Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HEV target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
 Browse   Structural and nonstructural protein mRNA, complete cds   Complete cds   mexican strain) structural proteins and a nonstructural polyprotein genes, complete cds   nonstructural polyprotein and putative capsid protein genes, complete cds   
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 3298 rescords (66 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-miR-324-3p52205241-30.7171
gGUCGUCGUGGACCCCGUCACC
||||:||: :| |||:||||
gCAGCGGCGGTTCCGGCGGTGG
NONO
2hsa-miR-37019041926-30.3132
GGUC-CAAGGUGGGGUC-GUCcg
||:| |||:||||||:| |||
CCGGCGTTTCACCCCGGTCAGcc
NONO
3hsa-miR-43210171040-29.9152
GGUGGGUUACUGGAU-GAGGUUCu
||:||:||||||:|| ||||: |
CCGCCTAATGACTTACCTCCGTGg
NONO
4hsa-miR-32840574083-28.9183
ugCCUUC----CCGUCUC-UCCCGGUC
|||:| ||: ||| ||||||||
gtGGAGGCCATGGTCGAGAAGGGCCAG
NOYes
5hsa-miR-32859135937-27.9153
uGCCUUCCCGUCU-CUC--CCGGUc
|||:: |||:|| ||| |||||
cCGGGGTGGCGGAGGAGGAGGCCAc
NONO
6hsa-miR-503406427-27.8181
GACGU-CUUGACAAGGGCGACGAu
||||: |::| | |||||||||
CTGCGCGGGC--TCCCCGCTGCTg
NOYes
7hsa-miR-324-5p11631190-27.1182
uGUGGUUACG----GGA-UCCCCUACGC
|||: | || :|| ||||||||||
gCACTCAGGCTATATCTAAGGGGATGCG
NOYes
8hsa-miR-32055915613-27130
aaGCG-GGAGAGUUGGGUCGAAaa
||| |||||:|: || ||||
gcCGCTCCTCTTAG-CCCGCTTct
10.314NO
9hsa-miR-14552355259-26.2125
uuCC-CUAAGGACCCUUUUGACCUG
|| |:||:|||||: :|| ||:|
gcGGTGGTTTCTGGGGTGACCGGGC
11.062NO
10hsa-miR-34520512076-26161
cGGGACCUG-----AUCCUCAGUCGu
||| ||:| |:||||||:||
cCCCCGGGCATGTTTGGGAGTCGGCt
NONO
11hsa-miR-370393415-25.9129
GGUC-CAAGGUGGG--GUCGUCCG
||:| |||||:| | | ||:|||
CCGGCGTTCCGCACTGC-GCGGGC
NONO
12hsa-miR-21040094029-25.8158
aGUCGGCGACAGUGUGCGUGUC
|:||| :|| | ||||:||||
cCGGCCATTGGC-CACGTACAG
6.639NO
13hsa-miR-512-5p60026023-25.7130
cuuuCACGGGAGUUCCGACucac
|||||||| :|||||
accgGTGCCCTC-GGGCTGttgg
NONO
14hsa-miR-42552145237-25.6126
CCGCC-UGU-GCUG-UAAGGGCua
||||| :|| ||:| :|||| |
GGCGGCGCAGCGGCGGTTCCGGcg
NONO
15hsa-miR-33127042732-25.5148
aaGAUCCUAUC--------CGGGUCCCCg
||:||| | |||| ||||
gcCTGGGAGCGGAATCACCGCCCCGGGGa
NONO
16hsa-miR-41240494078-25.5148
UGC-CGAUCACCU--GGU-CCA---CUUCa
||| ||||||||| ||| ||| ||||
ACGAGCTAGTGGAGGCCATGGTCGAGAAGg
NONO
17hsa-miR-525*11751195-25.5171
cgAGAUUUCCCUUCGCGGAAG
|||||:|||| ||||| ||
taTCTAAGGGGATGCGCCGTC
NONO
18hsa-miR-42337403765-25.3121
GACUCC-----CCGGAGUCUGGCUCGa
|||||| |||| |||||| ||
CTGAGGAGCTTGGCCACAGACC-TGCc
NONO
19hsa-miR-324-5p60006021-25.1141
UGUGGUUACGGGAUCCCCUACgc
|:|||::|||||| ||| ||
ATACCGGTGCCCT-CGGGCTGtt
NONO
20hsa-miR-42315081533-25133
gACUCCCCGGAGU----CUGGCUCGA
|||||||:|| | |||| |||
aTGAGGGGTCTGATGTCGACCCCGCT
NONO
21hsa-miR-542-5p47664787-25141
gagCACUGUACUACUAGGGGCu
||| ::||:||: |||||
cagGTGTTGTGGTGGCCCCCGg
NONO
22hsa-miR-324-5p46834704-24.9163
uGUGGUUACGGGAUCCCCUACGc
|::||: |||| ||||| |||
cCGTCAGAGCCC-AGGGGCTGCt
NONO
23hsa-miR-52411751195-24.9167
ugAGGUUUCCCUUCGCGGAAG
||:||:|||| ||||| ||
taTCTAAGGGGATGCGCCGTC
NONO
24hsa-miR-42348404862-24.7155
gacuCCCCGGAGUC-UGGCUCGa
|||||| ::| ||||||
aattGGGGCCCTGGCCCCGAGCg
NONO
25hsa-miR-49115041533-24.7128
aGGAGUACCUUCCCA---------AGGGGUGA
||| || ||:|||| ||||:||
gCCT-AT-GAGGGGTCTGATGTCGACCCCGCT
NONO
26hsa-miR-518b46424673-24.7151
uGGAGAUUUCCCC----------UCGCGAAAC
|||:|||||| | ||:||||||
gCCTTTAAAGGTGATGATTCGATAGTGCTTTG
NONO
27hsa-miR-21054025424-24.6127
aGUCGGCGACAGUGUGC-GUGUC
| ||||||| | |||| |::||
cCCGCCGCTGCCTCACGTCGTAG
6.639NO
28hsa-miR-37048424865-24.6136
gguCCAAGG--UGGGG-UCGUCCG
|| || :|||| |||:|||
ttgGGGCCCTGGCCCCGAGCGGGC
NONO
29hsa-miR-29659135937-24.5138
uGUCCUA---ACUCCCCC-CCGGga
|:||:| |||| || ||||
cCGGGGTGGCGGAGGAGGAGGCCac
7.400NO
30hsa-miR-45361396165-24.5124
GCUUGA---GUGGUGCC--UGUUGGag
|||:|| |||||||| :| |||
CGAGCTCACCACCACGGCTGCTACCcg
NONO
31hsa-miR-33959055928-24.4130
ACUC--GAGGACCUCCUGUC-CCU
|||| |||| ||: |:|:| |||
TGAGACCTCCGGGGTGGCGGAGGA
NONO
32hsa-miR-452*61136138-24.4167
GAAGAA-----ACGUCUACUCUGACu
|||| | ||||||||:|||||
CTTCGTCGCGGTGCAGATGGGACTGc
NONO
33hsa-miR-18811561188-24.3145
ugGGAGGUG---GUACG--------UUCCCUAC
|||||:| || || |:||||||
taCCTCCGCACTCAGGCTATATCTAAGGGGATG
5.000NO
34hsa-miR-21428652886-24.3167
GACGG-ACAGACACGGACGACA
| ||| | ||||||| |||||
CGGCCGGGCCTGTGCCGGCTGT
8.407NO
35hsa-miR-37056055625-24.3136
GGUCCAAGGUGGGGUCGUCCg
|| | |||:||||| ||||
CCCGCTTCTACCCCTCCAGGa
NONO
36hsa-miR-37021982217-24.3121
GGUCCAAGGUGGGGUCGUCcg
||| | :|||||:||:|
CCACACT-TACCCCGGCGGcc
NONO
37hsa-miR-12752075235-24.2147
uCGGU-----UCGAGU--CUGCCUAGGCu
|||: :|| || |:||| ||||
cGCCGTGGGCGGCGCAGCGGCGGTTCCGg
5.000NO
38hsa-miR-37032003223-24.2153
GGUCCAAG---GUGGGGUCGUCCG
||:|| || | | ||| |||||
CCGGGCTCGTTCCCGCCATCAGGC
NONO
39hsa-miR-517b11721193-24.2144
uugugAGAUUUCCCUACGUGcu
|||||:|||||||:|
ctataTCTAAGGGGATGCGCcg
NONO
40hsa-miR-363*29752996-24.1149
UUUAACGUAGCACUAGG--UGGGC
| :||| |||||:||| |||||
ACGTTG--TCGTGGTCCCGACCCG
NONO
41hsa-miR-43270127032-24148
GGU-GGGUUACUGGAUGAGGUUCu
||: ||| ||:| |||||:|
CCGCCCCCTTGGC---CTCCAGGg
NONO
42hsa-miR-14940544084-23.8152
ccUCACUUCU-GU----GC----CUCGGUCu
||||:||: || || |:|||||
ctAGTGGAGGCCATGGTCGAGAAGGGCCAGg
5.000NO
43hsa-miR-324-5p27182736-23.7157
uGUGGUUACGGGAUCCCCUACgc
|||| |||| |||||||
tCACC---GCCC-CGGGGATGag
NONO
44hsa-miR-52511811200-23.7141
UCUUUCACGUAGGGAGACCUC
||::: |||: || |||||||
AGGGGATGCG-CCGTCTGGAG
NONO
45hsa-miR-33146794700-23.6180
aagauccuaUC-CGGGUCCCCG
|| ||||||||||
agtaccgtcAGAGCCCAGGGGC
NONO
46hsa-miR-34524382463-23.6121
CGGGACC-UGAUCC---UCAGU-CGU
||||||| : |:|| |||| |||
GCCCTGGCGGTGGGCTCTGTCATGCA
NONO
47hsa-miR-43142074230-23.6156
aCGUACUGCCGGA---CGUUCUGu
|||| |||||| |:|||||
gGCATTTCGGCCTGGAGTAAGACc
NONO
48hsa-miR-32013071330-23.5152
aaGCGG--GAGAGUUGGGUCGAAAa
|||: |||||:: ||:|||||
ggCGCTGGCTCTCGG-CCGGCTTTc
10.314NO
49hsa-miR-33952395259-23.5156
ACUCGAGGACCUC-CUGUCCCu
|| |:|:||||:| ||| |||
TG-GTTTCTGGGGTGACCGGGc
NONO
50hsa-miR-42352335260-23.5159
GACUCC-CCGGAG-----UCUGGCUCGA
| | || ||::|| |||||:|||
CGGCGGTGGTTTCTGGGGTGACCGGGCT
NONO
miR-324-3p
Target on HEV 
Binding site 5220-5241
mfe : -30.7
Hybrid sequence
gGUCGUCGUGGACCCCGUCACC
gCAGCGGCGGTTCCGGCGGTGG miR-370
Target on HEV 
Binding site 1904-1926
mfe : -30.3
Hybrid sequence
GGUC-CAAGGUGGGGUC-GUCcg
CCGGCGTTTCACCCCGGTCAGcc miR-432
Target on HEV 
Binding site 1017-1040
mfe : -29.9
Hybrid sequence
GGUGGGUUACUGGAU-GAGGUUCu
CCGCCTAATGACTTACCTCCGTGg miR-328
Target on HEV 
Binding site 4057-4083
mfe : -28.9
Hybrid sequence
ugCCUUC----CCGUCUC-UCCCGGUC
gtGGAGGCCATGGTCGAGAAGGGCCAG miR-328
Target on HEV 
Binding site 5913-5937
mfe : -27.9
Hybrid sequence
uGCCUUCCCGUCU-CUC--CCGGUc
cCGGGGTGGCGGAGGAGGAGGCCAc miR-503
Target on HEV 
Binding site 406-427
mfe : -27.8
Hybrid sequence
GACGU-CUUGACAAGGGCGACGAu
CTGCGCGGGC--TCCCCGCTGCTg miR-324-5p
Target on HEV 
Binding site 1163-1190
mfe : -27.1
Hybrid sequence
uGUGGUUACG----GGA-UCCCCUACGC
gCACTCAGGCTATATCTAAGGGGATGCG miR-320
Target on HEV 
Binding site 5591-5613
mfe : -27
Hybrid sequence
aaGCG-GGAGAGUUGGGUCGAAaa
gcCGCTCCTCTTAG-CCCGCTTct miR-145
Target on HEV 
Binding site 5235-5259
mfe : -26.2
Hybrid sequence
uuCC-CUAAGGACCCUUUUGACCUG
gcGGTGGTTTCTGGGGTGACCGGGC miR-345
Target on HEV 
Binding site 2051-2076
mfe : -26
Hybrid sequence
cGGGACCUG-----AUCCUCAGUCGu
cCCCCGGGCATGTTTGGGAGTCGGCt miR-370
Target on HEV 
Binding site 393-415
mfe : -25.9
Hybrid sequence
GGUC-CAAGGUGGG--GUCGUCCG
CCGGCGTTCCGCACTGC-GCGGGC miR-210
Target on HEV 
Binding site 4009-4029
mfe : -25.8
Hybrid sequence
aGUCGGCGACAGUGUGCGUGUC
cCGGCCATTGGC-CACGTACAG miR-512-5p
Target on HEV 
Binding site 6002-6023
mfe : -25.7
Hybrid sequence
cuuuCACGGGAGUUCCGACucac
accgGTGCCCTC-GGGCTGttgg miR-425
Target on HEV 
Binding site 5214-5237
mfe : -25.6
Hybrid sequence
CCGCC-UGU-GCUG-UAAGGGCua
GGCGGCGCAGCGGCGGTTCCGGcg miR-331
Target on HEV 
Binding site 2704-2732
mfe : -25.5
Hybrid sequence
aaGAUCCUAUC--------CGGGUCCCCg
gcCTGGGAGCGGAATCACCGCCCCGGGGa miR-412
Target on HEV 
Binding site 4049-4078
mfe : -25.5
Hybrid sequence
UGC-CGAUCACCU--GGU-CCA---CUUCa
ACGAGCTAGTGGAGGCCATGGTCGAGAAGg miR-525*
Target on HEV 
Binding site 1175-1195
mfe : -25.5
Hybrid sequence
cgAGAUUUCCCUUCGCGGAAG
taTCTAAGGGGATGCGCCGTC miR-423
Target on HEV 
Binding site 3740-3765
mfe : -25.3
Hybrid sequence
GACUCC-----CCGGAGUCUGGCUCGa
CTGAGGAGCTTGGCCACAGACC-TGCc miR-324-5p
Target on HEV 
Binding site 6000-6021
mfe : -25.1
Hybrid sequence
UGUGGUUACGGGAUCCCCUACgc
ATACCGGTGCCCT-CGGGCTGtt miR-423
Target on HEV 
Binding site 1508-1533
mfe : -25
Hybrid sequence
gACUCCCCGGAGU----CUGGCUCGA
aTGAGGGGTCTGATGTCGACCCCGCT miR-542-5p
Target on HEV 
Binding site 4766-4787
mfe : -25
Hybrid sequence
gagCACUGUACUACUAGGGGCu
cagGTGTTGTGGTGGCCCCCGg miR-324-5p
Target on HEV 
Binding site 4683-4704
mfe : -24.9
Hybrid sequence
uGUGGUUACGGGAUCCCCUACGc
cCGTCAGAGCCC-AGGGGCTGCt miR-524
Target on HEV 
Binding site 1175-1195
mfe : -24.9
Hybrid sequence
ugAGGUUUCCCUUCGCGGAAG
taTCTAAGGGGATGCGCCGTC miR-423
Target on HEV 
Binding site 4840-4862
mfe : -24.7
Hybrid sequence
gacuCCCCGGAGUC-UGGCUCGa
aattGGGGCCCTGGCCCCGAGCg miR-491
Target on HEV 
Binding site 1504-1533
mfe : -24.7
Hybrid sequence
aGGAGUACCUUCCCA---------AGGGGUGA
gCCT-AT-GAGGGGTCTGATGTCGACCCCGCT miR-518b
Target on HEV 
Binding site 4642-4673
mfe : -24.7
Hybrid sequence
uGGAGAUUUCCCC----------UCGCGAAAC
gCCTTTAAAGGTGATGATTCGATAGTGCTTTG miR-210
Target on HEV 
Binding site 5402-5424
mfe : -24.6
Hybrid sequence
aGUCGGCGACAGUGUGC-GUGUC
cCCGCCGCTGCCTCACGTCGTAG miR-370
Target on HEV 
Binding site 4842-4865
mfe : -24.6
Hybrid sequence
gguCCAAGG--UGGGG-UCGUCCG
ttgGGGCCCTGGCCCCGAGCGGGC miR-296
Target on HEV 
Binding site 5913-5937
mfe : -24.5
Hybrid sequence
uGUCCUA---ACUCCCCC-CCGGga
cCGGGGTGGCGGAGGAGGAGGCCac miR-453
Target on HEV 
Binding site 6139-6165
mfe : -24.5
Hybrid sequence
GCUUGA---GUGGUGCC--UGUUGGag
CGAGCTCACCACCACGGCTGCTACCcg miR-339
Target on HEV 
Binding site 5905-5928
mfe : -24.4
Hybrid sequence
ACUC--GAGGACCUCCUGUC-CCU
TGAGACCTCCGGGGTGGCGGAGGA miR-452*
Target on HEV 
Binding site 6113-6138
mfe : -24.4
Hybrid sequence
GAAGAA-----ACGUCUACUCUGACu
CTTCGTCGCGGTGCAGATGGGACTGc miR-188
Target on HEV 
Binding site 1156-1188
mfe : -24.3
Hybrid sequence
ugGGAGGUG---GUACG--------UUCCCUAC
taCCTCCGCACTCAGGCTATATCTAAGGGGATG miR-214
Target on HEV 
Binding site 2865-2886
mfe : -24.3
Hybrid sequence
GACGG-ACAGACACGGACGACA
CGGCCGGGCCTGTGCCGGCTGT miR-370
Target on HEV 
Binding site 5605-5625
mfe : -24.3
Hybrid sequence
GGUCCAAGGUGGGGUCGUCCg
CCCGCTTCTACCCCTCCAGGa miR-370
Target on HEV 
Binding site 2198-2217
mfe : -24.3
Hybrid sequence
GGUCCAAGGUGGGGUCGUCcg
CCACACT-TACCCCGGCGGcc miR-127
Target on HEV 
Binding site 5207-5235
mfe : -24.2
Hybrid sequence
uCGGU-----UCGAGU--CUGCCUAGGCu
cGCCGTGGGCGGCGCAGCGGCGGTTCCGg miR-370
Target on HEV 
Binding site 3200-3223
mfe : -24.2
Hybrid sequence
GGUCCAAG---GUGGGGUCGUCCG
CCGGGCTCGTTCCCGCCATCAGGC miR-517b
Target on HEV 
Binding site 1172-1193
mfe : -24.2
Hybrid sequence
uugugAGAUUUCCCUACGUGcu
ctataTCTAAGGGGATGCGCcg miR-363*
Target on HEV 
Binding site 2975-2996
mfe : -24.1
Hybrid sequence
UUUAACGUAGCACUAGG--UGGGC
ACGTTG--TCGTGGTCCCGACCCG miR-432
Target on HEV 
Binding site 7012-7032
mfe : -24
Hybrid sequence
GGU-GGGUUACUGGAUGAGGUUCu
CCGCCCCCTTGGC---CTCCAGGg miR-149
Target on HEV 
Binding site 4054-4084
mfe : -23.8
Hybrid sequence
ccUCACUUCU-GU----GC----CUCGGUCu
ctAGTGGAGGCCATGGTCGAGAAGGGCCAGg miR-324-5p
Target on HEV 
Binding site 2718-2736
mfe : -23.7
Hybrid sequence
uGUGGUUACGGGAUCCCCUACgc
tCACC---GCCC-CGGGGATGag miR-525
Target on HEV 
Binding site 1181-1200
mfe : -23.7
Hybrid sequence
UCUUUCACGUAGGGAGACCUC
AGGGGATGCG-CCGTCTGGAG miR-331
Target on HEV 
Binding site 4679-4700
mfe : -23.6
Hybrid sequence
aagauccuaUC-CGGGUCCCCG
agtaccgtcAGAGCCCAGGGGC miR-345
Target on HEV 
Binding site 2438-2463
mfe : -23.6
Hybrid sequence
CGGGACC-UGAUCC---UCAGU-CGU
GCCCTGGCGGTGGGCTCTGTCATGCA miR-431
Target on HEV 
Binding site 4207-4230
mfe : -23.6
Hybrid sequence
aCGUACUGCCGGA---CGUUCUGu
gGCATTTCGGCCTGGAGTAAGACc miR-320
Target on HEV 
Binding site 1307-1330
mfe : -23.5
Hybrid sequence
aaGCGG--GAGAGUUGGGUCGAAAa
ggCGCTGGCTCTCGG-CCGGCTTTc miR-339
Target on HEV 
Binding site 5239-5259
mfe : -23.5
Hybrid sequence
ACUCGAGGACCUC-CUGUCCCu
TG-GTTTCTGGGGTGACCGGGc miR-423
Target on HEV 
Binding site 5233-5260
mfe : -23.5
Hybrid sequence
GACUCC-CCGGAG-----UCUGGCUCGA
CGGCGGTGGTTTCTGGGGTGACCGGGCT