Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HDV target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
 Browse    HDV RNA genome   HDVJS   
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 707 rescords (15 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-miR-328975996-31.3156
ugCCUUCCCGUCUCUCCCGGUC
||:|| | ||:|||||:|:|
tgGGGAGAGGAGGGAGGGTCGG
NONO
2hsa-miR-328248285-28.7133
uGCCUUCCC------------GUCU--CUCC--CGGUc
| |||||| |||| |||| ||||
cCCGAAGGGTTGAGAGTACCCCAGAGGGAGGAAGCCAc
NONO
3hsa-miR-191*10941120-28137
CCCCUGCUUU-----AGGUUCGCGucg
|||||||||: ||::||||
GGGGACGAAGCCGCCCCCGGGCGCtcc
NONO
4hsa-miR-37011381164-27.7144
gguCCAAG-GUGG-----GGUCGUCCG
||||| |||| || ||:|||
gggGGTTCACACCCCCAACCTGCGGGC
NONO
5hsa-miR-422a13351353-27.2146
CCGGAAGACUGGGAUUCAGGUC
|||| ||| :||||:||||:|
GGCC-TCT--TCCTAGGTCCGG
NONO
6hsa-miR-133a719747-27.02159
uGUCGACC------AA-CUUCCCCUGGuu
|:||||| || :||||||||
cCGGCTGGGCAACATTCCGAGGGGACCgt
5.000NO
7hsa-miR-328160181-26.8134
ugCCUUCCCGUCUCUCCCgguc
||||||| | ||||||
taGGAAGGGGAAAGAGGGaagg
NONO
8hsa-miR-129861881-26.7124
cGUUCGGGUCUGGCGUUUUUC
| || :|:||||||:|::||
cCCAGGTCGGACCGCGAGGAG
5.000NO
9hsa-miR-526c330351-25.9133
UUGUCUUUCGCGAAGGGAGAUCUC
||||||:||||| | | | ||||
AACAGAGAGCGCAT--CGCGAGAG
NONO
10hsa-miR-127428-25.6169
UCGGUUCGAGUC-UG--CCUAGGCu
|||||||:|| | || ||||:||
AGCCAAGTTCCGAACAAGGATTCGc
5.000NO
11hsa-miR-149274295-25.3126
CCUCACUUC--UGUGCCUCGGUCU
|||| |||| |||||||| :|||
GGAG-GAAGCCACACGGAG-TAGA
5.000NO
12hsa-miR-491681714-25.3131
aGGAGUACCUUC----CCA-------AGGGGUGA
||| |||| | ||| |||:|:||
aCCTGATGGCCGGCATGGTCCCAGCCTCCTCGCT
NONO
13hsa-miR-205969989-25.1130
GUCUGAGGCCACCUUACUUCCU
|| ||||:|| | :| ||:|||
CA-ACTCTGGGGAGAGGAGGGA
5.000NO
14hsa-miR-3262955-24.8153
gaCCUCCU------UCCCGGG-UCUCC
|||||| || |||| |||||
ggGGAGGATAGATCAGCGCCCGAGAGG
NONO
15hsa-miR-423191216-24.7137
gaCUC--CCCGGA-GUCU-GGCUCga
||| |||||| | || |||||
agGAGGCGGGCCTCCCGATCCGAGgg
NONO
16hsa-miR-127224247-24.6142
uCGGUUCGAGUCUGCCU---AGGCu
||||||:|::|| ||| ||||
gGCCAAGTTTGGA-GGACACTCCGg
5.000NO
17hsa-miR-193b544575-24.4157
UUUCGCC-CUGAAACU------CCC-GGUCAa
|::| || |||||||| ||| |||||
AGGGGGGTGACTTTGAACATTGGGGACCAGTg
NONO
18hsa-miR-331431466-24.3124
aaGAUC--CUAUCC----------GGG---UCCCCg
|||| |:|:|| ||| |||||
ggCTAGCAGGTGGGTGTTCCGCCCCCCGAGAGGGGa
NONO
19hsa-miR-324-5p3861-24.2147
UGUGGUUACGGGAUC-CCCUACgc
| |:||: |||| || |||:||
AGATCAGCGCCCGAGAGGGGTGag
NONO
20hsa-miR-326206225-24.2142
gaccucCUUCCCGGGUCUCC
||:||||||:| ||
cgatccGAGGGGCCCGGCGG
NONO
21hsa-miR-199a544567-24.1153
cuuguCCA-UCAGACUUGUGACCC
||| | |:||||||:||||
aggggGGTGACTTTGAACATTGGG
10.003NO
22hsa-miR-133b720747-24.02153
auCGACC------AA-CUUCCCCUGGuu
||||| || :||||||||
cgGCTGGGCAACATTCCGAGGGGACCgt
NONO
23hsa-miR-432601625-24148
GGUGGGUUACUGGA--UGAGGUUCu
||:||||| ||| | |||||
CCGCCCAAGCTCCTTCCCCCCAAGg
NONO
24hsa-miR-12710561078-23.9143
ucGGUUCGAGUCUGCCU-AGGCu
||:||: ||: ||| ||||
gtCCGAGTAAAGGGGGACTCCGg
5.000NO
25hsa-miR-133a436470-23.7130
uGUCGACCAAC-------------UUCCCCUGGUu
||| ||| || :||||||| |
gCAGGTGGGTGTTCCGCCCCCCGAGAGGGGACGAg
5.000NO
26hsa-miR-518c*292317-23.7167
gUCUU-UCAC-GAAG-GGAGGUCUCu
|||| || | || |||||||||
tAGAACAGAGAAATCACCTCCAGAGg
NONO
27hsa-miR-328719747-23.61121
uGCCUUCCCG-UCU----CUCCC--GGuc
||| |||| | | ||||| ||
cCGGCTGGGCAACATTCCGAGGGGACCgt
NONO
28hsa-miR-370640660-23.6148
gGUCCAAGGUGGGGUCGUCCg
|:|| || |:| |||||
gCGGGACCCCACTCTGCAGGg
NONO
29hsa-miR-484455479-23.5137
uaGCCCUCCCCUG---ACUCGGAcu
|| |||||||| |||| ||
ccCGAGAGGGGACGAGTGAGGCTta
NONO
30hsa-miR-523648668-23.5127
GG-GAGAUAUCCCUUCGCGCAA
|| ||||: |||| ||||||
CCACTCTGCAGGG-TCCGCGTT
NONO
31hsa-miR-328181204-23.4140
ugCCUUCCCGUC--UCUCCCGGuc
||||| | || :| |||||
gtGGAAGAGAAGGAGGCGGGCCtc
NONO
32hsa-miR-324-5p145174-23.2124
UGUGGUUAC---GGGA----UCCCCUacgc
||:|||:|| |:|| ||||||
ACGCCAGTGAAACTCTAGGAAGGGGAaaga
NONO
33hsa-miR-18811191144-23.1135
uGGG----AGGUGGUACGUUCCCUAc
||| |||||| | |:|||:|
cCCCTCGTTCCACCTTCGAGGGGGTt
5.000NO
34hsa-miR-296196221-23.1172
uGUCCUAA---CU--CCCCCCCGGGa
|:|| | || | |||||||
gCGGGCCTCCCGATCCGAGGGGCCCg
7.400NO
35hsa-miR-450329351-23136
auaaUC-CUUGUGUAGCGUUUUu
|| ||:|:||||||:|:|
gaacAGAGAGCGCATCGCGAGAg
NONO
36hsa-miR-491627652-22.9152
AG-GAGUACCUU--C-CCAAGGGGUGA
|| | || |||| | || |||||||
TCGCCCA-GGAATGGCGGGACCCCACT
NONO
37hsa-miR-526b435462-22.9127
UUGUCU-UUCACGA---AGGGAGUUCUC
|:|||: ::|||:| ||| |:||||
AGCAGGTGGGTGTTCCGCCCCCCGAGAG
NONO
38hsa-miR-127426452-22.8123
UCGGUUCGA--GUCUGCCU---AGGCu
||| ::||| |||::||: ||||
AGCGGGGCTAGCAGGTGGGTGTTCCGc
5.000NO
39hsa-miR-431216241-22.8126
aCGUACUGCCGG-----ACGUUCUGU
|| |:||||| || |:||||
gGCCCGGCGGCCAAGTTTGGAGGACA
NONO
40hsa-miR-150372395-22.7157
gugaCC-AUGUUCC-CAACCCUCU
|| |:| ||| ||||||:||
gaggGGATGCTAGGAGTTGGGGGA
7.336NO
41hsa-miR-18810461072-22.5129
uGGGAGGUGGUACG-----UUCCCuac
|||||| | :| | |||||
tCCCTCCCCGGTCCGAGTAAAGGGgga
5.000NO
42hsa-miR-211245277-22.5144
uCC--GCUUCCUA---CU------GUUUCCCUu
|| ||||||:| || ||:|||||
cGGCCCGAAGGGTTGAGAGTACCCCAGAGGGAg
5.593NO
43hsa-miR-326249274-22.5169
GACCUCC---UUCCC---GGGUCUCC
| | ||| :|| | ||||||||
CCGAAGGGTTGAGAGTACCCCAGAGG
NONO
44hsa-miR-33113651397-22.5147
aAGAUC---CUA-UCCG--------GGUCCCCg
|||:| | | :||| ||:||||
aTCTGGTCCGTTCGGGCCCTCTTCGCCGGGGGa
NONO
45hsa-miR-378371394-22.5121
ugUGUCCUG-GA-CCUCAGUCCUC
| :|||: || |||||::||:|
ggAGGGGATGCTAGGAGTTGGGGG
NONO
46hsa-miR-422b13351353-22.4136
CCGGAAGACUGAGG-UUCAGGUC
|||| ||| ||| |:||||:|
GGCC-TCT---TCCTAGGTCCGG
NONO
47hsa-miR-3312958-22.3140
aagaUCCUAUC------CGGG---UCCCCg
||||||| |||| |||||
ggggAGGATAGATCAGCGCCCGAGAGGGGt
NONO
48hsa-miR-409-3p11381161-22.3121
uCCCCAAGUG-GCUCGUUGUAAGC
||||||||| | |||| | ||
gGGGGTTCACACCCCCAACCTGCG
NONO
49hsa-miR-340431465-22.2123
CCGAUAUUUCAUU------------GACUCUGCCu
||||| |:||:: | |||| ||
GGCTAGCAGGTGGGTGTTCCGCCCCCCGAGAGGGg
NONO
50hsa-miR-432*878899-22.2129
uCUGUACCUCCUCGGUA-GGuc
|| :||||| ||||| ||
gGAGGTGGAGATGCCATGCCga
NONO
miR-328
Target on HDV 
Binding site 975-996
mfe : -31.3
Hybrid sequence
ugCCUUCCCGUCUCUCCCGGUC
tgGGGAGAGGAGGGAGGGTCGG miR-328
Target on HDV 
Binding site 248-285
mfe : -28.7
Hybrid sequence
uGCCUUCCC------------GUCU--CUCC--CGGUc
cCCGAAGGGTTGAGAGTACCCCAGAGGGAGGAAGCCAc miR-191*
Target on HDV 
Binding site 1094-1120
mfe : -28
Hybrid sequence
CCCCUGCUUU-----AGGUUCGCGucg
GGGGACGAAGCCGCCCCCGGGCGCtcc miR-370
Target on HDV 
Binding site 1138-1164
mfe : -27.7
Hybrid sequence
gguCCAAG-GUGG-----GGUCGUCCG
gggGGTTCACACCCCCAACCTGCGGGC miR-422a
Target on HDV 
Binding site 1335-1353
mfe : -27.2
Hybrid sequence
CCGGAAGACUGGGAUUCAGGUC
GGCC-TCT--TCCTAGGTCCGG miR-133a
Target on HDV 
Binding site 719-747
mfe : -27.02
Hybrid sequence
uGUCGACC------AA-CUUCCCCUGGuu
cCGGCTGGGCAACATTCCGAGGGGACCgt miR-328
Target on HDV 
Binding site 160-181
mfe : -26.8
Hybrid sequence
ugCCUUCCCGUCUCUCCCgguc
taGGAAGGGGAAAGAGGGaagg miR-129
Target on HDV 
Binding site 861-881
mfe : -26.7
Hybrid sequence
cGUUCGGGUCUGGCGUUUUUC
cCCAGGTCGGACCGCGAGGAG miR-526c
Target on HDV 
Binding site 330-351
mfe : -25.9
Hybrid sequence
UUGUCUUUCGCGAAGGGAGAUCUC
AACAGAGAGCGCAT--CGCGAGAG miR-127
Target on HDV 
Binding site 4-28
mfe : -25.6
Hybrid sequence
UCGGUUCGAGUC-UG--CCUAGGCu
AGCCAAGTTCCGAACAAGGATTCGc miR-149
Target on HDV 
Binding site 274-295
mfe : -25.3
Hybrid sequence
CCUCACUUC--UGUGCCUCGGUCU
GGAG-GAAGCCACACGGAG-TAGA miR-491
Target on HDV 
Binding site 681-714
mfe : -25.3
Hybrid sequence
aGGAGUACCUUC----CCA-------AGGGGUGA
aCCTGATGGCCGGCATGGTCCCAGCCTCCTCGCT miR-205
Target on HDV 
Binding site 969-989
mfe : -25.1
Hybrid sequence
GUCUGAGGCCACCUUACUUCCU
CA-ACTCTGGGGAGAGGAGGGA miR-326
Target on HDV 
Binding site 29-55
mfe : -24.8
Hybrid sequence
gaCCUCCU------UCCCGGG-UCUCC
ggGGAGGATAGATCAGCGCCCGAGAGG miR-423
Target on HDV 
Binding site 191-216
mfe : -24.7
Hybrid sequence
gaCUC--CCCGGA-GUCU-GGCUCga
agGAGGCGGGCCTCCCGATCCGAGgg miR-127
Target on HDV 
Binding site 224-247
mfe : -24.6
Hybrid sequence
uCGGUUCGAGUCUGCCU---AGGCu
gGCCAAGTTTGGA-GGACACTCCGg miR-193b
Target on HDV 
Binding site 544-575
mfe : -24.4
Hybrid sequence
UUUCGCC-CUGAAACU------CCC-GGUCAa
AGGGGGGTGACTTTGAACATTGGGGACCAGTg miR-331
Target on HDV 
Binding site 431-466
mfe : -24.3
Hybrid sequence
aaGAUC--CUAUCC----------GGG---UCCCCg
ggCTAGCAGGTGGGTGTTCCGCCCCCCGAGAGGGGa miR-324-5p
Target on HDV 
Binding site 38-61
mfe : -24.2
Hybrid sequence
UGUGGUUACGGGAUC-CCCUACgc
AGATCAGCGCCCGAGAGGGGTGag miR-326
Target on HDV 
Binding site 206-225
mfe : -24.2
Hybrid sequence
gaccucCUUCCCGGGUCUCC
cgatccGAGGGGCCCGGCGG miR-199a
Target on HDV 
Binding site 544-567
mfe : -24.1
Hybrid sequence
cuuguCCA-UCAGACUUGUGACCC
aggggGGTGACTTTGAACATTGGG miR-133b
Target on HDV 
Binding site 720-747
mfe : -24.02
Hybrid sequence
auCGACC------AA-CUUCCCCUGGuu
cgGCTGGGCAACATTCCGAGGGGACCgt miR-432
Target on HDV 
Binding site 601-625
mfe : -24
Hybrid sequence
GGUGGGUUACUGGA--UGAGGUUCu
CCGCCCAAGCTCCTTCCCCCCAAGg miR-127
Target on HDV 
Binding site 1056-1078
mfe : -23.9
Hybrid sequence
ucGGUUCGAGUCUGCCU-AGGCu
gtCCGAGTAAAGGGGGACTCCGg miR-133a
Target on HDV 
Binding site 436-470
mfe : -23.7
Hybrid sequence
uGUCGACCAAC-------------UUCCCCUGGUu
gCAGGTGGGTGTTCCGCCCCCCGAGAGGGGACGAg miR-518c*
Target on HDV 
Binding site 292-317
mfe : -23.7
Hybrid sequence
gUCUU-UCAC-GAAG-GGAGGUCUCu
tAGAACAGAGAAATCACCTCCAGAGg miR-328
Target on HDV 
Binding site 719-747
mfe : -23.61
Hybrid sequence
uGCCUUCCCG-UCU----CUCCC--GGuc
cCGGCTGGGCAACATTCCGAGGGGACCgt miR-370
Target on HDV 
Binding site 640-660
mfe : -23.6
Hybrid sequence
gGUCCAAGGUGGGGUCGUCCg
gCGGGACCCCACTCTGCAGGg miR-484
Target on HDV 
Binding site 455-479
mfe : -23.5
Hybrid sequence
uaGCCCUCCCCUG---ACUCGGAcu
ccCGAGAGGGGACGAGTGAGGCTta miR-523
Target on HDV 
Binding site 648-668
mfe : -23.5
Hybrid sequence
GG-GAGAUAUCCCUUCGCGCAA
CCACTCTGCAGGG-TCCGCGTT miR-328
Target on HDV 
Binding site 181-204
mfe : -23.4
Hybrid sequence
ugCCUUCCCGUC--UCUCCCGGuc
gtGGAAGAGAAGGAGGCGGGCCtc miR-324-5p
Target on HDV 
Binding site 145-174
mfe : -23.2
Hybrid sequence
UGUGGUUAC---GGGA----UCCCCUacgc
ACGCCAGTGAAACTCTAGGAAGGGGAaaga miR-188
Target on HDV 
Binding site 1119-1144
mfe : -23.1
Hybrid sequence
uGGG----AGGUGGUACGUUCCCUAc
cCCCTCGTTCCACCTTCGAGGGGGTt miR-296
Target on HDV 
Binding site 196-221
mfe : -23.1
Hybrid sequence
uGUCCUAA---CU--CCCCCCCGGGa
gCGGGCCTCCCGATCCGAGGGGCCCg miR-450
Target on HDV 
Binding site 329-351
mfe : -23
Hybrid sequence
auaaUC-CUUGUGUAGCGUUUUu
gaacAGAGAGCGCATCGCGAGAg miR-491
Target on HDV 
Binding site 627-652
mfe : -22.9
Hybrid sequence
AG-GAGUACCUU--C-CCAAGGGGUGA
TCGCCCA-GGAATGGCGGGACCCCACT miR-526b
Target on HDV 
Binding site 435-462
mfe : -22.9
Hybrid sequence
UUGUCU-UUCACGA---AGGGAGUUCUC
AGCAGGTGGGTGTTCCGCCCCCCGAGAG miR-127
Target on HDV 
Binding site 426-452
mfe : -22.8
Hybrid sequence
UCGGUUCGA--GUCUGCCU---AGGCu
AGCGGGGCTAGCAGGTGGGTGTTCCGc miR-431
Target on HDV 
Binding site 216-241
mfe : -22.8
Hybrid sequence
aCGUACUGCCGG-----ACGUUCUGU
gGCCCGGCGGCCAAGTTTGGAGGACA miR-150
Target on HDV 
Binding site 372-395
mfe : -22.7
Hybrid sequence
gugaCC-AUGUUCC-CAACCCUCU
gaggGGATGCTAGGAGTTGGGGGA miR-188
Target on HDV 
Binding site 1046-1072
mfe : -22.5
Hybrid sequence
uGGGAGGUGGUACG-----UUCCCuac
tCCCTCCCCGGTCCGAGTAAAGGGgga miR-211
Target on HDV 
Binding site 245-277
mfe : -22.5
Hybrid sequence
uCC--GCUUCCUA---CU------GUUUCCCUu
cGGCCCGAAGGGTTGAGAGTACCCCAGAGGGAg miR-326
Target on HDV 
Binding site 249-274
mfe : -22.5
Hybrid sequence
GACCUCC---UUCCC---GGGUCUCC
CCGAAGGGTTGAGAGTACCCCAGAGG miR-331
Target on HDV 
Binding site 1365-1397
mfe : -22.5
Hybrid sequence
aAGAUC---CUA-UCCG--------GGUCCCCg
aTCTGGTCCGTTCGGGCCCTCTTCGCCGGGGGa miR-378
Target on HDV 
Binding site 371-394
mfe : -22.5
Hybrid sequence
ugUGUCCUG-GA-CCUCAGUCCUC
ggAGGGGATGCTAGGAGTTGGGGG miR-422b
Target on HDV 
Binding site 1335-1353
mfe : -22.4
Hybrid sequence
CCGGAAGACUGAGG-UUCAGGUC
GGCC-TCT---TCCTAGGTCCGG miR-331
Target on HDV 
Binding site 29-58
mfe : -22.3
Hybrid sequence
aagaUCCUAUC------CGGG---UCCCCg
ggggAGGATAGATCAGCGCCCGAGAGGGGt miR-409-3p
Target on HDV 
Binding site 1138-1161
mfe : -22.3
Hybrid sequence
uCCCCAAGUG-GCUCGUUGUAAGC
gGGGGTTCACACCCCCAACCTGCG miR-340
Target on HDV 
Binding site 431-465
mfe : -22.2
Hybrid sequence
CCGAUAUUUCAUU------------GACUCUGCCu
GGCTAGCAGGTGGGTGTTCCGCCCCCCGAGAGGGg miR-432*
Target on HDV 
Binding site 878-899
mfe : -22.2
Hybrid sequence
uCUGUACCUCCUCGGUA-GGuc
gGAGGTGGAGATGCCATGCCga