa-let-7c19071936-14.4124
UUGGU---AU---GUUGGAUGAUG--GAGu
||:|| || ||| | ||||| |||
AATCACATTAAAGCAAGCAACTACTGCTCc
11.774NO
15hsa-let-7d70677088-14.2140
UGAUACGU-UGGAUGAUGGAGA
||| ||| : | :||||:|||
ACTTGGCATGACAGCTACTTCT
7.888NO
16hsa-let-7d25352558-13.4133
uGAUACGUUG-----GAUGAUGGAGA
|||| ||| || | ||||||
cCTAT--AACCTTGTCTTCAACCTCT
7.888NO
17hsa-let-7d19141936-13.4129
ugaUACGUUGGAUGAUG--GAGa
| |||| | ||||| |||
ttaAAGCAAGCAACTACTGCTCc
7.888NO
18hsa-let-7d5070-13.7126
ugaUACGUUGGAUGAUGGAGa
| | :||:|: ||||||
gtgAGGGGACTTGATACCTCa
7.888NO
19hsa-let-7e25352558-14.2133
uGAUAU---GUUGGAGGAUGGAGu
||||| : ::||:| |||||
cCTATAACCTTGTCTTCAACCTCt
6.037NO
20hsa-let-7e5070-13.5124
ugauauguuggaggAUGGAGU
|||||||
gtgaggggacttgaTACCTCA
6.037NO
21hsa-let-7f25342558-11.7134
uuGAUAU---GUUAGAUGAUGGAGu
||||| : :||| | |||||
tcCTATAACCTTGTCTTCAACCTCt
10.092NO
22hsa-let-7f19121936-12.3127
uUGAUAU-GUUAGAUGAUG--GAGu
|:|| | ||| | ||||| |||
cATTAAAGCAAGCAACTACTGCTCc
10.092NO
23hsa-let-7f16101631-11.4125
UUGAUAUGUUAGAUGAUGGAgu
||:|| || |:||||||:|
AATTACTCATTTTACTACTTgg
10.092NO
24hsa-let-7f4970-10.4124
uugauauguuagaugAUGGAGU
|||||||
ggtgaggggacttgaTACCTCA
10.092NO
25hsa-let-7g70677088-11.6137
UGACAUGU-UUGAUGAUGGAGu
||| :|| :|| :||||:||
ACTTGGCATGACAGCTACTTCt
9.988NO
26hsa-let-7g19141936-12.3125
ugacauGUUUGAUGAUG--GAGu
|||:| ||||| |||
ttaaagCAAGCAACTACTGCTCc
9.988NO
27hsa-let-7g5070-13.8124
ugacauguuugaugAUGGAGU
|||||||
gtgaggggacttgaTACCTCA
9.988NO
28hsa-let-7g70897109-16.8121
uGACAUGUUUGAUGAUGGAGU-
||| ||||: |||||||
gCTG-ACAAGAATGTACCTCAG
9.988NO
29hsa-let-7i70697088-10.9135
uguCGUGUUUGAUGAUGGAGu
|||: :|| :||||:||
ttgGCAT-GACAGCTACTTCt
7.883NO
30hsa-let-7i19111936-16.8128
UGUCGU---GUUUGAUGAUG--GAGu
||| :| |||:| ||||| |||
ACATTAAAGCAAGCAACTACTGCTCc
7.883NO
31hsa-let-7i5070-12.6124
ugucguguuugaugAUGGAGU
|||||||
gtgaggggacttgaTACCTCA
7.883NO
32hsa-miR-124912509-11129
AUGUAUGAAGAAAUGUAAGgu
|::: ||| |||||||||
TGTGCACT--TTTACATTCaa
5.340NO
33hsa-miR-100386407-21.9172
GUGUUCAAGCCUA---GAUGCCCAa
|||||| ||:| ||||||||
CACAAG---GGGTAGGCTACGGGTg
9.137Yes
34hsa-miR-100121-19.1128
guGUUCAAGCCUAGAUGCCCaa
|||| ||:||| ||||
ttCAAG-AGGGGTCTCCGGGaa
9.137NO
35hsa-miR-10051125133-20.6124
GUGUUCAAGCCUA--GAUGCCCaa
||||||| ||:| ||::|||
CACAAGT--GGGTTGCTGTGGGag
9.137NO
36hsa-miR-101282305-12.9122
GAAGU-C-AAUAGUGUCAUGACAU
|| || | ||| ||::| :|||||
CTCCATGATTAGCATGGAGCTGTA
9.992NO
37hsa-miR-10339193943-11.1139
aGUAUCGGGACAUG--UUACGACga
|| ||:::| | | |||||||
gCAAAGTTTTTTCCAAAATGCTGga
9.493NO
38hsa-miR-10358515870-12.7136
AGUAUCGGGACAUGUUACGACGA
|| |:| | | | |||:||||
TCTTGGGCAT---CCATGTTGCT
9.493NO
39hsa-miR-10328142840-11.2132
aGUAUC---GGGACAUGU-UACGACga
|||:| :|:| | :| ||||||
cCATGGTATTCTTATTTATATGCTGtg
9.493NO
40hsa-miR-10335233545-10.7128
aguaucgggacauguuACGACGa
||||||
tggatcttgaagaaatTGCTGCc
9.493NO
41hsa-miR-10335763598-12.7128
aguaucgggacauguuACGACGa
||||||
acggatttgtgtttctTGCTGCa
9.493NO
42hsa-miR-10365766599-12.7122
aGUAUCGGGACAUGU-UACGACGA
|| : ::| |||| :||:||||
cCAGGTTTCCATACAGGTGTTGCT
9.493NO
43hsa-miR-105689710-10.9126
ugUCC-UCAG-ACUCGUAAAcu
||| | || |:||||||
tgAGGTACTCAGGGGCATTTag
5.000NO
44hsa-miR-10551275143-10.1122
uguCCUCAGACUCGUAAACu
|||| || ||| |||
gtgGGAG-CT--GCAGTTGg
5.000NO
45hsa-miR-106a60536075-12.7138
cgAUGGACGUGAC-AUUCGUGAAAA
| |||||| | || || |||||
ttTTCCTGCA--GCTATGCCCTTTT
8.618NO
46hsa-miR-106a46664689-11.7131
cgauggaCGUGACAUUCGUGAAAA
| | |||:|||:||||
ttgaggaGAAGGGTAGGCATTTTT
8.618NO
47hsa-miR-106a28282854-13.42125
cgAUGGACGUGACA---UUCGUGAaaa
||: ||| ||| :||||||
ttTATATGCTGTGTCTGGAGCACTgga
8.618NO
48hsa-miR-106b24802501-10.7143
uAGACGUGACAG---UCGUGAAAu
||| ||:| || |||||||
gTCT-CATT-TCTTGTGCACTTTt
5.784Yes
49hsa-miR-106b28312854-13.9131
UAGACGUGACAG---UCGUGAaau
|| ||| |||| ||||||
ATATGCTGTGTCTGGAGCACTgga
5.784NO
50hsa-miR-106b55845601-11.8131
UAGACGUGACAGUCGUGAAAU
|| | :|| ||||||:||||
ATAT-TAC--TCAGCATTTTA
5.784NO
let-7a
Target on HAV 
Binding site 7066-7088
mfe : -11.1
Hybrid sequence
UUGAUAUGU-UGGAUGAUGGAGu
AACTTGGCATGACAGCTACTTCt let-7a
Target on HAV 
Binding site 2534-2558
mfe : -13.2
Hybrid sequence
uuGAUAU---GUUGGAUGAUGGAGu
tcCTATAACCTTGTCTTCAACCTCt let-7a
Target on HAV 
Binding site 1912-1936
mfe : -12.3
Hybrid sequence
uUGAUAU-GUUGGAUGAUG--GAGu
cATTAAAGCAAGCAACTACTGCTCc let-7a
Target on HAV 
Binding site 49-70
mfe : -14.2
Hybrid sequence
uugauauguUGGAUGAUGGAGU
ggtgaggggACTTGATACCTCA let-7a
Target on HAV 
Binding site 1610-1631
mfe : -11.7
Hybrid sequence
UUGAUAUGUUGGAUGAUGGAgu
AATTACTCATTTTACTACTTgg let-7b
Target on HAV 
Binding site 7066-7088
mfe : -11.7
Hybrid sequence
UUGG--UGUGUUGGAUGAUGGAGu
AACTTGGCATGA-CAGCTACTTCt let-7b
Target on HAV 
Binding site 1907-1936
mfe : -15.4
Hybrid sequence
UUGGUGU------GUUGGAUGAUG--GAGu
AATCACATTAAAGCAAGCAACTACTGCTCc let-7b
Target on HAV 
Binding site 2533-2558
mfe : -15.9
Hybrid sequence
uuGGUGUGUUG-----GAUGAUGGAGu
ttCC-TATAACCTTGTCTTCAACCTCt let-7b
Target on HAV 
Binding site 1610-1631
mfe : -14.8
Hybrid sequence
UUGGUGUGUUGGAUGAUGGAgu
AATTACTCATTTTACTACTTgg let-7b
Target on HAV 
Binding site 49-70
mfe : -14.8
Hybrid sequence
uugguguguUGGAUGAUGGAGU
ggtgaggggACTTGATACCTCA let-7c
Target on HAV 
Binding site 2533-2558
mfe : -16.5
Hybrid sequence
uuGGUAUGUUG-----GAUGAUGGAGu
ttCC-TATAACCTTGTCTTCAACCTCt let-7c
Target on HAV 
Binding site 7066-7088
mfe : -10.7
Hybrid sequence
UUGGUAUGU-UGGAUGAUGGAGu
AACTTGGCATGACAGCTACTTCt let-7c
Target on HAV 
Binding site 49-70
mfe : -14.2
Hybrid sequence
uugguauguUGGAUGAUGGAGU
ggtgaggggACTTGATACCTCA let-7c
Target on HAV 
Binding site 1907-1936
mfe : -14.4
Hybrid sequence
UUGGU---AU---GUUGGAUGAUG--GAGu
AATCACATTAAAGCAAGCAACTACTGCTCc let-7d
Target on HAV 
Binding site 7067-7088
mfe : -14.2
Hybrid sequence
UGAUACGU-UGGAUGAUGGAGA
ACTTGGCATGACAGCTACTTCT let-7d
Target on HAV 
Binding site 2535-2558
mfe : -13.4
Hybrid sequence
uGAUACGUUG-----GAUGAUGGAGA
cCTAT--AACCTTGTCTTCAACCTCT let-7d
Target on HAV 
Binding site 1914-1936
mfe : -13.4
Hybrid sequence
ugaUACGUUGGAUGAUG--GAGa
ttaAAGCAAGCAACTACTGCTCc let-7d
Target on HAV 
Binding site 50-70
mfe : -13.7
Hybrid sequence
ugaUACGUUGGAUGAUGGAGa
gtgAGGGGACTTGATACCTCa let-7e
Target on HAV 
Binding site 2535-2558
mfe : -14.2
Hybrid sequence
uGAUAU---GUUGGAGGAUGGAGu
cCTATAACCTTGTCTTCAACCTCt let-7e
Target on HAV 
Binding site 50-70
mfe : -13.5
Hybrid sequence
ugauauguuggaggAUGGAGU
gtgaggggacttgaTACCTCA let-7f
Target on HAV 
Binding site 2534-2558
mfe : -11.7
Hybrid sequence
uuGAUAU---GUUAGAUGAUGGAGu
tcCTATAACCTTGTCTTCAACCTCt let-7f
Target on HAV 
Binding site 1912-1936
mfe : -12.3
Hybrid sequence
uUGAUAU-GUUAGAUGAUG--GAGu
cATTAAAGCAAGCAACTACTGCTCc let-7f
Target on HAV 
Binding site 1610-1631
mfe : -11.4
Hybrid sequence
UUGAUAUGUUAGAUGAUGGAgu
AATTACTCATTTTACTACTTgg let-7f
Target on HAV 
Binding site 49-70
mfe : -10.4
Hybrid sequence
uugauauguuagaugAUGGAGU
ggtgaggggacttgaTACCTCA let-7g
Target on HAV 
Binding site 7067-7088
mfe : -11.6
Hybrid sequence
UGACAUGU-UUGAUGAUGGAGu
ACTTGGCATGACAGCTACTTCt let-7g
Target on HAV 
Binding site 1914-1936
mfe : -12.3
Hybrid sequence
ugacauGUUUGAUGAUG--GAGu
ttaaagCAAGCAACTACTGCTCc let-7g
Target on HAV 
Binding site 50-70
mfe : -13.8
Hybrid sequence
ugacauguuugaugAUGGAGU
gtgaggggacttgaTACCTCA let-7g
Target on HAV 
Binding site 7089-7109
mfe : -16.8
Hybrid sequence
uGACAUGUUUGAUGAUGGAGU-
gCTG-ACAAGAATGTACCTCAG let-7i
Target on HAV 
Binding site 7069-7088
mfe : -10.9
Hybrid sequence
uguCGUGUUUGAUGAUGGAGu
ttgGCAT-GACAGCTACTTCt let-7i
Target on HAV 
Binding site 1911-1936
mfe : -16.8
Hybrid sequence
UGUCGU---GUUUGAUGAUG--GAGu
ACATTAAAGCAAGCAACTACTGCTCc let-7i
Target on HAV 
Binding site 50-70
mfe : -12.6
Hybrid sequence
ugucguguuugaugAUGGAGU
gtgaggggacttgaTACCTCA miR-1
Target on HAV 
Binding site 2491-2509
mfe : -11
Hybrid sequence
AUGUAUGAAGAAAUGUAAGgu
TGTGCACT--TTTACATTCaa miR-100
Target on HAV 
Binding site 386-407
mfe : -21.9
Hybrid sequence
GUGUUCAAGCCUA---GAUGCCCAa
CACAAG---GGGTAGGCTACGGGTg miR-100
Target on HAV 
Binding site 1-21
mfe : -19.1
Hybrid sequence
guGUUCAAGCCUAGAUGCCCaa
ttCAAG-AGGGGTCTCCGGGaa miR-100
Target on HAV 
Binding site 5112-5133
mfe : -20.6
Hybrid sequence
GUGUUCAAGCCUA--GAUGCCCaa
CACAAGT--GGGTTGCTGTGGGag miR-101
Target on HAV 
Binding site 282-305
mfe : -12.9
Hybrid sequence
GAAGU-C-AAUAGUGUCAUGACAU
CTCCATGATTAGCATGGAGCTGTA miR-103
Target on HAV 
Binding site 3919-3943
mfe : -11.1
Hybrid sequence
aGUAUCGGGACAUG--UUACGACga
gCAAAGTTTTTTCCAAAATGCTGga miR-103
Target on HAV 
Binding site 5851-5870
mfe : -12.7
Hybrid sequence
AGUAUCGGGACAUGUUACGACGA
TCTTGGGCAT---CCATGTTGCT miR-103
Target on HAV 
Binding site 2814-2840
mfe : -11.2
Hybrid sequence
aGUAUC---GGGACAUGU-UACGACga
cCATGGTATTCTTATTTATATGCTGtg miR-103
Target on HAV 
Binding site 3523-3545
mfe : -10.7
Hybrid sequence
aguaucgggacauguuACGACGa
tggatcttgaagaaatTGCTGCc miR-103
Target on HAV 
Binding site 3576-3598
mfe : -12.7
Hybrid sequence
aguaucgggacauguuACGACGa
acggatttgtgtttctTGCTGCa miR-103
Target on HAV 
Binding site 6576-6599
mfe : -12.7
Hybrid sequence
aGUAUCGGGACAUGU-UACGACGA
cCAGGTTTCCATACAGGTGTTGCT miR-105
Target on HAV 
Binding site 689-710
mfe : -10.9
Hybrid sequence
ugUCC-UCAG-ACUCGUAAAcu
tgAGGTACTCAGGGGCATTTag miR-105
Target on HAV 
Binding site 5127-5143
mfe : -10.1
Hybrid sequence
uguCCUCAGACUCGUAAACu
gtgGGAG-CT--GCAGTTGg miR-106a
Target on HAV 
Binding site 6053-6075
mfe : -12.7
Hybrid sequence
cgAUGGACGUGAC-AUUCGUGAAAA
ttTTCCTGCA--GCTATGCCCTTTT miR-106a
Target on HAV 
Binding site 4666-4689
mfe : -11.7
Hybrid sequence
cgauggaCGUGACAUUCGUGAAAA
ttgaggaGAAGGGTAGGCATTTTT miR-106a
Target on HAV 
Binding site 2828-2854
mfe : -13.42
Hybrid sequence
cgAUGGACGUGACA---UUCGUGAaaa
ttTATATGCTGTGTCTGGAGCACTgga miR-106b
Target on HAV 
Binding site 2480-2501
mfe : -10.7
Hybrid sequence
uAGACGUGACAG---UCGUGAAAu
gTCT-CATT-TCTTGTGCACTTTt miR-106b
Target on HAV 
Binding site 2831-2854
mfe : -13.9
Hybrid sequence
UAGACGUGACAG---UCGUGAaau
ATATGCTGTGTCTGGAGCACTgga miR-106b
Target on HAV 
Binding site 5584-5601
mfe : -11.8
Hybrid sequence
UAGACGUGACAGUCGUGAAAU
ATAT-TAC--TCAGCATTTTA