Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HGV target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
 Browse   strain Iowan, complete genome   wildtype(complete genome)   
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 4939 rescords (99 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-miR-14986358673-33.9144
CCUCACUUCUGUG-----------------CCUCGGUCu
||:|||:||:||| || |||||
GGGGTGGAGGCACACCGTCTGATCCGGTTTGGTGCCAGg
5.000NO
2hsa-miR-41223012332-31.4162
uGCCGAUCACCU------G----GUCCACUUCA
||||| ||||| | |||||||:||
cCGGCT-GTGGAAGCCGCCGTGGCAGGTGAGGT
NONO
3hsa-miR-412840868-30.8164
ugCCGAUC-----ACCUGG-UCCACUUCA
||||:| |||:|| :|||||:||
gtGGCTGGGATCCTGGGCCTGGGTGAGGT
NONO
4hsa-miR-32857335761-30.2169
UGCCUUCC-CG------UCUCUCCCGGUC
|:|| ||| || :|:|:|||||||
ATGGCAGGTGCGTTCATGGGGGGGGCCAG
NONO
5hsa-miR-99b46524680-30153
GCGUUCCAGCC-------AAGAUGCCCAC
|||::|| :|| ||:||||||
CGCGGGGGTGGGCAAAGCCCCTGCGGGTG
7.475NO
6hsa-miR-19764906511-29.6191
CGACCCACCUCUUCCACCACUu
|||||| |||: ||||||||
GCTGGGCTGAGGTGGTGGTGAc
6.957Yes
7hsa-miR-32819712002-29.41140
UGCCUUC-------CCGU---CUCUCCCGGUC
||||||| |||| |:|:||||::|
ACGGAAGTGTCCGAGGCACTTGGGGGGGCTGG
NONO
8hsa-miR-32662556274-29.4133
gaCCUCCUUCCCGGGUCUCc
|||||:: ||:||:|:|
ggGGAGGGGTGGTCCGGGGa
NONO
9hsa-miR-42317761808-29.4133
gACUCCCC---GGA-------GU-CUGGCUCga
| ||||| ||| || |:|||||
aTTAGGGGGCCCCTGGGCAACCAGGGCCGAGgc
NONO
10hsa-miR-48463916412-29140
UAGCCCUCCCCUGACUCGGACu
||:|| |||||||| ||||
ATTGGATGGGGACTGTCCCTGt
NONO
11hsa-miR-324-3p22792310-28.8158
GGUCG-UCGU--GGA--CC-----CCGUCACC
||||| :||| ||| || ||| ||||
CCAGCTGGCAGTCCTAGGGCTGCCGGCTGTGG
NONO
12hsa-miR-29679237942-28.6177
uGUCCUAACUCCCCCCCGGga
|:| :||| |||||||||
gCGGTGTTG-GGGGGGGCCta
7.400NO
13hsa-miR-326681710-28.6141
GACCUCCUUC----------CCGGGUCUCC
|||||||: | ||||| |:||
CTGGAGGGTGGATGCCTGGTGGCCCTGGGG
NONO
14hsa-miR-49157435773-28.1136
aggAGUACCUUCC-------CA-AGGGGuga
||||||::|| || |||||
cgtTCATGGGGGGGGCCAGTGTCTCCCCctc
NONO
15hsa-miR-432*53365357-28184
UCUGUACCUCC-UCGGUAGGUC
|||:: || || ||||||||||
AGATGCGGTGGCAGCCATCCAG
NOYes
16hsa-miR-48427302749-28145
uAGCCCUCCCCUGACUCGGACu
|||||: |||:| :|||||
cTCGGGGAGGGGC--GGCCTGc
NONO
17hsa-miR-48625142538-28124
GAGCCC-CGUCGAGUCAU--GUCCu
| |||| ||| ||||||: |:||
CGCGGGCGCACCTCAGTGCTCGGGg
NONO
18hsa-miR-32691249157-27.9152
GACCUCCUUC--------------CCGGGUCUCC
| ||||||:| | |||||:||
CCGGAGGAGGTTCCCGCCCTCCCCGCCCCAGGGG
NONO
19hsa-miR-133a57365761-27.8165
uGUCGAC-CA---ACUUCCCCUGGUu
||| || || ||::||||:|||
gCAGGTGCGTTCATGGGGGGGGCCAg
5.000NO
20hsa-miR-32888788905-27.72131
uGCCUUCCCGUCUC------UCCCGGuc
||| |||| ||| |||| |
gCGGTTGGGCTGAGTTGGCTAGGGGCtt
NONO
21hsa-miR-43277387759-27.7151
GGUGGGUUACUGGAUGAGGUUCU
||::|| |||||| :||:||:||
CCGTCC-ATGACCGGCTTCAGGA
NONO
22hsa-miR-14926482670-27.6123
CCUCACUUCUGUGCCUCGGU-CU
||:|||:||:||| ||||: ||
GGGGTGGAGGCACAAAGCCGTGA
5.000NO
23hsa-miR-34620772107-27.5164
uCUCCGUCCGUAC--------GCCCGUCUGu
|:||: ||||| |||||||:|
cGGGGTTTGCATGGCTCTCTTCGGGCAGGCc
NONO
24hsa-miR-147585614-27.4127
CGUCUUC-GUAA-A--------GGUGUGUG
|| |::| |||| | |||| |||
GCCGGGGCCATTCTGGCCCCGGCCACCCAC
5.000NO
25hsa-miR-18817661786-27.4132
uGGGAGGUGGUACGUUCCCuac
||||:|||||| :|:|||
tCCCTTCACCAT-TAGGGGgcc
5.000NO
26hsa-miR-21045874623-27.4150
AGUCGGC--GACAG---------UG----UGCGUGUC
||:||:| ||||| || ||||||:|
TCGGCTGAACTGTCGATGCAAAGACGAGGACGCACGG
6.639NO
27hsa-miR-324-5p51735210-27.4141
UGUGGUUACGGGAUC---------------CCCUACGC
|||||:: | |||| ||||||:|
ACACCGGGTCGCTAGTGGTGGTGACAGACTGGGATGTG
NONO
28hsa-miR-29657365761-27.12171
uGUCC---UAACU--CCCCCCCGGga
|||| :|| | |||||||||
gCAGGTGCGTTCATGGGGGGGGCCag
7.400NO
29hsa-miR-12735253559-27.1137
uCGGUUCGAGUC------------U-GCCUAGGCU
||||:||| || | | |||||||
tGCCAGGCTGAGTCCTGTTGGGTCATCAGATCCGA
5.000NO
30hsa-miR-130b93089338-27.1130
uaCGGGAAAG---UA------GUAACGUGAC
||||| | || || |||||||
gaGCCCTCCCCGGATGGGGCACAGTGCACTG
5.095NO
31hsa-miR-22279007919-27.1138
CUCUGGGUCAUCGGUCUACAUCGa
||||||||| ||| : |||||
GAGACCCAG--GCC--GGGTAGCc
5.000NO
32hsa-miR-422b407433-27.1153
CCGGAA-----GACUGAGGUUCAGGuc
|| ||| ||||||||||||
GGGCTTGGAGAGGGACTCCAAGTCCcg
NONO
33hsa-miR-18754625483-26.9149
gCCGACGUUGUG-UUCUGUGCu
|||||| |:|| ::|||:||
tGGCTGCTATACGGGGACGCGg
5.000NO
34hsa-miR-48438363859-26.9138
uaGCCCUC-CCCUGACUCG-GAcu
|||||| |||| |||| ||
taCGGGAGCGGGAAAGAGCACTcg
NONO
35hsa-miR-37052465266-26.8161
GGUCCAAGGUGGGGUCGUCCg
||||| |:||:|||| ||
CCAGGCCACGCCTCAGCCGGt
NONO
36hsa-miR-44922782303-26.6136
UGGUCGAUUGUUA----UGUGACGGu
|||||||::||:| : :|||||
ACCAGCTGGCAGTCCTAGGGCTGCCg
NONO
37hsa-miR-48458065838-26.5146
uAGCCCUCCC------------CUGACUCGGAcu
|:||||||| |:| ||||||
gTTGGGAGGGTGTTGTCAACGCGGC-GAGCCTag
NONO
38hsa-miR-34229082933-26.4162
cuGCCCAC--GCUAAAGACACACUcu
|||||| :|| | ||||||||
ctCGGGTGGTTGAGTGCTGTGTGAtg
NONO
39hsa-miR-42316531681-26.31146
gACUCC-------CCGGAGUCUGGCUCga
||||| |||| ||||||:|
gTGAGGGACTGCTGGCCCGAGACCGGGtc
NONO
40hsa-miR-37072897318-26.3127
GGUCCAAG-GUG-GG-------GUCGUCCg
|||||| | ||| || : |||||
CCAGGTGCGCACTCCGCTTGAATTGCAGGt
NONO
41hsa-miR-41275237545-26.22153
UGCCGAUCACCUGGUCCACUuca
|||| :|||||| ||||||
ACGGAGGGTGGACAAGGTGAcct
NONO
42hsa-miR-49110211040-26.2128
aGGAGUACCUUCCCAAGGGguga
|||| ||||||| ||||
aCCTC-TGGAAGG--TCCCattt
NONO
43hsa-miR-296574595-26172
uGUCCUAACUCC-CCCCCGGga
|: |:|||||| ||||||
tCGTGGTTGAGGCCGGGGCCat
7.400NO
44hsa-miR-32855215549-26156
uGCCUU---CCCGUC----UCUCCCGGUc
||||: ||||:| :| ||||||
cCGGAGGGTGGGCGGCTGTGGTGGGCCAt
NONO
45hsa-miR-484838861-26166
UAGCCCUCCCCU--GACUCGGACu
|| || |||| |||:|||||
ATGTGGCTGGGATCCTGGGCCTGg
NONO
46hsa-miR-52470817106-26140
ugaGGUUUCCC-----UUCGCGGAAG
||:||||| |||:|:||||
cagCCGAAGGGGAGGAAAGTGTCTTC
NONO
47hsa-miR-18852755304-25.9124
ugGGAGG-----UGGUA--C-GUUCCCUAC
||||| ||||| | |::|||:||
ttCCTCCGGTAGACCATCGGCCGGGGGGTG
5.000NO
48hsa-miR-127736759-25.8123
uCGGU-UCG-AGUCUGCCUAGGCu
|||| |: ||||:|||:|::|
gGCCACTGTATCAGGCGGGTTTGg
5.000NO
49hsa-miR-19712541274-25.8134
cGACCCACCUCUUC--CACCACUu
|||| ||||||| |||| ||
aCTGG--GGAGAAGGTGTGG-GAc
6.957NO
50hsa-miR-33935333565-25.8148
ACUCGAGGAC--CUC-----------CUGUCCCu
|||| ||||| |:| |||:|||
TGAG-TCCTGTTGGGTCATCAGATCCGACGGGGc
NONO
miR-149
Target on HGV 
Binding site 8635-8673
mfe : -33.9
Hybrid sequence
CCUCACUUCUGUG-----------------CCUCGGUCu
GGGGTGGAGGCACACCGTCTGATCCGGTTTGGTGCCAGg miR-412
Target on HGV 
Binding site 2301-2332
mfe : -31.4
Hybrid sequence
uGCCGAUCACCU------G----GUCCACUUCA
cCGGCT-GTGGAAGCCGCCGTGGCAGGTGAGGT miR-412
Target on HGV 
Binding site 840-868
mfe : -30.8
Hybrid sequence
ugCCGAUC-----ACCUGG-UCCACUUCA
gtGGCTGGGATCCTGGGCCTGGGTGAGGT miR-328
Target on HGV 
Binding site 5733-5761
mfe : -30.2
Hybrid sequence
UGCCUUCC-CG------UCUCUCCCGGUC
ATGGCAGGTGCGTTCATGGGGGGGGCCAG miR-99b
Target on HGV 
Binding site 4652-4680
mfe : -30
Hybrid sequence
GCGUUCCAGCC-------AAGAUGCCCAC
CGCGGGGGTGGGCAAAGCCCCTGCGGGTG miR-197
Target on HGV 
Binding site 6490-6511
mfe : -29.6
Hybrid sequence
CGACCCACCUCUUCCACCACUu
GCTGGGCTGAGGTGGTGGTGAc miR-328
Target on HGV 
Binding site 1971-2002
mfe : -29.41
Hybrid sequence
UGCCUUC-------CCGU---CUCUCCCGGUC
ACGGAAGTGTCCGAGGCACTTGGGGGGGCTGG miR-326
Target on HGV 
Binding site 6255-6274
mfe : -29.4
Hybrid sequence
gaCCUCCUUCCCGGGUCUCc
ggGGAGGGGTGGTCCGGGGa miR-423
Target on HGV 
Binding site 1776-1808
mfe : -29.4
Hybrid sequence
gACUCCCC---GGA-------GU-CUGGCUCga
aTTAGGGGGCCCCTGGGCAACCAGGGCCGAGgc miR-484
Target on HGV 
Binding site 6391-6412
mfe : -29
Hybrid sequence
UAGCCCUCCCCUGACUCGGACu
ATTGGATGGGGACTGTCCCTGt miR-324-3p
Target on HGV 
Binding site 2279-2310
mfe : -28.8
Hybrid sequence
GGUCG-UCGU--GGA--CC-----CCGUCACC
CCAGCTGGCAGTCCTAGGGCTGCCGGCTGTGG miR-296
Target on HGV 
Binding site 7923-7942
mfe : -28.6
Hybrid sequence
uGUCCUAACUCCCCCCCGGga
gCGGTGTTG-GGGGGGGCCta miR-326
Target on HGV 
Binding site 681-710
mfe : -28.6
Hybrid sequence
GACCUCCUUC----------CCGGGUCUCC
CTGGAGGGTGGATGCCTGGTGGCCCTGGGG miR-491
Target on HGV 
Binding site 5743-5773
mfe : -28.1
Hybrid sequence
aggAGUACCUUCC-------CA-AGGGGuga
cgtTCATGGGGGGGGCCAGTGTCTCCCCctc miR-432*
Target on HGV 
Binding site 5336-5357
mfe : -28
Hybrid sequence
UCUGUACCUCC-UCGGUAGGUC
AGATGCGGTGGCAGCCATCCAG miR-484
Target on HGV 
Binding site 2730-2749
mfe : -28
Hybrid sequence
uAGCCCUCCCCUGACUCGGACu
cTCGGGGAGGGGC--GGCCTGc miR-486
Target on HGV 
Binding site 2514-2538
mfe : -28
Hybrid sequence
GAGCCC-CGUCGAGUCAU--GUCCu
CGCGGGCGCACCTCAGTGCTCGGGg miR-326
Target on HGV 
Binding site 9124-9157
mfe : -27.9
Hybrid sequence
GACCUCCUUC--------------CCGGGUCUCC
CCGGAGGAGGTTCCCGCCCTCCCCGCCCCAGGGG miR-133a
Target on HGV 
Binding site 5736-5761
mfe : -27.8
Hybrid sequence
uGUCGAC-CA---ACUUCCCCUGGUu
gCAGGTGCGTTCATGGGGGGGGCCAg miR-328
Target on HGV 
Binding site 8878-8905
mfe : -27.72
Hybrid sequence
uGCCUUCCCGUCUC------UCCCGGuc
gCGGTTGGGCTGAGTTGGCTAGGGGCtt miR-432
Target on HGV 
Binding site 7738-7759
mfe : -27.7
Hybrid sequence
GGUGGGUUACUGGAUGAGGUUCU
CCGTCC-ATGACCGGCTTCAGGA miR-149
Target on HGV 
Binding site 2648-2670
mfe : -27.6
Hybrid sequence
CCUCACUUCUGUGCCUCGGU-CU
GGGGTGGAGGCACAAAGCCGTGA miR-346
Target on HGV 
Binding site 2077-2107
mfe : -27.5
Hybrid sequence
uCUCCGUCCGUAC--------GCCCGUCUGu
cGGGGTTTGCATGGCTCTCTTCGGGCAGGCc miR-147
Target on HGV 
Binding site 585-614
mfe : -27.4
Hybrid sequence
CGUCUUC-GUAA-A--------GGUGUGUG
GCCGGGGCCATTCTGGCCCCGGCCACCCAC miR-188
Target on HGV 
Binding site 1766-1786
mfe : -27.4
Hybrid sequence
uGGGAGGUGGUACGUUCCCuac
tCCCTTCACCAT-TAGGGGgcc miR-210
Target on HGV 
Binding site 4587-4623
mfe : -27.4
Hybrid sequence
AGUCGGC--GACAG---------UG----UGCGUGUC
TCGGCTGAACTGTCGATGCAAAGACGAGGACGCACGG miR-324-5p
Target on HGV 
Binding site 5173-5210
mfe : -27.4
Hybrid sequence
UGUGGUUACGGGAUC---------------CCCUACGC
ACACCGGGTCGCTAGTGGTGGTGACAGACTGGGATGTG miR-296
Target on HGV 
Binding site 5736-5761
mfe : -27.12
Hybrid sequence
uGUCC---UAACU--CCCCCCCGGga
gCAGGTGCGTTCATGGGGGGGGCCag miR-127
Target on HGV 
Binding site 3525-3559
mfe : -27.1
Hybrid sequence
uCGGUUCGAGUC------------U-GCCUAGGCU
tGCCAGGCTGAGTCCTGTTGGGTCATCAGATCCGA miR-130b
Target on HGV 
Binding site 9308-9338
mfe : -27.1
Hybrid sequence
uaCGGGAAAG---UA------GUAACGUGAC
gaGCCCTCCCCGGATGGGGCACAGTGCACTG miR-222
Target on HGV 
Binding site 7900-7919
mfe : -27.1
Hybrid sequence
CUCUGGGUCAUCGGUCUACAUCGa
GAGACCCAG--GCC--GGGTAGCc miR-422b
Target on HGV 
Binding site 407-433
mfe : -27.1
Hybrid sequence
CCGGAA-----GACUGAGGUUCAGGuc
GGGCTTGGAGAGGGACTCCAAGTCCcg miR-187
Target on HGV 
Binding site 5462-5483
mfe : -26.9
Hybrid sequence
gCCGACGUUGUG-UUCUGUGCu
tGGCTGCTATACGGGGACGCGg miR-484
Target on HGV 
Binding site 3836-3859
mfe : -26.9
Hybrid sequence
uaGCCCUC-CCCUGACUCG-GAcu
taCGGGAGCGGGAAAGAGCACTcg miR-370
Target on HGV 
Binding site 5246-5266
mfe : -26.8
Hybrid sequence
GGUCCAAGGUGGGGUCGUCCg
CCAGGCCACGCCTCAGCCGGt miR-449
Target on HGV 
Binding site 2278-2303
mfe : -26.6
Hybrid sequence
UGGUCGAUUGUUA----UGUGACGGu
ACCAGCTGGCAGTCCTAGGGCTGCCg miR-484
Target on HGV 
Binding site 5806-5838
mfe : -26.5
Hybrid sequence
uAGCCCUCCC------------CUGACUCGGAcu
gTTGGGAGGGTGTTGTCAACGCGGC-GAGCCTag miR-342
Target on HGV 
Binding site 2908-2933
mfe : -26.4
Hybrid sequence
cuGCCCAC--GCUAAAGACACACUcu
ctCGGGTGGTTGAGTGCTGTGTGAtg miR-423
Target on HGV 
Binding site 1653-1681
mfe : -26.31
Hybrid sequence
gACUCC-------CCGGAGUCUGGCUCga
gTGAGGGACTGCTGGCCCGAGACCGGGtc miR-370
Target on HGV 
Binding site 7289-7318
mfe : -26.3
Hybrid sequence
GGUCCAAG-GUG-GG-------GUCGUCCg
CCAGGTGCGCACTCCGCTTGAATTGCAGGt miR-412
Target on HGV 
Binding site 7523-7545
mfe : -26.22
Hybrid sequence
UGCCGAUCACCUGGUCCACUuca
ACGGAGGGTGGACAAGGTGAcct miR-491
Target on HGV 
Binding site 1021-1040
mfe : -26.2
Hybrid sequence
aGGAGUACCUUCCCAAGGGguga
aCCTC-TGGAAGG--TCCCattt miR-296
Target on HGV 
Binding site 574-595
mfe : -26
Hybrid sequence
uGUCCUAACUCC-CCCCCGGga
tCGTGGTTGAGGCCGGGGCCat miR-328
Target on HGV 
Binding site 5521-5549
mfe : -26
Hybrid sequence
uGCCUU---CCCGUC----UCUCCCGGUc
cCGGAGGGTGGGCGGCTGTGGTGGGCCAt miR-484
Target on HGV 
Binding site 838-861
mfe : -26
Hybrid sequence
UAGCCCUCCCCU--GACUCGGACu
ATGTGGCTGGGATCCTGGGCCTGg miR-524
Target on HGV 
Binding site 7081-7106
mfe : -26
Hybrid sequence
ugaGGUUUCCC-----UUCGCGGAAG
cagCCGAAGGGGAGGAAAGTGTCTTC miR-188
Target on HGV 
Binding site 5275-5304
mfe : -25.9
Hybrid sequence
ugGGAGG-----UGGUA--C-GUUCCCUAC
ttCCTCCGGTAGACCATCGGCCGGGGGGTG miR-127
Target on HGV 
Binding site 736-759
mfe : -25.8
Hybrid sequence
uCGGU-UCG-AGUCUGCCUAGGCu
gGCCACTGTATCAGGCGGGTTTGg miR-197
Target on HGV 
Binding site 1254-1274
mfe : -25.8
Hybrid sequence
cGACCCACCUCUUC--CACCACUu
aCTGG--GGAGAAGGTGTGG-GAc miR-339
Target on HGV 
Binding site 3533-3565
mfe : -25.8
Hybrid sequence
ACUCGAGGAC--CUC-----------CUGUCCCu
TGAG-TCCTGTTGGGTCATCAGATCCGACGGGGc