Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HAV wildtype target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-10
The miRNA expression : 5(low) - 12(high).

Total 1778 rescords (36 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-miR-37026772696-28.7171
GGUCCAAGGUGGGGUCGUCCg
|| |||| |||:||||:|||
CCTGGTT-CACTCCAGTAGGt
NONO
2hsa-miR-125b49815003-27.1193
AGUG-UUCAAUCCCAGAGUCCCU
|||: :||||: |||||||||||
TCATGGAGTTGTGGTCTCAGGGA
10.846NO
3hsa-miR-99b386407-26.7178
GCGUUCCAGCCA--AGAUGCCCAC
| ||||| ||| |||||||||
CACAAGG--GGTAGGCTACGGGTG
7.475Yes
4hsa-miR-34527112735-26172
cGGGAC----CUGAUCCUCAGUCGu
||:|| || ||||||||||
tCCTTGGGTAGAGAAGGAGTCAGCt
NOYes
5hsa-miR-125a49825003-25.7181
GUGUC-CAAUUUCCCAGAGUCCCU
||::| ||| : |||||||||||
CATGGAGTT--GTGGTCTCAGGGA
10.086NO
6hsa-miR-324-5p238267-24.6122
uguGGUUACGGGAUC-----CC--CUACGC
|| |||||||| || | ||||
ctcCCCTTGCCCTAGGCTCTGGCCGTTGCG
NONO
7hsa-miR-32827102733-24.3132
ugccuuCCCGUCUC-UCC-CGGUC
|||:|||| ||| |:|||
ctccttGGGTAGAGAAGGAGTCAG
NONO
8hsa-miR-34a20412064-24178
UUGUUGGUCGAUUC-UGUGACGGU
| ||: || |:|| |||||||||
ATCAGAAAGGTGAGTACACTGCCA
7.376Yes
9hsa-miR-432265289-23.9144
gGUGGGU--UACUGGAUGAGGUUCU
|:|||: : |::| |||||| ||
gCGCCCGGCGGGGTCAACTCCATGA
NONO
10hsa-miR-18821752196-23.8124
uGGGAGGUGGUACGUUCCCUAC
|:||::|:||||| | |||||
cCTCTTTATCATGCTATGGATG
5.000NO
11hsa-miR-125b120-23.4159
aguGUUCAAUCCCAGAGUCCCU
|||| :||||||| ||||
-ttCAAG-AGGGGTCTCCGGGA
10.846NO
12hsa-miR-33162146244-23.4150
AAGAUC-----CUAU-CCG----GGUCCCCG
||:||| |||| ||| |||||||
TTTTAGATCTTGATATGGCCATTACAGGGGC
NONO
13hsa-miR-345441461-23.4124
CGGGACCUGAUCCUCA--GUCGu
|||:|||| || |:|| ||||
GCCTTGGA-TA-GGGTAACAGCg
NONO
14hsa-miR-21228342855-23.22123
cCGGCACUGACCUC-UGACaau
||:||| |||||| ||||
tGCTGTGTCTGGAGCACTGgat
5.000NO
15hsa-miR-145630656-23.2158
UUCCCUA---AGGACCCUUUUGACCUG
|:||||| ||| || |:||||||
AGGGGATCCCTCCATTGACAGCTGGAC
11.062NO
16hsa-miR-32068426875-23.2157
AAG---CGGGAGAGUU---GG-----GUCGAAAa
||| ||||||| :: || |||||||
TTCAATGCCCTCTGGGTCTCCTTGTACAGCTTTg
10.314NO
17hsa-miR-37823142340-23137
UGUGUCC--UGGACCU---CAGUCCUC
||| ||| | |||| |||||||
ACAGAGGGAAAATGGATGTTTCAGGAG
NONO
18hsa-miR-2411861207-22.8148
gaCAAGGACGACUUGACUCGGU
||||||| ||| | ||||:|
tgGTTCCTGGTGACCAGAGCTA
11.006NO
19hsa-miR-50332933315-22.72134
GACGUCUUGACAAGGGCGACGAU
||| |||: ||| |:|||| ||
CTGGAGAGGTGTGACTGCTGATA
NONO
20hsa-miR-29657965818-22.7173
uGUCCUAACUC-CC-CCCCGGGA
| ||| || | || ||||||:|
cCTGGAATGTGTGGTGGGGCCTT
7.400NO
21hsa-miR-49255385563-22.7125
uUCUUAGAACAGG---GCGUCCAGGa
||:|| ||||:| :| ||||:|
cAGGATGTTGTTCTGATGAAGGTTCc
NONO
22hsa-miR-14533853410-22.52124
uuCCCUAAG---GACCCUUUUGACcug
|||:||| ||||| |:||||
ctGGGGTTCTTACTGGG-AGACTGatt
11.062NO
23hsa-miR-99a386407-22.5173
GUGUU--CUAGCCUAGAUGCCCAa
||||| |:| || ||||||||
CACAAGGGGTAGG--CTACGGGTg
9.146Yes
24hsa-miR-125a120-22.4155
guGUCCAAUUUCCCAGAGUCCCU
|| | |:||||||| ||||
ttCAAG---AGGGGTCTCCGGGA
10.086NO
25hsa-miR-216887909-22.1144
guGUCAACG---GUCGACUCUAAu
||||| | ||||||||:||
ttCAGTT-CATACAGCTGAGGTTg
5.000NO
26hsa-miR-296615640-22.1154
UGUCCUA--ACUC-CCCCCC--GGGA
|::|||| || | | |||| ||||
ATGGGATTCTGTGAGAGGGGATCCCT
7.400NO
27hsa-miR-324-3p26492676-22.1128
gGUCGUCGUGGAC-----C--CCGUCACC
||| |||| ||| | |||| |||
aCAGGAGCAACTGATGTAGATGGCA-TGG
NONO
28hsa-miR-542-3p29392963-22.1178
AAAGUCAAUAGU---UAGACAGUGU
|||:||||:|:| :|||||||||
TTTTAGTTGTTATTTGTCTGTCACA
NOYes
29hsa-miR-181a48184841-22164
uGAGUG--GCUGUCGCAACUUACAA
||||| :||:| :||||||||||
cCTCACAATGATA-TGTTGAATGTT
9.523NO
30hsa-miR-339150171-22127
ACUCGAGGACCUCC-UGUCCCu
| | :||||| ||| |||||
TTAATTCCTGCAGGTTCAGGGt
NONO
31hsa-miR-100386407-21.9172
GUGUUCAAGCCUA---GAUGCCCAa
|||||| ||:| ||||||||
CACAAG---GGGTAGGCTACGGGTg
9.137Yes
32hsa-miR-2433013324-21.9136
gACAAGGACGACU-UGA-CUCGgu
||| ||||||| ||| ||||
gTGTGACTGCTGATACTAGAGCtt
11.006NO
33hsa-miR-331686704-21.9163
aAGAUCCUAUCCGGGUCCCCG
|||: |:|| |:|||||||
cTCTGAGGTA--CTCAGGGGC
NONO
34hsa-miR-34c827849-21.9131
cGUUAGUCGAUUGAUGUGACGga
|||||||:|:|: : |||||
tCAATCAGTTGATAGGACTGCag
6.403NO
35hsa-miR-501515543-21.9124
AGAGUGGGUC-CCU--G----UUUCCUAA
|||||:|||| ||| | |: |||||
TCTCATCCAGTGGATGCATTGAGTGGATT
NONO
36hsa-miR-99a121-21.9135
guGUUCUAGCCUAGAUGCCCaa
||||| ||:||| ||||
ttCAAGA-GGGGTCTCCGGGaa
9.146NO
37hsa-miR-34c20372064-21.8180
CGU-UAG----UCGAUUGAUGUGACGGa
||| ||| || |:| |||||||||
GCACATCAGAAAGGTGAGTACACTGCCa
6.403Yes
38hsa-miR-370256277-21.8143
GGUC--CAAGGUGGGGUCGUCCg
|::| ||| |: |||:||:||
CTGGCCGTTGCG-CCCGGCGGGg
NONO
39hsa-miR-181b640660-21.7122
gGGUGGCUGUCGUUACUU-ACAA
|||::|||||| ||:| ||||
tCCATTGACAGC--TGGACTGTT
6.484NO
40hsa-miR-193b23492384-21.7130
uuuCGCCCU-GA----------AACUCCC--GGUCAA
|:|||| || |||| || ||||||
cctGTGGGAGCTATCACAACAATTGA-GGATCCAGTT
NONO
41hsa-miR-34045264547-21.7147
CCGAUAUUUCAUUGACUCUGCCU
|||| | |: | ||||:||:|||
GGCT-TCAGATTACTGGGATGGA
NONO
42hsa-miR-217825851-21.6148
UAGGUUAGUCAAGGA--CU-ACGUCAu
||:||||||||| | || ||||||
ATTCAATCAGTTGATAGGACTGCAGTg
5.000NO
43hsa-miR-520d56885719-21.6136
uuGGGUGGU-------UUCUC-UUCG-UGAAa
|||||:| ||||| |||| ||||
ggCCCACTAAAGATGGAAGAGAAAGCTACTTa
NONO
44hsa-miR-339435454-21.4146
aCUCGA-GGACCUCCUGUCCCu
||| | ||| |||:||||
aGAGATGCCT--TGGATAGGGt
NONO
45hsa-miR-32533783401-21.3123
ugugaAUGA-CCUGUGGAUGAUCC
|:|| ||:: |:||||:||
atggaTGCTGGGGTTCTTACTGGG
NONO
46hsa-miR-409-5p386413-21.3131
acGUU--UCA-ACGA-GCCCA--UUGGA
||| :|| ||| ||||| |||||
caCAAGGGGTAGGCTACGGGTGAAACCT
NONO
47hsa-miR-49751065127-21.3141
UGUUUGGUG-UCACACGACGAC
|| ||:||| |||| |:|||||
ACTAATCACAAGTGGGTTGCTG
NONO
48hsa-miR-519d46604689-21.3145
uGUGAGA------UUUCCC-UCCGUGAAAc
| |||| :||||| |||||:|||
cCTCTCTTGAGGAGAAGGGTAGGCATTTTt
NONO
49hsa-miR-15033763404-21.2136
gUGACC-AUGUUCCC------AACCCUCU
| ||| |:| :||| |||||||
aAATGGATGCTGGGGTTCTTACTGGGAGA
7.336NO
50hsa-miR-15010791100-21.2121
guGACCAUGUUCCCAAC-CCUCU
|| || ||||||||| ||||
tgCT-GTTCAAGGGTTGTTGAGA
7.336NO
miR-370
Target on HAV 
Binding site 2677-2696
mfe : -28.7
Hybrid sequence
GGUCCAAGGUGGGGUCGUCCg
CCTGGTT-CACTCCAGTAGGt miR-125b
Target on HAV 
Binding site 4981-5003
mfe : -27.1
Hybrid sequence
AGUG-UUCAAUCCCAGAGUCCCU
TCATGGAGTTGTGGTCTCAGGGA miR-99b
Target on HAV 
Binding site 386-407
mfe : -26.7
Hybrid sequence
GCGUUCCAGCCA--AGAUGCCCAC
CACAAGG--GGTAGGCTACGGGTG miR-345
Target on HAV 
Binding site 2711-2735
mfe : -26
Hybrid sequence
cGGGAC----CUGAUCCUCAGUCGu
tCCTTGGGTAGAGAAGGAGTCAGCt miR-125a
Target on HAV 
Binding site 4982-5003
mfe : -25.7
Hybrid sequence
GUGUC-CAAUUUCCCAGAGUCCCU
CATGGAGTT--GTGGTCTCAGGGA miR-324-5p
Target on HAV 
Binding site 238-267
mfe : -24.6
Hybrid sequence
uguGGUUACGGGAUC-----CC--CUACGC
ctcCCCTTGCCCTAGGCTCTGGCCGTTGCG miR-328
Target on HAV 
Binding site 2710-2733
mfe : -24.3
Hybrid sequence
ugccuuCCCGUCUC-UCC-CGGUC
ctccttGGGTAGAGAAGGAGTCAG miR-34a
Target on HAV 
Binding site 2041-2064
mfe : -24
Hybrid sequence
UUGUUGGUCGAUUC-UGUGACGGU
ATCAGAAAGGTGAGTACACTGCCA miR-432
Target on HAV 
Binding site 265-289
mfe : -23.9
Hybrid sequence
gGUGGGU--UACUGGAUGAGGUUCU
gCGCCCGGCGGGGTCAACTCCATGA miR-188
Target on HAV 
Binding site 2175-2196
mfe : -23.8
Hybrid sequence
uGGGAGGUGGUACGUUCCCUAC
cCTCTTTATCATGCTATGGATG miR-125b
Target on HAV 
Binding site 1-20
mfe : -23.4
Hybrid sequence
aguGUUCAAUCCCAGAGUCCCU
-ttCAAG-AGGGGTCTCCGGGA miR-331
Target on HAV 
Binding site 6214-6244
mfe : -23.4
Hybrid sequence
AAGAUC-----CUAU-CCG----GGUCCCCG
TTTTAGATCTTGATATGGCCATTACAGGGGC miR-345
Target on HAV 
Binding site 441-461
mfe : -23.4
Hybrid sequence
CGGGACCUGAUCCUCA--GUCGu
GCCTTGGA-TA-GGGTAACAGCg miR-212
Target on HAV 
Binding site 2834-2855
mfe : -23.22
Hybrid sequence
cCGGCACUGACCUC-UGACaau
tGCTGTGTCTGGAGCACTGgat miR-145
Target on HAV 
Binding site 630-656
mfe : -23.2
Hybrid sequence
UUCCCUA---AGGACCCUUUUGACCUG
AGGGGATCCCTCCATTGACAGCTGGAC miR-320
Target on HAV 
Binding site 6842-6875
mfe : -23.2
Hybrid sequence
AAG---CGGGAGAGUU---GG-----GUCGAAAa
TTCAATGCCCTCTGGGTCTCCTTGTACAGCTTTg miR-378
Target on HAV 
Binding site 2314-2340
mfe : -23
Hybrid sequence
UGUGUCC--UGGACCU---CAGUCCUC
ACAGAGGGAAAATGGATGTTTCAGGAG miR-24
Target on HAV 
Binding site 1186-1207
mfe : -22.8
Hybrid sequence
gaCAAGGACGACUUGACUCGGU
tgGTTCCTGGTGACCAGAGCTA miR-503
Target on HAV 
Binding site 3293-3315
mfe : -22.72
Hybrid sequence
GACGUCUUGACAAGGGCGACGAU
CTGGAGAGGTGTGACTGCTGATA miR-296
Target on HAV 
Binding site 5796-5818
mfe : -22.7
Hybrid sequence
uGUCCUAACUC-CC-CCCCGGGA
cCTGGAATGTGTGGTGGGGCCTT miR-492
Target on HAV 
Binding site 5538-5563
mfe : -22.7
Hybrid sequence
uUCUUAGAACAGG---GCGUCCAGGa
cAGGATGTTGTTCTGATGAAGGTTCc miR-145
Target on HAV 
Binding site 3385-3410
mfe : -22.52
Hybrid sequence
uuCCCUAAG---GACCCUUUUGACcug
ctGGGGTTCTTACTGGG-AGACTGatt miR-99a
Target on HAV 
Binding site 386-407
mfe : -22.5
Hybrid sequence
GUGUU--CUAGCCUAGAUGCCCAa
CACAAGGGGTAGG--CTACGGGTg miR-125a
Target on HAV 
Binding site 1-20
mfe : -22.4
Hybrid sequence
guGUCCAAUUUCCCAGAGUCCCU
ttCAAG---AGGGGTCTCCGGGA miR-216
Target on HAV 
Binding site 887-909
mfe : -22.1
Hybrid sequence
guGUCAACG---GUCGACUCUAAu
ttCAGTT-CATACAGCTGAGGTTg miR-296
Target on HAV 
Binding site 615-640
mfe : -22.1
Hybrid sequence
UGUCCUA--ACUC-CCCCCC--GGGA
ATGGGATTCTGTGAGAGGGGATCCCT miR-324-3p
Target on HAV 
Binding site 2649-2676
mfe : -22.1
Hybrid sequence
gGUCGUCGUGGAC-----C--CCGUCACC
aCAGGAGCAACTGATGTAGATGGCA-TGG miR-542-3p
Target on HAV 
Binding site 2939-2963
mfe : -22.1
Hybrid sequence
AAAGUCAAUAGU---UAGACAGUGU
TTTTAGTTGTTATTTGTCTGTCACA miR-181a
Target on HAV 
Binding site 4818-4841
mfe : -22
Hybrid sequence
uGAGUG--GCUGUCGCAACUUACAA
cCTCACAATGATA-TGTTGAATGTT miR-339
Target on HAV 
Binding site 150-171
mfe : -22
Hybrid sequence
ACUCGAGGACCUCC-UGUCCCu
TTAATTCCTGCAGGTTCAGGGt miR-100
Target on HAV 
Binding site 386-407
mfe : -21.9
Hybrid sequence
GUGUUCAAGCCUA---GAUGCCCAa
CACAAG---GGGTAGGCTACGGGTg miR-24
Target on HAV 
Binding site 3301-3324
mfe : -21.9
Hybrid sequence
gACAAGGACGACU-UGA-CUCGgu
gTGTGACTGCTGATACTAGAGCtt miR-331
Target on HAV 
Binding site 686-704
mfe : -21.9
Hybrid sequence
aAGAUCCUAUCCGGGUCCCCG
cTCTGAGGTA--CTCAGGGGC miR-34c
Target on HAV 
Binding site 827-849
mfe : -21.9
Hybrid sequence
cGUUAGUCGAUUGAUGUGACGga
tCAATCAGTTGATAGGACTGCag miR-501
Target on HAV 
Binding site 515-543
mfe : -21.9
Hybrid sequence
AGAGUGGGUC-CCU--G----UUUCCUAA
TCTCATCCAGTGGATGCATTGAGTGGATT miR-99a
Target on HAV 
Binding site 1-21
mfe : -21.9
Hybrid sequence
guGUUCUAGCCUAGAUGCCCaa
ttCAAGA-GGGGTCTCCGGGaa miR-34c
Target on HAV 
Binding site 2037-2064
mfe : -21.8
Hybrid sequence
CGU-UAG----UCGAUUGAUGUGACGGa
GCACATCAGAAAGGTGAGTACACTGCCa miR-370
Target on HAV 
Binding site 256-277
mfe : -21.8
Hybrid sequence
GGUC--CAAGGUGGGGUCGUCCg
CTGGCCGTTGCG-CCCGGCGGGg miR-181b
Target on HAV 
Binding site 640-660
mfe : -21.7
Hybrid sequence
gGGUGGCUGUCGUUACUU-ACAA
tCCATTGACAGC--TGGACTGTT miR-193b
Target on HAV 
Binding site 2349-2384
mfe : -21.7
Hybrid sequence
uuuCGCCCU-GA----------AACUCCC--GGUCAA
cctGTGGGAGCTATCACAACAATTGA-GGATCCAGTT miR-340
Target on HAV 
Binding site 4526-4547
mfe : -21.7
Hybrid sequence
CCGAUAUUUCAUUGACUCUGCCU
GGCT-TCAGATTACTGGGATGGA miR-217
Target on HAV 
Binding site 825-851
mfe : -21.6
Hybrid sequence
UAGGUUAGUCAAGGA--CU-ACGUCAu
ATTCAATCAGTTGATAGGACTGCAGTg miR-520d
Target on HAV 
Binding site 5688-5719
mfe : -21.6
Hybrid sequence
uuGGGUGGU-------UUCUC-UUCG-UGAAa
ggCCCACTAAAGATGGAAGAGAAAGCTACTTa miR-339
Target on HAV 
Binding site 435-454
mfe : -21.4
Hybrid sequence
aCUCGA-GGACCUCCUGUCCCu
aGAGATGCCT--TGGATAGGGt miR-325
Target on HAV 
Binding site 3378-3401
mfe : -21.3
Hybrid sequence
ugugaAUGA-CCUGUGGAUGAUCC
atggaTGCTGGGGTTCTTACTGGG miR-409-5p
Target on HAV 
Binding site 386-413
mfe : -21.3
Hybrid sequence
acGUU--UCA-ACGA-GCCCA--UUGGA
caCAAGGGGTAGGCTACGGGTGAAACCT miR-497
Target on HAV 
Binding site 5106-5127
mfe : -21.3
Hybrid sequence
UGUUUGGUG-UCACACGACGAC
ACTAATCACAAGTGGGTTGCTG miR-519d
Target on HAV 
Binding site 4660-4689
mfe : -21.3
Hybrid sequence
uGUGAGA------UUUCCC-UCCGUGAAAc
cCTCTCTTGAGGAGAAGGGTAGGCATTTTt miR-150
Target on HAV 
Binding site 3376-3404
mfe : -21.2
Hybrid sequence
gUGACC-AUGUUCCC------AACCCUCU
aAATGGATGCTGGGGTTCTTACTGGGAGA miR-150
Target on HAV 
Binding site 1079-1100
mfe : -21.2
Hybrid sequence
guGACCAUGUUCCCAAC-CCUCU
tgCT-GTTCAAGGGTTGTTGAGA