Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HBV wildtype target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    adr   adyw   unspecified   ayw   adr4   ayw(patient C)   adw2   wildtype    
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 1075 rescords (22 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-miR-15017241747-29.1165
gUGAC-CAUGUUCC-CAACCCUCU
|||| ||: :||| ||||||:||
tACTGAGTGGGAGGAGTTGGGGGA
7.336NO
2hsa-miR-32830123043-28.2151
UGCCUUC--CCGU----CUC----UCCCGGUC
|:||||| || | ||| |||||||
ATGGAAGGTGGGAGTGGGAGCATTCGGGCCAG
NONO
3hsa-miR-14930223044-27.7164
CCUCACUUCUGU-GCCUCGGUCu
||||||:: :|| : |:|||||
GGAGTGGGAGCATTCGGGCCAGg
5.000NO
4hsa-miR-45314421461-27.5142
gCUUGAGUGGUGCCUGUUGGag
||| || ||:|||||:|||
tGAA-TC-CCGCGGACGACCcc
NONO
5hsa-miR-21411621190-26.31137
GACGGA-CAGA-------CACGGACGACa
| |||| |||| |||::|||||
CGGCCTGGTCTGTGCCAAGTGTTTGCTGa
8.407NO
6hsa-miR-13213691391-26.2152
gcuGGUACCGAC-AUCUGACAau
||||||||| |||:||||
tttCCATGGCTGCTAGGCTGTgc
5.000NO
7hsa-miR-43216241647-26.2135
gGUGGGU-UAC-UGGAUGAGGUUCu
|:|||| | | ||||:| |||||
aCGCCCACAGGAACCTGC-CCAAGg
NONO
8hsa-miR-324-3p12981321-25.76135
GGUCGUCGU--GGACCCCGUcacc
|: |||||| :||||||||
CTCGCAGCAGGTCTGGGGCAaaac
NONO
9hsa-miR-19717391761-25.4124
CGACCCACCUCUUCCA--CCACUU
|:|||| ||||:|||| ||| ||
GTTGGG-GGAGGAGGTTAGGTTAA
6.957NO
10hsa-miR-1033961-25.2140
AGUAUCGGGACAUGUUACGACGA
||| :||||||||| | |||||
TCAGGGCCCTGTACCTTCCTGCT
9.493NO
11hsa-miR-2022856-24.9128
aaaAGGGU---A----CGGGAUAUGGAga
||||| | |||||:|||||
agaTCCCAGAGTCAGGGCCCTGTACCTtc
NONO
12hsa-miR-370485510-24.9157
GGUCCAAG--G-UGG-GGUCGU-CCg
||||| || | ||| |||||| ||
CCAGGATCATCAACCACCAGCACGGg
NONO
13hsa-miR-29630613084-24.6163
uguCCU---AACUCCCCCCCGGGA
||| |||:|| || |||||
gggGGACTGTTGGGGTGGAGCCCT
7.400NO
14hsa-miR-34521412162-24.6175
cGGGACCUG-AUCCUCAGUCGu
|| |||| ||| |||||||
tCCAGGGACTTAGTAGTCAGCt
NONO
15hsa-miR-193b30223045-24.4166
uuUCGCCCU-GAAACUCCCGGUCaa
||:|||| | || |||||||
ggAGTGGGAGCATT-CGGGCCAGgg
NONO
16hsa-miR-18830503068-24.3124
uGGGAGGUGGUACGUUCCCUac
|||||| |||| ::||||
cCCCTCC-CCAT--GGGGGAct
5.000NO
17hsa-miR-193b30583095-23.9122
uUUCGCCCUGA-AACUC------------CCG-GUCaa
| | |||||| |||:| ||| |||
cATGGGGGACTGTTGGGGTGGAGCCCTCAGGCTCAGgg
NONO
18hsa-miR-33015631589-23.8131
AG-AGACGUCC-GGCACAC--GAAACG
|| ||||| || ||||||| ||| ||
TCATCTGCCGGACCGTGTGCACTTCGC
NONO
19hsa-miR-372370394-23.7123
uGCGAGUU-UACAG-CGUCGUGAAA
|||| :| :|||| ||:||::|||
tCGCTGGATGTGTCTGCGGCGTTTT
NONO
20hsa-miR-1073961-23.6131
ACUAUCGGGACAUGUUACGACGA
| | :||||||||| | |||||
TCAGGGCCCTGTACCTTCCTGCT
9.255NO
21hsa-miR-21012821307-23.2126
agUCGGCG-AC--AGUGUGCGU-GUC
|||||| || |::| |||| |||
ctAGCCGCTTGTTTTGCTCGCAGCAG
6.639NO
22hsa-miR-32630703096-23.2136
gACCUC-CUUC------CCGGGUCUCc
|||:| |:|| |||:|||:|
tTGGGGTGGAGCCCTCAGGCTCAGGGc
NONO
23hsa-miR-33927512772-23149
acucGAG-GACCUCCUGUCCCU
||| :|||| |:|:||||
cacaCTCTTTGGAAGGCGGGGA
NONO
24hsa-miR-22221452170-22.96124
CUCUGGGUCAUCGGUC--UACAucga
|:|||::|||||:||| ||||
GGGACTTAGTAGTCAGCTATGTcaac
5.000NO
25hsa-let-7e31063135-22.92151
UGAUAUGUU---------GGAGGAUGGAGu
|||:|:| | ||||||:||||
ACTGTGCCAGCAGCTCCTCCTCCTGCCTCc
6.037NO
26hsa-miR-193b743767-22.9153
uuucgCCCUGAAACUCCCGG-UCAa
| |::||||:||||| |||
atgatGTGGTTTTGGGGGCCAAGTc
NONO
27hsa-miR-324-3p31123150-22.9142
GGUCGUC------GUGGAC-----------CCCGUCAcc
||||||| | |||| ||||||
CCAGCAGCTCCTCCTCCTGCCTCCACCAATCGGCAGTca
NONO
28hsa-miR-142-3p24642486-22.8136
agGUAUUUCAUCCUUUGUGAUGu
|||||:||:|||||| :|||
caCATAAGGTGGGAAACTTTACt
9.468NO
29hsa-miR-48430183044-22.8134
uagCCCUC-CCC---UGA-CUCGGACu
||||| ||| |:| |:||| |
ggtGGGAGTGGGAGCATTCGGGCCAGg
NONO
30hsa-miR-19729993025-22.7130
cGACCCACCU------CUUCCACCACUu
|||| ||| |||||||| ||
aCTGGCCGGACGCATGGAAGGTGG-GAg
6.957NO
31hsa-miR-124a281303-22.6125
aCCGUAAGU-GGCGCACGGAAuu
|| : || |||:|||:|||
gGGGGAACACCCGTGTGTCTTgg
5.000NO
32hsa-miR-42514491468-22.6132
cCGCCUG-UGCUGUAAGGGCua
|||||| || | |||||
cGCGGACGACCCC--TCCCGgg
NONO
33hsa-miR-324-3p30003028-22.5142
GGUCGUC--GUGGACC-----CCGUCACC
|::|| | |:| ||| || |||||
CTGGCCGGACGCATGGAAGGTGGGAGTGG
NONO
34hsa-miR-50430263048-22.4153
uauCUC--ACGUCUGGUCCCAga
||| | |:|:|||||||
tggGAGCATTCGGGCCAGGGTtc
NONO
35hsa-miR-42518901917-22.2130
CCG----CCUGUG-CUGUAA--GGGCua
||| |||||: |||||| ||||
GGCTTTGGGACATGGACATTGACCCGta
NONO
36hsa-miR-48420132034-22.2140
UAGCCCUCCCCUGACUCGGAcu
||||||||| : |||:||
ATCGGGAGGCCTTAGAGTCTcc
NONO
37hsa-miR-50312711295-22.2135
GACGUCUUGA-CAAGGGCG-ACGAu
||||:||||| | |||| ||:|
CTGCGGAACTCCTAGCCGCTTGTTt
NONO
38hsa-miR-324-5p30473071-22.1133
uGUGGUUACGGG-AUCCCCU-ACgc
|||| | ||| |:||||| ||
tCACCCCTCCCCATGGGGGACTGtt
NONO
39hsa-miR-32830713099-22.1144
ugCCUUCC-C----GUCU--CUCCCGGuc
||: || | |||: ||||||
tgGGGTGGAGCCCTCAGGCTCAGGGCCta
NONO
40hsa-miR-491691721-22.1148
AGGAGU-AC----CUUCCC---AAGGGGUGA
| :||| || | |||| | |||||||
TGTTCAGTGGTTCGTAGGGCTTTCCCCCACT
NONO
41hsa-miR-50016311655-22.1141
GUCUUAGGAACGGG-UCC---ACGUA
|||:| || ||||| ||| |||||
CAGGAACC-TGCCCAAGGTCTTGCAT
NONO
42hsa-miR-32010181053-22128
aaGC-GGGAGAGU------------UGGGUCGAAAa
|| ||||:||| |:|| |||||
gcCGCCCCTTTCACGCAATGTGGATATCCTGCTTTa
10.314NO
43hsa-miR-37030903120-22141
gGUCC---AAG-GUG--G----GGUCGUCcg
|||| | | ||| | |||||||
tCAGGGCCTACTCACAACTGTGCCAGCAGct
NONO
44hsa-miR-21014961531-21.9127
AGUCGG-CGACA----------GUG---UGCGUGuc
|| ||| |:||| ||| :|||||
TCCGCCTGTTGTACCGACCGACCACGGGGCGCACct
6.639NO
45hsa-let-7c18101832-21.8133
uUGGUAUGUUGGAUGA-UGGAGu
|||||:||||:| :| |||||
cACCATGCAACTTTTTCACCTCt
11.774NO
46hsa-miR-48330033028-21.8154
ucuuCUGC---CCUCCUCUCCUCACu
|||| ||| |: :||||||
gccgGACGCATGGAAGGTGGGAGTGg
NONO
47hsa-miR-728322866-21.8160
gUUGUUUUAG-UG------------AUCAGAAGGU
|||||:||| || |:||||||||
gAACAAGATCTACAGCATGGGAGGTTGGTCTTCCA
5.000NO
48hsa-miR-37012881309-21.7170
ggucCAAGGUGGG-GUCGUCCg
|||:::|:| |||||||
gcttGTTTTGCTCGCAGCAGGt
NONO
49hsa-miR-44810351069-21.5150
UAC-CCUGUAGGAUG------------UAUACGUu
||| |||:|||||:| |||||||
ATGTGGATATCCTGCTTTAATGCCTTTATATGCAt
NONO
50hsa-miR-133a744764-21.4156
ugucgACCAACUUCCCCUGGUU
||||| ||||:||||
tgatgTGGTT-TTGGGGGCCAA
5.000NO
miR-150
Target on HBV wildtype 
Binding site 1724-1747
mfe : -29.1
Hybrid sequence
gUGAC-CAUGUUCC-CAACCCUCU
tACTGAGTGGGAGGAGTTGGGGGA miR-328
Target on HBV wildtype 
Binding site 3012-3043
mfe : -28.2
Hybrid sequence
UGCCUUC--CCGU----CUC----UCCCGGUC
ATGGAAGGTGGGAGTGGGAGCATTCGGGCCAG miR-149
Target on HBV wildtype 
Binding site 3022-3044
mfe : -27.7
Hybrid sequence
CCUCACUUCUGU-GCCUCGGUCu
GGAGTGGGAGCATTCGGGCCAGg miR-453
Target on HBV wildtype 
Binding site 1442-1461
mfe : -27.5
Hybrid sequence
gCUUGAGUGGUGCCUGUUGGag
tGAA-TC-CCGCGGACGACCcc miR-214
Target on HBV wildtype 
Binding site 1162-1190
mfe : -26.31
Hybrid sequence
GACGGA-CAGA-------CACGGACGACa
CGGCCTGGTCTGTGCCAAGTGTTTGCTGa miR-132
Target on HBV wildtype 
Binding site 1369-1391
mfe : -26.2
Hybrid sequence
gcuGGUACCGAC-AUCUGACAau
tttCCATGGCTGCTAGGCTGTgc miR-432
Target on HBV wildtype 
Binding site 1624-1647
mfe : -26.2
Hybrid sequence
gGUGGGU-UAC-UGGAUGAGGUUCu
aCGCCCACAGGAACCTGC-CCAAGg miR-324-3p
Target on HBV wildtype 
Binding site 1298-1321
mfe : -25.76
Hybrid sequence
GGUCGUCGU--GGACCCCGUcacc
CTCGCAGCAGGTCTGGGGCAaaac miR-197
Target on HBV wildtype 
Binding site 1739-1761
mfe : -25.4
Hybrid sequence
CGACCCACCUCUUCCA--CCACUU
GTTGGG-GGAGGAGGTTAGGTTAA miR-103
Target on HBV wildtype 
Binding site 39-61
mfe : -25.2
Hybrid sequence
AGUAUCGGGACAUGUUACGACGA
TCAGGGCCCTGTACCTTCCTGCT miR-202
Target on HBV wildtype 
Binding site 28-56
mfe : -24.9
Hybrid sequence
aaaAGGGU---A----CGGGAUAUGGAga
agaTCCCAGAGTCAGGGCCCTGTACCTtc miR-370
Target on HBV wildtype 
Binding site 485-510
mfe : -24.9
Hybrid sequence
GGUCCAAG--G-UGG-GGUCGU-CCg
CCAGGATCATCAACCACCAGCACGGg miR-296
Target on HBV wildtype 
Binding site 3061-3084
mfe : -24.6
Hybrid sequence
uguCCU---AACUCCCCCCCGGGA
gggGGACTGTTGGGGTGGAGCCCT miR-345
Target on HBV wildtype 
Binding site 2141-2162
mfe : -24.6
Hybrid sequence
cGGGACCUG-AUCCUCAGUCGu
tCCAGGGACTTAGTAGTCAGCt miR-193b
Target on HBV wildtype 
Binding site 3022-3045
mfe : -24.4
Hybrid sequence
uuUCGCCCU-GAAACUCCCGGUCaa
ggAGTGGGAGCATT-CGGGCCAGgg miR-188
Target on HBV wildtype 
Binding site 3050-3068
mfe : -24.3
Hybrid sequence
uGGGAGGUGGUACGUUCCCUac
cCCCTCC-CCAT--GGGGGAct miR-193b
Target on HBV wildtype 
Binding site 3058-3095
mfe : -23.9
Hybrid sequence
uUUCGCCCUGA-AACUC------------CCG-GUCaa
cATGGGGGACTGTTGGGGTGGAGCCCTCAGGCTCAGgg miR-330
Target on HBV wildtype 
Binding site 1563-1589
mfe : -23.8
Hybrid sequence
AG-AGACGUCC-GGCACAC--GAAACG
TCATCTGCCGGACCGTGTGCACTTCGC miR-372
Target on HBV wildtype 
Binding site 370-394
mfe : -23.7
Hybrid sequence
uGCGAGUU-UACAG-CGUCGUGAAA
tCGCTGGATGTGTCTGCGGCGTTTT miR-107
Target on HBV wildtype 
Binding site 39-61
mfe : -23.6
Hybrid sequence
ACUAUCGGGACAUGUUACGACGA
TCAGGGCCCTGTACCTTCCTGCT miR-210
Target on HBV wildtype 
Binding site 1282-1307
mfe : -23.2
Hybrid sequence
agUCGGCG-AC--AGUGUGCGU-GUC
ctAGCCGCTTGTTTTGCTCGCAGCAG miR-326
Target on HBV wildtype 
Binding site 3070-3096
mfe : -23.2
Hybrid sequence
gACCUC-CUUC------CCGGGUCUCc
tTGGGGTGGAGCCCTCAGGCTCAGGGc miR-339
Target on HBV wildtype 
Binding site 2751-2772
mfe : -23
Hybrid sequence
acucGAG-GACCUCCUGUCCCU
cacaCTCTTTGGAAGGCGGGGA miR-222
Target on HBV wildtype 
Binding site 2145-2170
mfe : -22.96
Hybrid sequence
CUCUGGGUCAUCGGUC--UACAucga
GGGACTTAGTAGTCAGCTATGTcaac let-7e
Target on HBV wildtype 
Binding site 3106-3135
mfe : -22.92
Hybrid sequence
UGAUAUGUU---------GGAGGAUGGAGu
ACTGTGCCAGCAGCTCCTCCTCCTGCCTCc miR-193b
Target on HBV wildtype 
Binding site 743-767
mfe : -22.9
Hybrid sequence
uuucgCCCUGAAACUCCCGG-UCAa
atgatGTGGTTTTGGGGGCCAAGTc miR-324-3p
Target on HBV wildtype 
Binding site 3112-3150
mfe : -22.9
Hybrid sequence
GGUCGUC------GUGGAC-----------CCCGUCAcc
CCAGCAGCTCCTCCTCCTGCCTCCACCAATCGGCAGTca miR-142-3p
Target on HBV wildtype 
Binding site 2464-2486
mfe : -22.8
Hybrid sequence
agGUAUUUCAUCCUUUGUGAUGu
caCATAAGGTGGGAAACTTTACt miR-484
Target on HBV wildtype 
Binding site 3018-3044
mfe : -22.8
Hybrid sequence
uagCCCUC-CCC---UGA-CUCGGACu
ggtGGGAGTGGGAGCATTCGGGCCAGg miR-197
Target on HBV wildtype 
Binding site 2999-3025
mfe : -22.7
Hybrid sequence
cGACCCACCU------CUUCCACCACUu
aCTGGCCGGACGCATGGAAGGTGG-GAg miR-124a
Target on HBV wildtype 
Binding site 281-303
mfe : -22.6
Hybrid sequence
aCCGUAAGU-GGCGCACGGAAuu
gGGGGAACACCCGTGTGTCTTgg miR-425
Target on HBV wildtype 
Binding site 1449-1468
mfe : -22.6
Hybrid sequence
cCGCCUG-UGCUGUAAGGGCua
cGCGGACGACCCC--TCCCGgg miR-324-3p
Target on HBV wildtype 
Binding site 3000-3028
mfe : -22.5
Hybrid sequence
GGUCGUC--GUGGACC-----CCGUCACC
CTGGCCGGACGCATGGAAGGTGGGAGTGG miR-504
Target on HBV wildtype 
Binding site 3026-3048
mfe : -22.4
Hybrid sequence
uauCUC--ACGUCUGGUCCCAga
tggGAGCATTCGGGCCAGGGTtc miR-425
Target on HBV wildtype 
Binding site 1890-1917
mfe : -22.2
Hybrid sequence
CCG----CCUGUG-CUGUAA--GGGCua
GGCTTTGGGACATGGACATTGACCCGta miR-484
Target on HBV wildtype 
Binding site 2013-2034
mfe : -22.2
Hybrid sequence
UAGCCCUCCCCUGACUCGGAcu
ATCGGGAGGCCTTAGAGTCTcc miR-503
Target on HBV wildtype 
Binding site 1271-1295
mfe : -22.2
Hybrid sequence
GACGUCUUGA-CAAGGGCG-ACGAu
CTGCGGAACTCCTAGCCGCTTGTTt miR-324-5p
Target on HBV wildtype 
Binding site 3047-3071
mfe : -22.1
Hybrid sequence
uGUGGUUACGGG-AUCCCCU-ACgc
tCACCCCTCCCCATGGGGGACTGtt miR-328
Target on HBV wildtype 
Binding site 3071-3099
mfe : -22.1
Hybrid sequence
ugCCUUCC-C----GUCU--CUCCCGGuc
tgGGGTGGAGCCCTCAGGCTCAGGGCCta miR-491
Target on HBV wildtype 
Binding site 691-721
mfe : -22.1
Hybrid sequence
AGGAGU-AC----CUUCCC---AAGGGGUGA
TGTTCAGTGGTTCGTAGGGCTTTCCCCCACT miR-500
Target on HBV wildtype 
Binding site 1631-1655
mfe : -22.1
Hybrid sequence
GUCUUAGGAACGGG-UCC---ACGUA
CAGGAACC-TGCCCAAGGTCTTGCAT miR-320
Target on HBV wildtype 
Binding site 1018-1053
mfe : -22
Hybrid sequence
aaGC-GGGAGAGU------------UGGGUCGAAAa
gcCGCCCCTTTCACGCAATGTGGATATCCTGCTTTa miR-370
Target on HBV wildtype 
Binding site 3090-3120
mfe : -22
Hybrid sequence
gGUCC---AAG-GUG--G----GGUCGUCcg
tCAGGGCCTACTCACAACTGTGCCAGCAGct miR-210
Target on HBV wildtype 
Binding site 1496-1531
mfe : -21.9
Hybrid sequence
AGUCGG-CGACA----------GUG---UGCGUGuc
TCCGCCTGTTGTACCGACCGACCACGGGGCGCACct let-7c
Target on HBV wildtype 
Binding site 1810-1832
mfe : -21.8
Hybrid sequence
uUGGUAUGUUGGAUGA-UGGAGu
cACCATGCAACTTTTTCACCTCt miR-483
Target on HBV wildtype 
Binding site 3003-3028
mfe : -21.8
Hybrid sequence
ucuuCUGC---CCUCCUCUCCUCACu
gccgGACGCATGGAAGGTGGGAGTGg miR-7
Target on HBV wildtype 
Binding site 2832-2866
mfe : -21.8
Hybrid sequence
gUUGUUUUAG-UG------------AUCAGAAGGU
gAACAAGATCTACAGCATGGGAGGTTGGTCTTCCA miR-370
Target on HBV wildtype 
Binding site 1288-1309
mfe : -21.7
Hybrid sequence
ggucCAAGGUGGG-GUCGUCCg
gcttGTTTTGCTCGCAGCAGGt miR-448
Target on HBV wildtype 
Binding site 1035-1069
mfe : -21.5
Hybrid sequence
UAC-CCUGUAGGAUG------------UAUACGUu
ATGTGGATATCCTGCTTTAATGCCTTTATATGCAt miR-133a
Target on HBV wildtype 
Binding site 744-764
mfe : -21.4
Hybrid sequence
ugucgACCAACUUCCCCUGGUU
tgatgTGGTT-TTGGGGGCCAA