Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HDV target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
 Browse    HDV RNA genome   HDVJS   
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 670 rescords (14 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-miR-107581602-17121
aCUAUCGGGACAUGUUACGAcga
|||: |||| |:|||||
gGATGCCCCT-CCCGATGCTcga
9.255NO
2hsa-miR-10712731302-16121
aCUAUCG---GGA--CA--UGUUACGACGa
|| :|| ||| || :::|| ||||
cGAGGGCCTTCCTTCGTCGGTGATCCTGCc
9.255NO
3hsa-miR-126331351-12.3121
cguaauaAUGAGUGCCAUGCU
| | :||||| ||
gaggcgcTTCGAGCGGTAGGA
10.720NO
4hsa-miR-133b13611382-12.5121
aUCGACCA-ACUUCCCCUGGuu
| ||||| | ||| ||
cATCTGGTCCGTTCGGGCCCtc
NONO
5hsa-miR-136818840-13.61121
AGGUAGUAGUUUUGUUUACCUca
||| |:| | | |:|:||||
TCCCTTAGCCATCCGAGTGGAcg
7.279NO
6hsa-miR-138133151-17.3121
CUA--AGUGUUGUGGUCga
||| ||||||:||:|
GATCCCCACAACGCCGGag
5.000NO
7hsa-miR-18a*1738-19.2121
UC-UUCCUC-GUGAAUCCCGUCa
|| :||||| |:| :||| ||
AGCGAGGAGACGC-GGGGGGAGg
NONO
8hsa-miR-191709738-15.6121
uCGAC----GAAAACCC----UAAGGCaac
|||| | |||| ||||||
cGCTGGCGCCGGCTGGGCAACATTCCGagg
NONO
9hsa-miR-191*345370-12.9121
CC--CCUGCUUUAGGU-UCGC-GUCg
|| ||| ||: ||| |||| :||
GGTAGGAGTAAGACCATAGCGATAGg
NONO
10hsa-miR-193b15961617-14.1121
uuucGCCCUGAAACUCCCG--GUCAa
||| | | || ||| ||||
atctCGG--C-TAGA-GGCGGCAGTc
NONO
11hsa-miR-197375396-13.93121
CGACCCACCUCUUCCACCACUu
| || |||| ||| || ||
GATGCTAGGAGTAGGAGGAGAc
6.957NO
12hsa-miR-2043057-18121
uCCGUAUCCUACU-----G-UUUCCCUU
|| : ||||| | | |:||||:|
gGGGGGAGGATCAGCTCCCGAGAGGGGA
5.379NO
13hsa-miR-211381405-17.3121
UCCGCUUCCUACU---GUUUCCCUu
||| | |||| || |:||| ||
AGGAGTAGGAGGAGACCGAAGCGAg
5.593NO
14hsa-miR-221795816-13.1121
CU-UUGGGUCGUCUGUUACAUCGA
|| ||:| || ||| || ||:|||
GAGAATCGAG-AGA-AAAGTGGCT
6.194NO
15hsa-miR-299-3p636652-14.22121
uuCGCCAAAUGGUAGGGUGuau
|||| || |||||
tgGCGG--GAC---CCCACtct
NONO
16hsa-miR-299-3p12301252-15.32121
uuCGCCA--AAUGGUAGGGUGuau
| ||| ||:|| ||||:|
ctGAGGTTCTTGCC-TCCCGCcga
NONO
17hsa-miR-302c240266-12.82121
GGU--GACUUUGUACCU--UCGUGaau
||: | |||: :| || |||||
CCGGCCCGAAGGGTTGAGTAGCACcca
NONO
18hsa-miR-326849866-12.3121
gaccuCCUUCCCGGGUCucc
||| ||||||
ccttcGGA--TGCCCAGgtc
NONO
19hsa-miR-32616551673-14.2121
GACCUCCUUCCCGGGUCUCc
||||| : |||| |||
CTGGACTCGCCGCCC-GAGc
NONO
20hsa-miR-328717745-23.61121
uGCCUUCCCG-UCU----CUCCC--GGuc
||| |||| | | ||||| ||
cCGGCTGGGCAACATTCCGAGGGGACCgt
NONO
21hsa-miR-32899121-19.3121
ugcCUUCCCGUCUCUCCCG-GUC
|||| ||||||| | |||
caaGAAGCAAAGAGAGGTCTCAG
NONO
22hsa-miR-33110881113-21121
aaGAUCC---UAUC--CGGGUCCCCG
||:|| : || |||| ||||
gaCTGGGGACGAAGCCGCCCCCGGGC
NONO
23hsa-miR-337369390-15.9121
uuUCCGUAGUAU-AUCCUCGACCU
||| : ||: ||||||: |||
ggAGGAG--ATGCTAGGAGTAGGA
NONO
24hsa-miR-3399831000-14.1121
aCUCGAGGACCU-CCUGUCCCU
|:|| ||| |:| ||||
aGGGC----GGATCGGCTGGGA
NONO
25hsa-miR-3403256-16.5121
CCGAUAUU--UCAUUGACUCUGCCu
|| | :| || | |||| ||
GGGGAGGATCAGCTCCCGAGAGGGg
NONO
26hsa-miR-340526549-17.9121
ccgauaUUUCAUU-GACUCUGCCu
|||||:| | |||: ||
ccttcgAAAGTGACCGGAGGGGGt
NONO
27hsa-miR-346266298-22.2121
UCUCCGUCC----GUACGC-----C-CGUCUgu
||||| ||| || || | |||||
AGAGGGAGGAATCCACTCGGAGATGAGCAGAga
NONO
28hsa-miR-346621645-16.49121
UCUC--C--GUCCGUACGCCCG-UCUGu
||:| | |||| || ||| :|||
AGGGTCGCCCAGGAAT---GGCGGGACc
NONO
29hsa-miR-34a16461669-14.3121
UUGUUGGUCGAUUCU--GUGACGGu
|: |: | ||| :|| |:| |||
AGGAGACTGCT-GGACTCGCCGCCc
7.376NO
30hsa-miR-363*808832-15.4121
UUUAAC---GUAGCACUAGGUGGGC
||| || | | | | |||:|||
AAAGTGGCTCTCCCTTAGCCATCCG
NONO
31hsa-miR-423436460-22.6121
GACUCCC-C--GGAGUCUGGCUCga
| | ||| | || | |||||
CGGTGGGTGTTCCGCCCCCCGAGag
NONO
32hsa-miR-42310411062-15.6121
gacuccccGGAGUCUGGCUCga
|| |:| |||||
cagcccctCCCCGGTCCGAGag
NONO
33hsa-miR-423329345-17.5121
gaCUCCCCGGAGUCUGGCUCGa
|||| ||: :|||||
aaGAGGCGCT-----TCGAGCg
NONO
34hsa-miR-43116391661-12.2121
ACG-UACUGC-CGGACGUUCUGu
||: | || | | |||| :|||
TGTAAAGAGGAGACTGCTGGACt
NONO
35hsa-miR-43210561078-15.2121
GGUGGGUUACUGGAUGAGGUUCU
||: :| |: |||||::||
CCGAGAGAAGGGGGACTCCGGGA
NONO
36hsa-miR-432*12671286-12.9121
ucuguACCUCCUCGGUAGGuc
| |||| ||| |||
tgttcTCGAGG-GCCTTCCtt
NONO
37hsa-miR-432*303323-15.4121
ucuguacCUCCUCGGUAGGUC
||||| || |:|||
acctccaGAGGACCCCTTCAG
NONO
38hsa-miR-49010601080-19.12121
gUCGUACCUCAGGAGGUCCaac
|| | ||:| ||||:||
gAG-AAGGGGGACTCCGGGact
NONO
39hsa-miR-49110601087-14.8121
aggaguaCCUU----CCC-AAGGGGUGa
||:| ||| ||||::|
gagaaggGGGACTCCGGGACTCCCTGCa
NONO
40hsa-miR-4989791001-14.8121
CUUUUUGCGGGGGACCGAACUUU
|||||: || : |||| |:||
GAAAAGGGCGGATCGGCTGGGAA
NONO
41hsa-miR-50215321552-17.5121
aucGUGGGU--CUAUCGUUCCUA
|||||| | | |:|||||
ggcCACCCACTGCT--CGAGGAT
NONO
42hsa-miR-5041536-14.92121
uaUCUCACGUCUG-GUCCCaga
|| | | |||| |:|||
cgAGCGAGGAGACGCGGGGgga
NONO
43hsa-miR-507277297-14121
AAGUGAGGUUUUCCACGUUUu
| ||||| :|:| | |||:|
TCCACTCGGAGATGAGCAGAg
NONO
44hsa-miR-51016471674-12.1121
aCACUAACGG--UGA---GAGGACUCau
| || |||: ||| | || |||
gGAGACTGCTGGACTCGCCGCCCGAGcc
NONO
45hsa-miR-515-3p258283-20.9121
ugCG-AGGUUUUCUUCC----GUGAG
|| |||:|:|:||| |||||
taGCACCCAGAGGGAGGAATCCACTC
NONO
46hsa-miR-518c*14061427-16.4121
gucuuucACGAAGGGAGGUCUCU
| ||||::||| ||||
atccttaTCCTTCTTTCC-GAGA
NONO
47hsa-miR-52413811402-20121
uGAGGU-UUCCCUUCGCGGAAG
||:|: :|||:||| || ||
tCTTCGCCGGGGGAGCCCCCTC
NONO
48hsa-miR-542-5p570591-13.9121
gAGCACUGUACUACUA-GGGGcu
| | | ||||: ||| ||||
gTGGAGCCATGG-GATGCCCCtc
NONO
49hsa-let-7b15601581-14.9122
uuGGUGUGUUG-GAUGAUGGAGu
|| | | :| | || ||||
ctCC-CTCCGCGGTTCTTCCTCg
11.726NO
50hsa-miR-125a634-12.2122
guGUCCAA---U--UUCC-CAGAGUCCCu
|| ||| | :||| | | |:|||
gcCAAGTTCCGAGCGAGGAGACGCGGGGg
10.086NO
miR-107
Target on HDV 
Binding site 581-602
mfe : -17
Hybrid sequence
aCUAUCGGGACAUGUUACGAcga
gGATGCCCCT-CCCGATGCTcga miR-107
Target on HDV 
Binding site 1273-1302
mfe : -16
Hybrid sequence
aCUAUCG---GGA--CA--UGUUACGACGa
cGAGGGCCTTCCTTCGTCGGTGATCCTGCc miR-126
Target on HDV 
Binding site 331-351
mfe : -12.3
Hybrid sequence
cguaauaAUGAGUGCCAUGCU
gaggcgcTTCGAGCGGTAGGA miR-133b
Target on HDV 
Binding site 1361-1382
mfe : -12.5
Hybrid sequence
aUCGACCA-ACUUCCCCUGGuu
cATCTGGTCCGTTCGGGCCCtc miR-136
Target on HDV 
Binding site 818-840
mfe : -13.61
Hybrid sequence
AGGUAGUAGUUUUGUUUACCUca
TCCCTTAGCCATCCGAGTGGAcg miR-138
Target on HDV 
Binding site 133-151
mfe : -17.3
Hybrid sequence
CUA--AGUGUUGUGGUCga
GATCCCCACAACGCCGGag miR-18a*
Target on HDV 
Binding site 17-38
mfe : -19.2
Hybrid sequence
UC-UUCCUC-GUGAAUCCCGUCa
AGCGAGGAGACGC-GGGGGGAGg miR-191
Target on HDV 
Binding site 709-738
mfe : -15.6
Hybrid sequence
uCGAC----GAAAACCC----UAAGGCaac
cGCTGGCGCCGGCTGGGCAACATTCCGagg miR-191*
Target on HDV 
Binding site 345-370
mfe : -12.9
Hybrid sequence
CC--CCUGCUUUAGGU-UCGC-GUCg
GGTAGGAGTAAGACCATAGCGATAGg miR-193b
Target on HDV 
Binding site 1596-1617
mfe : -14.1
Hybrid sequence
uuucGCCCUGAAACUCCCG--GUCAa
atctCGG--C-TAGA-GGCGGCAGTc miR-197
Target on HDV 
Binding site 375-396
mfe : -13.93
Hybrid sequence
CGACCCACCUCUUCCACCACUu
GATGCTAGGAGTAGGAGGAGAc miR-204
Target on HDV 
Binding site 30-57
mfe : -18
Hybrid sequence
uCCGUAUCCUACU-----G-UUUCCCUU
gGGGGGAGGATCAGCTCCCGAGAGGGGA miR-211
Target on HDV 
Binding site 381-405
mfe : -17.3
Hybrid sequence
UCCGCUUCCUACU---GUUUCCCUu
AGGAGTAGGAGGAGACCGAAGCGAg miR-221
Target on HDV 
Binding site 795-816
mfe : -13.1
Hybrid sequence
CU-UUGGGUCGUCUGUUACAUCGA
GAGAATCGAG-AGA-AAAGTGGCT miR-299-3p
Target on HDV 
Binding site 636-652
mfe : -14.22
Hybrid sequence
uuCGCCAAAUGGUAGGGUGuau
tgGCGG--GAC---CCCACtct miR-299-3p
Target on HDV 
Binding site 1230-1252
mfe : -15.32
Hybrid sequence
uuCGCCA--AAUGGUAGGGUGuau
ctGAGGTTCTTGCC-TCCCGCcga miR-302c
Target on HDV 
Binding site 240-266
mfe : -12.82
Hybrid sequence
GGU--GACUUUGUACCU--UCGUGaau
CCGGCCCGAAGGGTTGAGTAGCACcca miR-326
Target on HDV 
Binding site 849-866
mfe : -12.3
Hybrid sequence
gaccuCCUUCCCGGGUCucc
ccttcGGA--TGCCCAGgtc miR-326
Target on HDV 
Binding site 1655-1673
mfe : -14.2
Hybrid sequence
GACCUCCUUCCCGGGUCUCc
CTGGACTCGCCGCCC-GAGc miR-328
Target on HDV 
Binding site 717-745
mfe : -23.61
Hybrid sequence
uGCCUUCCCG-UCU----CUCCC--GGuc
cCGGCTGGGCAACATTCCGAGGGGACCgt miR-328
Target on HDV 
Binding site 99-121
mfe : -19.3
Hybrid sequence
ugcCUUCCCGUCUCUCCCG-GUC
caaGAAGCAAAGAGAGGTCTCAG miR-331
Target on HDV 
Binding site 1088-1113
mfe : -21
Hybrid sequence
aaGAUCC---UAUC--CGGGUCCCCG
gaCTGGGGACGAAGCCGCCCCCGGGC miR-337
Target on HDV 
Binding site 369-390
mfe : -15.9
Hybrid sequence
uuUCCGUAGUAU-AUCCUCGACCU
ggAGGAG--ATGCTAGGAGTAGGA miR-339
Target on HDV 
Binding site 983-1000
mfe : -14.1
Hybrid sequence
aCUCGAGGACCU-CCUGUCCCU
aGGGC----GGATCGGCTGGGA miR-340
Target on HDV 
Binding site 32-56
mfe : -16.5
Hybrid sequence
CCGAUAUU--UCAUUGACUCUGCCu
GGGGAGGATCAGCTCCCGAGAGGGg miR-340
Target on HDV 
Binding site 526-549
mfe : -17.9
Hybrid sequence
ccgauaUUUCAUU-GACUCUGCCu
ccttcgAAAGTGACCGGAGGGGGt miR-346
Target on HDV 
Binding site 266-298
mfe : -22.2
Hybrid sequence
UCUCCGUCC----GUACGC-----C-CGUCUgu
AGAGGGAGGAATCCACTCGGAGATGAGCAGAga miR-346
Target on HDV 
Binding site 621-645
mfe : -16.49
Hybrid sequence
UCUC--C--GUCCGUACGCCCG-UCUGu
AGGGTCGCCCAGGAAT---GGCGGGACc miR-34a
Target on HDV 
Binding site 1646-1669
mfe : -14.3
Hybrid sequence
UUGUUGGUCGAUUCU--GUGACGGu
AGGAGACTGCT-GGACTCGCCGCCc miR-363*
Target on HDV 
Binding site 808-832
mfe : -15.4
Hybrid sequence
UUUAAC---GUAGCACUAGGUGGGC
AAAGTGGCTCTCCCTTAGCCATCCG miR-423
Target on HDV 
Binding site 436-460
mfe : -22.6
Hybrid sequence
GACUCCC-C--GGAGUCUGGCUCga
CGGTGGGTGTTCCGCCCCCCGAGag miR-423
Target on HDV 
Binding site 1041-1062
mfe : -15.6
Hybrid sequence
gacuccccGGAGUCUGGCUCga
cagcccctCCCCGGTCCGAGag miR-423
Target on HDV 
Binding site 329-345
mfe : -17.5
Hybrid sequence
gaCUCCCCGGAGUCUGGCUCGa
aaGAGGCGCT-----TCGAGCg miR-431
Target on HDV 
Binding site 1639-1661
mfe : -12.2
Hybrid sequence
ACG-UACUGC-CGGACGUUCUGu
TGTAAAGAGGAGACTGCTGGACt miR-432
Target on HDV 
Binding site 1056-1078
mfe : -15.2
Hybrid sequence
GGUGGGUUACUGGAUGAGGUUCU
CCGAGAGAAGGGGGACTCCGGGA miR-432*
Target on HDV 
Binding site 1267-1286
mfe : -12.9
Hybrid sequence
ucuguACCUCCUCGGUAGGuc
tgttcTCGAGG-GCCTTCCtt miR-432*
Target on HDV 
Binding site 303-323
mfe : -15.4
Hybrid sequence
ucuguacCUCCUCGGUAGGUC
acctccaGAGGACCCCTTCAG miR-490
Target on HDV 
Binding site 1060-1080
mfe : -19.12
Hybrid sequence
gUCGUACCUCAGGAGGUCCaac
gAG-AAGGGGGACTCCGGGact miR-491
Target on HDV 
Binding site 1060-1087
mfe : -14.8
Hybrid sequence
aggaguaCCUU----CCC-AAGGGGUGa
gagaaggGGGACTCCGGGACTCCCTGCa miR-498
Target on HDV 
Binding site 979-1001
mfe : -14.8
Hybrid sequence
CUUUUUGCGGGGGACCGAACUUU
GAAAAGGGCGGATCGGCTGGGAA miR-502
Target on HDV 
Binding site 1532-1552
mfe : -17.5
Hybrid sequence
aucGUGGGU--CUAUCGUUCCUA
ggcCACCCACTGCT--CGAGGAT miR-504
Target on HDV 
Binding site 15-36
mfe : -14.92
Hybrid sequence
uaUCUCACGUCUG-GUCCCaga
cgAGCGAGGAGACGCGGGGgga miR-507
Target on HDV 
Binding site 277-297
mfe : -14
Hybrid sequence
AAGUGAGGUUUUCCACGUUUu
TCCACTCGGAGATGAGCAGAg miR-510
Target on HDV 
Binding site 1647-1674
mfe : -12.1
Hybrid sequence
aCACUAACGG--UGA---GAGGACUCau
gGAGACTGCTGGACTCGCCGCCCGAGcc miR-515-3p
Target on HDV 
Binding site 258-283
mfe : -20.9
Hybrid sequence
ugCG-AGGUUUUCUUCC----GUGAG
taGCACCCAGAGGGAGGAATCCACTC miR-518c*
Target on HDV 
Binding site 1406-1427
mfe : -16.4
Hybrid sequence
gucuuucACGAAGGGAGGUCUCU
atccttaTCCTTCTTTCC-GAGA miR-524
Target on HDV 
Binding site 1381-1402
mfe : -20
Hybrid sequence
uGAGGU-UUCCCUUCGCGGAAG
tCTTCGCCGGGGGAGCCCCCTC miR-542-5p
Target on HDV 
Binding site 570-591
mfe : -13.9
Hybrid sequence
gAGCACUGUACUACUA-GGGGcu
gTGGAGCCATGG-GATGCCCCtc let-7b
Target on HDV 
Binding site 1560-1581
mfe : -14.9
Hybrid sequence
uuGGUGUGUUG-GAUGAUGGAGu
ctCC-CTCCGCGGTTCTTCCTCg miR-125a
Target on HDV 
Binding site 6-34
mfe : -12.2
Hybrid sequence
guGUCCAA---U--UUCC-CAGAGUCCCu
gcCAAGTTCCGAGCGAGGAGACGCGGGGg