Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HCV wildtype target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    
Subtypes1a  1b  2a  3a  4a  5a  6a  10a  11a 
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 4725 rescords (95 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-miR-45560236059-32.6140
GCUACAUCAG-------GUU-U-------CCGUGUAu
||:|||:||| ||| | |||||:|
CGGTGTGGTCTGCGCAGCAATACTGCGCCGGCACGTt
NONO
2hsa-miR-191*23102330-29.2162
cCCCUGCUUUAGGUUCGCGUCG
||||| |::|||:||| ||||
aGGGAC-AGGTCCGAGCTCAGC
NONO
3hsa-miR-198864882-28.9162
gGAUAGAGGGGAGACCUGG
||||||:||:||||| ||
tCTATCTTCCTTCTGGCCC
5.000NO
4hsa-miR-32675127531-28.9143
GACCUCCUUCCCGGGUCUCc
|||||||::| |||::|:|
CTGGAGGGGGAGCCTGGGGa
NONO
5hsa-miR-34670397062-28.9142
uCUCCGUCC-GUACGC-CCGUCUGU
|||||||| ||| | |||| |||
gGAGGCAGGAGATGGGCGGCA-ACA
NONO
6hsa-miR-32868986924-28.5164
uGCCUUC------CCGUCUCUCCCGGUc
|||:|| ||| |||||||:||
cCGGGAGAAGGTTGGC-GAGAGGGTCAc
NONO
7hsa-miR-324-3p60506081-28172
GGUCGU-----CGUG---G--ACCCCGUCACc
||:||| || | | |||||||||
CCGGCACGTTGGCCCGGGCGAGGGGGCAGTGc
NOYes
8hsa-miR-43327732796-27.6127
UGUGGCUCC-UCGG-GUAGUACua
|||| |||| :||| |:||:||
ACACGGAGGTGGCCGCGTCGTGtg
NONO
9hsa-miR-18854865507-27.4181
UGGGAGGUGGUACGUUCCCUAC
||| | ||:|: ||||||||||
ACCGTACATCGAGCAAGGGATG
5.000Yes
10hsa-miR-32833533384-27.1151
uGCCUUCCCG--UCUC--------UCCCGGUC
|| |:|||| :||| |||||||
cCGTAGGGGCCAGGAGATACTGCTTGGGCCAG
NONO
11hsa-miR-14985838610-27164
CCUCA----CUUCUGUGC--CUCGGUCU
||:|| ||:|||:|| ||||| ||
GGGGTCCAGGAGGACGCGGCGAGCCTGA
5.000NO
12hsa-miR-32848084830-27138
ugCCUUCCCGUCUCUCC--CGGUC
||| ||||| |:|| |||||
caGGACTGGCAG-GGGGAAGCCAG
NONO
13hsa-miR-43132203240-26.9152
aCGUACUGCCGGACGUUCUgu
||| |||||||||:|||
cGCACAACGGCCTGCGAGAtc
NONO
14hsa-miR-324-5p455481-26.8142
uGUGGUUACGGGAUC---CCC-UACGC
|:| :: ||||||| ||| :||||
gCGCAGGGGCCCTAGATTGGGTGTGCG
NONO
15hsa-miR-21822362257-26.7148
UGUA-CCAAUCUAGUUCGUGUu
||:| || :|:||:||||||
ACGTGGGAGGGGTCGAGCACAg
5.000NO
16hsa-miR-48475107528-26.7183
uaGCCCUCCCCUGACUCGGACu
| ||||||| |||||||
ccCTGGAGGGG---GAGCCTGg
NOYes
17hsa-miR-21052895317-26.6126
AGUCGGC--GA----CAGU-GUGCGUGUc
||:|||| || |||: |||| :||
TCGGCCGACCTGGAGGTCGTCACGAGCAc
6.639NO
18hsa-miR-487b81128133-26.6166
uUCACCUACUGGGACAUGCUaa
|| ||||:||||||||||
gAGAAGATGGCCCTGTACGAcg
NONO
19hsa-miR-14575167538-26.4122
UUCCCUAAGGACCCUUUUGACCUg
|:|||: |||||| :| | |||
AGGGGGAGCCTGGG-GATCCGGAt
11.062NO
20hsa-miR-42315051537-26.3124
GACUCC-------CCGGAGU----CUGGCUCGA
| |:|| |||| || |:|:|:|||
CGGGGGAAGTGCCGGCCGCACCACGGCTGGGCT
NONO
21hsa-miR-324-3p47894822-26.12150
GGUC----GUCGUGGACC--------CCGUCACC
|||| || |:|| || ||||| ||
CCAGGACTCAACGCCGGGGCAGGACTGGCAGGGG
NONO
22hsa-miR-32690989119-26.1168
gACCUCCUU--CCCGGGUCUCc
||||| | ||||||:|||
tTGGAGACACCGGGCCCGGAGc
NONO
23hsa-miR-193b64606486-26121
UUUCGCCCUGAAACUC---CCGGUCAa
||| |||||| |||| |:|:||
AAAACGGGACGATGAGGATCGTCGGTc
NONO
24hsa-miR-33985828602-26144
aCUCGAGGACCUCCUGUCCCu
|:| ||| |||||||: ||
gGGGGTCCAGGAGGACGCGGc
NONO
25hsa-miR-48622812319-26129
GAGCCCCGU---CGA-------------GU-CAUGUCCu
| ||||||: ||| || | |||||
CGCGGGGCGAACGCTGTGATCTGGAAGACAGGGACAGGt
NONO
26hsa-miR-14562726292-25.9154
UUCCCUAAGGACCCUUUUGACCUg
|||||| :|||| :||||||
AAGGGACATCTGG---GACTGGAt
11.062NO
27hsa-miR-18883928415-25.9143
uGGGAG-GUGG-UACGUUCCCuac
||||| :||| || ||||||
gCCCTCTTACCAATTCAAGGGggg
5.000NO
28hsa-miR-198632655-25.8136
GGAUAGAGGG-----GAGACCUGG
|||:|||||| |||| |:||
CCTGTCTCCCCGTGGCTCTCGGCC
5.000NO
29hsa-miR-29653925418-25.8121
uGUCCUAAC----UCCCCCC--CGGga
|||||||| : ||| |||
gCAGGATTGTCTTGTCCGGGAAGCCgg
7.400NO
30hsa-miR-21148034825-25.5148
uCCGCUUCCU-ACUGUUUCCCUU
|| | |||| ||:||::|||||
cGGGGCAGGACTGGCAGGGGGAA
5.593NO
31hsa-miR-48422372258-25.5133
uagCCCUCCCCUGACUCG-GACu
|||||||| | |||| | |
cgtGGGAGGGGTC-GAGCACAGg
NONO
32hsa-miR-15425722594-25.4141
GCUUCCGUUG-UGCCUAUUGGAu
||:||||::| :||| |||||
CGGAGGCGGCTTTGGAGAACCTc
5.000NO
33hsa-miR-45370137034-25.3132
GCUUGAGUGGUGCCUGUUGGAG
|||:||||: : || :||||||
CGAGCTCATAGAGGCTAACCTC
NONO
34hsa-miR-542-5p80718092-25.3169
GAGCACUGUACUACUAGGGGCU
||||| ||| :|| |||||||
CTCGTCTCATCGTGTTCCCCGA
NONO
35hsa-miR-32860596079-25.2128
ugccuuCCCGUCUCUCCCGguc
|||| |||:||||
tggcccGGGC-GAGGGGGCagt
NONO
36hsa-miR-52329292954-25.2149
GGGAGAU--A---UCCCUUCGCGCaa
||||| | | :|||::|||||
CCCTCAACGTCCGGGGGGGGCGCGat
NONO
37hsa-miR-14990939116-25.1151
cCUC--ACUUCUGUGCCUCGGUCu
||| ||:|||||| |:||| |
cGAGCTTGGAGACACCGGGCCCGg
5.000NO
38hsa-miR-526c96089641-25.1124
uuGUCUUUCGCGA-----A---GGGAGA--UCUc
||||:||:||| | |:|||| |||
tgCAGAGAGTGCTGATACTGGCCTCTCTGCAGAt
NONO
39hsa-miR-122a229-25156
uGUUUGUGG--UA--ACAG-UGUGAGGU
||: | || || | | ||||||||
cCAGCCCCCTGATGGGGGCGACACTCCA
12.384NO
40hsa-miR-18722662285-25145
GCC-GACGUUGUGUUCUGUGCu
||| ||||| || :|||:||
CGGCCTGCA--ACTGGACGCGg
5.000NO
41hsa-miR-37027412761-25163
gGUCCAAGGUGGGGUCGUCCG
| || :::||:||||:|||
gCTGGCGTTGCCTCAGCGGGC
NONO
42hsa-miR-14935773599-24.9156
CCUCACUUCU-GUGCCUCGGUCU
||| || | |||||:|||:||
GGACTGTCTACCACGGGGCCGGA
5.000NO
43hsa-miR-15063786403-24.9123
GUGACCAUGUUCCC---AACC-CUCu
|:| ||||:|:||| ||| |||
CGCGGGTATAGGGGGGTCTGGCGAGg
7.336NO
44hsa-miR-20448054825-24.9144
uCCGUAUCCU-ACUGUUUCCCUU
||| |||| ||:||::|||||
gGGC--AGGACTGGCAGGGGGAA
5.379NO
45hsa-miR-34659005921-24.9124
UCUCCGU-CCGUACGCCCGU-CUGu
|| ||:| ||| ||||||: |:|
AG-GGTATGGC--GCGGGCGTGGCg
NONO
46hsa-miR-13232363255-24.84133
gCUGGUACCGACAUCUGACAau
||:| |||| || |:||||
aGATC-TGGCCGT-GGCTGTgg
5.000NO
47hsa-miR-214890910-24.8155
gACGGACAGACACGGACGAca
|||||| ||||||| |||
tTGCCTGACTGTGCCCGCTtc
8.407NO
48hsa-miR-9260646085-24.8167
GUCCG--GCCCUGUUCACGUUAu
|:||| |||:| ||||||||
CGGGCGAGGGGGC-AGTGCAATg
9.883Yes
49hsa-miR-324-3p24352460-24.7134
gguCGUCGUGGA----CCCCGUCACc
||||:||:| ||||:|| |
cgtGCAGTACTTGTACGGGGTAGGGt
NONO
50hsa-miR-142-3p33523376-24.6129
aGGUAUUUC--AUCCUUUGUGAUGu
||:||::| ||||:|:|||:|
cCCGTAGGGGCCAGGAGATACTGCt
9.468NO
miR-455
Target on hcv wildtype 
Binding site 6023-6059
mfe : -32.6
Hybrid sequence
GCUACAUCAG-------GUU-U-------CCGUGUAu
CGGTGTGGTCTGCGCAGCAATACTGCGCCGGCACGTt miR-191*
Target on hcv wildtype 
Binding site 2310-2330
mfe : -29.2
Hybrid sequence
cCCCUGCUUUAGGUUCGCGUCG
aGGGAC-AGGTCCGAGCTCAGC miR-198
Target on hcv wildtype 
Binding site 864-882
mfe : -28.9
Hybrid sequence
gGAUAGAGGGGAGACCUGG
tCTATCTTCCTTCTGGCCC miR-326
Target on hcv wildtype 
Binding site 7512-7531
mfe : -28.9
Hybrid sequence
GACCUCCUUCCCGGGUCUCc
CTGGAGGGGGAGCCTGGGGa miR-346
Target on hcv wildtype 
Binding site 7039-7062
mfe : -28.9
Hybrid sequence
uCUCCGUCC-GUACGC-CCGUCUGU
gGAGGCAGGAGATGGGCGGCA-ACA miR-328
Target on hcv wildtype 
Binding site 6898-6924
mfe : -28.5
Hybrid sequence
uGCCUUC------CCGUCUCUCCCGGUc
cCGGGAGAAGGTTGGC-GAGAGGGTCAc miR-324-3p
Target on hcv wildtype 
Binding site 6050-6081
mfe : -28
Hybrid sequence
GGUCGU-----CGUG---G--ACCCCGUCACc
CCGGCACGTTGGCCCGGGCGAGGGGGCAGTGc miR-433
Target on hcv wildtype 
Binding site 2773-2796
mfe : -27.6
Hybrid sequence
UGUGGCUCC-UCGG-GUAGUACua
ACACGGAGGTGGCCGCGTCGTGtg miR-188
Target on hcv wildtype 
Binding site 5486-5507
mfe : -27.4
Hybrid sequence
UGGGAGGUGGUACGUUCCCUAC
ACCGTACATCGAGCAAGGGATG miR-328
Target on hcv wildtype 
Binding site 3353-3384
mfe : -27.1
Hybrid sequence
uGCCUUCCCG--UCUC--------UCCCGGUC
cCGTAGGGGCCAGGAGATACTGCTTGGGCCAG miR-149
Target on hcv wildtype 
Binding site 8583-8610
mfe : -27
Hybrid sequence
CCUCA----CUUCUGUGC--CUCGGUCU
GGGGTCCAGGAGGACGCGGCGAGCCTGA miR-328
Target on hcv wildtype 
Binding site 4808-4830
mfe : -27
Hybrid sequence
ugCCUUCCCGUCUCUCC--CGGUC
caGGACTGGCAG-GGGGAAGCCAG miR-431
Target on hcv wildtype 
Binding site 3220-3240
mfe : -26.9
Hybrid sequence
aCGUACUGCCGGACGUUCUgu
cGCACAACGGCCTGCGAGAtc miR-324-5p
Target on hcv wildtype 
Binding site 455-481
mfe : -26.8
Hybrid sequence
uGUGGUUACGGGAUC---CCC-UACGC
gCGCAGGGGCCCTAGATTGGGTGTGCG miR-218
Target on hcv wildtype 
Binding site 2236-2257
mfe : -26.7
Hybrid sequence
UGUA-CCAAUCUAGUUCGUGUu
ACGTGGGAGGGGTCGAGCACAg miR-484
Target on hcv wildtype 
Binding site 7510-7528
mfe : -26.7
Hybrid sequence
uaGCCCUCCCCUGACUCGGACu
ccCTGGAGGGG---GAGCCTGg miR-210
Target on hcv wildtype 
Binding site 5289-5317
mfe : -26.6
Hybrid sequence
AGUCGGC--GA----CAGU-GUGCGUGUc
TCGGCCGACCTGGAGGTCGTCACGAGCAc miR-487b
Target on hcv wildtype 
Binding site 8112-8133
mfe : -26.6
Hybrid sequence
uUCACCUACUGGGACAUGCUaa
gAGAAGATGGCCCTGTACGAcg miR-145
Target on hcv wildtype 
Binding site 7516-7538
mfe : -26.4
Hybrid sequence
UUCCCUAAGGACCCUUUUGACCUg
AGGGGGAGCCTGGG-GATCCGGAt miR-423
Target on hcv wildtype 
Binding site 1505-1537
mfe : -26.3
Hybrid sequence
GACUCC-------CCGGAGU----CUGGCUCGA
CGGGGGAAGTGCCGGCCGCACCACGGCTGGGCT miR-324-3p
Target on hcv wildtype 
Binding site 4789-4822
mfe : -26.12
Hybrid sequence
GGUC----GUCGUGGACC--------CCGUCACC
CCAGGACTCAACGCCGGGGCAGGACTGGCAGGGG miR-326
Target on hcv wildtype 
Binding site 9098-9119
mfe : -26.1
Hybrid sequence
gACCUCCUU--CCCGGGUCUCc
tTGGAGACACCGGGCCCGGAGc miR-193b
Target on hcv wildtype 
Binding site 6460-6486
mfe : -26
Hybrid sequence
UUUCGCCCUGAAACUC---CCGGUCAa
AAAACGGGACGATGAGGATCGTCGGTc miR-339
Target on hcv wildtype 
Binding site 8582-8602
mfe : -26
Hybrid sequence
aCUCGAGGACCUCCUGUCCCu
gGGGGTCCAGGAGGACGCGGc miR-486
Target on hcv wildtype 
Binding site 2281-2319
mfe : -26
Hybrid sequence
GAGCCCCGU---CGA-------------GU-CAUGUCCu
CGCGGGGCGAACGCTGTGATCTGGAAGACAGGGACAGGt miR-145
Target on hcv wildtype 
Binding site 6272-6292
mfe : -25.9
Hybrid sequence
UUCCCUAAGGACCCUUUUGACCUg
AAGGGACATCTGG---GACTGGAt miR-188
Target on hcv wildtype 
Binding site 8392-8415
mfe : -25.9
Hybrid sequence
uGGGAG-GUGG-UACGUUCCCuac
gCCCTCTTACCAATTCAAGGGggg miR-198
Target on hcv wildtype 
Binding site 632-655
mfe : -25.8
Hybrid sequence
GGAUAGAGGG-----GAGACCUGG
CCTGTCTCCCCGTGGCTCTCGGCC miR-296
Target on hcv wildtype 
Binding site 5392-5418
mfe : -25.8
Hybrid sequence
uGUCCUAAC----UCCCCCC--CGGga
gCAGGATTGTCTTGTCCGGGAAGCCgg miR-211
Target on hcv wildtype 
Binding site 4803-4825
mfe : -25.5
Hybrid sequence
uCCGCUUCCU-ACUGUUUCCCUU
cGGGGCAGGACTGGCAGGGGGAA miR-484
Target on hcv wildtype 
Binding site 2237-2258
mfe : -25.5
Hybrid sequence
uagCCCUCCCCUGACUCG-GACu
cgtGGGAGGGGTC-GAGCACAGg miR-154
Target on hcv wildtype 
Binding site 2572-2594
mfe : -25.4
Hybrid sequence
GCUUCCGUUG-UGCCUAUUGGAu
CGGAGGCGGCTTTGGAGAACCTc miR-453
Target on hcv wildtype 
Binding site 7013-7034
mfe : -25.3
Hybrid sequence
GCUUGAGUGGUGCCUGUUGGAG
CGAGCTCATAGAGGCTAACCTC miR-542-5p
Target on hcv wildtype 
Binding site 8071-8092
mfe : -25.3
Hybrid sequence
GAGCACUGUACUACUAGGGGCU
CTCGTCTCATCGTGTTCCCCGA miR-328
Target on hcv wildtype 
Binding site 6059-6079
mfe : -25.2
Hybrid sequence
ugccuuCCCGUCUCUCCCGguc
tggcccGGGC-GAGGGGGCagt miR-523
Target on hcv wildtype 
Binding site 2929-2954
mfe : -25.2
Hybrid sequence
GGGAGAU--A---UCCCUUCGCGCaa
CCCTCAACGTCCGGGGGGGGCGCGat miR-149
Target on hcv wildtype 
Binding site 9093-9116
mfe : -25.1
Hybrid sequence
cCUC--ACUUCUGUGCCUCGGUCu
cGAGCTTGGAGACACCGGGCCCGg miR-526c
Target on hcv wildtype 
Binding site 9608-9641
mfe : -25.1
Hybrid sequence
uuGUCUUUCGCGA-----A---GGGAGA--UCUc
tgCAGAGAGTGCTGATACTGGCCTCTCTGCAGAt miR-122a
Target on hcv wildtype 
Binding site 2-29
mfe : -25
Hybrid sequence
uGUUUGUGG--UA--ACAG-UGUGAGGU
cCAGCCCCCTGATGGGGGCGACACTCCA miR-187
Target on hcv wildtype 
Binding site 2266-2285
mfe : -25
Hybrid sequence
GCC-GACGUUGUGUUCUGUGCu
CGGCCTGCA--ACTGGACGCGg miR-370
Target on hcv wildtype 
Binding site 2741-2761
mfe : -25
Hybrid sequence
gGUCCAAGGUGGGGUCGUCCG
gCTGGCGTTGCCTCAGCGGGC miR-149
Target on hcv wildtype 
Binding site 3577-3599
mfe : -24.9
Hybrid sequence
CCUCACUUCU-GUGCCUCGGUCU
GGACTGTCTACCACGGGGCCGGA miR-150
Target on hcv wildtype 
Binding site 6378-6403
mfe : -24.9
Hybrid sequence
GUGACCAUGUUCCC---AACC-CUCu
CGCGGGTATAGGGGGGTCTGGCGAGg miR-204
Target on hcv wildtype 
Binding site 4805-4825
mfe : -24.9
Hybrid sequence
uCCGUAUCCU-ACUGUUUCCCUU
gGGC--AGGACTGGCAGGGGGAA miR-346
Target on hcv wildtype 
Binding site 5900-5921
mfe : -24.9
Hybrid sequence
UCUCCGU-CCGUACGCCCGU-CUGu
AG-GGTATGGC--GCGGGCGTGGCg miR-132
Target on hcv wildtype 
Binding site 3236-3255
mfe : -24.84
Hybrid sequence
gCUGGUACCGACAUCUGACAau
aGATC-TGGCCGT-GGCTGTgg miR-214
Target on hcv wildtype 
Binding site 890-910
mfe : -24.8
Hybrid sequence
gACGGACAGACACGGACGAca
tTGCCTGACTGTGCCCGCTtc miR-92
Target on hcv wildtype 
Binding site 6064-6085
mfe : -24.8
Hybrid sequence
GUCCG--GCCCUGUUCACGUUAu
CGGGCGAGGGGGC-AGTGCAATg miR-324-3p
Target on hcv wildtype 
Binding site 2435-2460
mfe : -24.7
Hybrid sequence
gguCGUCGUGGA----CCCCGUCACc
cgtGCAGTACTTGTACGGGGTAGGGt miR-142-3p
Target on hcv wildtype 
Binding site 3352-3376
mfe : -24.6
Hybrid sequence
aGGUAUUUC--AUCCUUUGUGAUGu
cCCGTAGGGGCCAGGAGATACTGCt