Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HEV target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
 Browse   Structural and nonstructural protein mRNA, complete cds   Complete cds   mexican strain) structural proteins and a nonstructural polyprotein genes, complete cds   nonstructural polyprotein and putative capsid protein genes, complete cds   
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 2572 rescords (52 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7a62896312-12.5121
uugauauGUUGG-AUGAUG-GAGu
||:|: | |||| |||
tggtggcCAGCTGTTCTACTCTCg
11.678NO
2hsa-let-7b68596881-16.8121
uuGGUGUGUUG-GAUGAU-GGAgu
|||| | || |||||| |||
ttCCAC-CTACACTACTAGCCTgg
11.726NO
3hsa-let-7b62896312-13.4121
uugguguGUUGG-AUGAUG-GAGu
||:|: | |||| |||
tggtggcCAGCTGTTCTACTCTCg
11.726NO
4hsa-let-7c53145340-21.4121
uUGGU-AUGUUGG--AUGA--UGGAGu
|||: |:|::|| :|| |||||
cACCGCTGCGGCCGGGGCTGGACCTCg
11.774NO
5hsa-let-7c62896312-13.6121
uugguauGUUGG-AUGAUG-GAGu
||:|: | |||| |||
tggtggcCAGCTGTTCTACTCTCg
11.774NO
6hsa-let-7c12701295-15.5121
uuGGUAUGUUGG----AUGAUG-GAGU
||:| ||::: | |||| ||||
ggCCGT-CAGTTGGAGTTCTACGCTCA
11.774NO
7hsa-let-7e13521372-15.1121
ugauauGUUGGAGGAUGGAGu
|::|| |||:|| |
atgagtCGGCCCCCTGCCACt
6.037NO
8hsa-let-7i55185551-13.9121
uGUCGUGUUUGAU------------GA-UGGAGu
|||:|:|| ||| || |||||
gCAGTATAACCTATCAACATCTCCCCTCACCTCt
7.883NO
9hsa-let-7i62846312-17.9121
uGUCG-----UGUUUGAU--GAUG-GAGu
|:|| :| |:||: |||| |||
tCGGCTGGTGGCCAGCTGTTCTACTCTCg
7.883NO
10hsa-miR-10049314952-13.2121
guguucaAGCCUAGAUGCCCaa
||| :|:||:|||
ttgtctcTCGTGTTTATGGGgt
9.137NO
11hsa-miR-10046094632-13.5121
gUGUUCAA-GC-CUAGAUGCCCAa
|::| || || |||||:| |||
tATGATTTCCGCGATCTGCAGGTg
9.137NO
12hsa-miR-10351155142-17.2121
aGUAU-CGGGA--C--AUGUUACGACGA
|||: ||||| | ||: |||||:|
cCATGCGCCCTCGGCCTATTTTGCTGTT
9.493NO
13hsa-miR-106a62036228-12121
cgaUGGAC-GUGACAU-UCGUGAAaa
|:| | |:| | | |||:|||
gagATCGGCCGCGGGATAGCGCTTac
8.618NO
14hsa-miR-10a46094633-16.9121
gUGUUUAA-GC-CUAGAUGUCCcau
|::| || || |||||:||||
tATGATTTCCGCGATCTGCAGGtgg
7.071NO
15hsa-miR-12617181738-14121
cguaauAAUGAGUGCCAUGCu
||::| |||| :||
cgtcgtTTGTTGACGGGGCGg
10.720NO
16hsa-miR-12728472871-20.5121
UCGGU-UC-G-AGUCUGCCUAGGCu
||||| || | ||:| |||: |:|
AGCCACAGACGTCGGCCGGGCCTGt
5.000NO
17hsa-miR-128a48104831-15.5121
uuuucuCUGGCCAAGUGACACU
|::||| |:|||| ||
ttcgccGGTCGGCTTACTGAGA
5.472NO
18hsa-miR-128b48104831-15.5121
cuuucuCUGGCCAAGUGACACU
|::||| |:|||| ||
ttcgccGGTCGGCTTACTGAGA
5.226NO
19hsa-miR-133a4571-15121
ugUCGACCAAC---UUC--CCCUGGUU
||| || || || | |:||||
tgAGCAGGCTGCTCTAGCAGCGGCCAA
5.000NO
20hsa-miR-133b4671-15121
aUCGACCAAC---UUC--CCCUGGUU
||| || || || | |:||||
gAGCAGGCTGCTCTAGCAGCGGCCAA
NONO
21hsa-miR-13465746595-13.72121
GGGAGACCAGUU-GGUCAGugu
|:||: | |:: ||||||
CTCTTCGACCGGCCCAGTCtat
5.000NO
22hsa-miR-13470177045-14.8121
gGGAG--ACCAGU-UG----GUCAG-UGu
|||| |||:: :| ||||| ||
gCCTCCAGGGTTGTGCTTTTCAGTCTACt
5.000NO
23hsa-miR-135a59105932-12.7121
aguguauCCUUAUUUUUCGGUau
|||: |::|:||||
gggtggcGGAGGAGGAGGCCAcc
NONO
24hsa-miR-13810261042-15.9121
cuAAGUGUUGUGGUCGA
| |:|::||::||||
ccTCCGCGGCATTAGCT
5.000NO
25hsa-miR-14134523475-18.92121
GGUAGAAAUGGU-CUGUC-ACAAu
||||| ||:||| |:||| || |
CCATCATTGCCACGGCAGATGCTc
5.100NO
26hsa-miR-142-3p20732101-14.9121
AGGUAUUUCAUC---CUU-UGUG--AUGU
||||| ||:| ||: |||| ||||
TCCATTCTGTGGCGAGAGCACACTTTACA
9.468NO
27hsa-miR-15242434262-16.9121
GGGUUCAAGACAGUACG-UGACU
||| :|||| |:||| |:|||
CCCTGGTTC---CGTGCTATTGA
7.093NO
28hsa-miR-15357155735-14.5121
aGUGA-AAACACUGAUACGuu
|:|| || |||:||| ||
aCGCTGTTGGTGGCTACGCta
7.150NO
29hsa-miR-15441084136-14121
gCUUC--CGUUGU----G-CCUAUUGGAu
| || ||:||: | |||| ||||
tGTAGCCGCGACGTGTCCAGGATCACCTt
5.000NO
30hsa-miR-15432753301-12.1121
gcuUCCGUU--GUGCC---UAUUGGAU
|| :|| |:||| ||| ||||
gtgAGCTAATCCGCGGCGCATACCCTA
5.000NO
31hsa-miR-17-5p601625-13.3121
UG-AUGGACGUGACAU-UCGUGAAac
|| |||| |||| | : |:||||
ACATACC-GCACCGCGTCGTACTTgc
8.771NO
32hsa-miR-17-5p62036228-12121
ugaUGGAC-GUGACAU-UCGUGAAac
|:| | |:| | | |||:|||
gagATCGGCCGCGGGATAGCGCTTac
8.771NO
33hsa-miR-17-5p763787-13.4121
ugauggacGUGACAUUC-GUGAAAC
||:|| | |||||||
gttagggcCATTGGCTGCCACTTTG
8.771NO
34hsa-miR-181d27872811-15.8121
UUGGGUG-GCUGUUGUUACUUACAA
|||:| | | |:||| : |:|||||
AACTCTCACTATAACTGAGGATGTT
NONO
35hsa-miR-18460956115-15.7121
uGGGAAUAGUCAAGAGGCAGgu
||| | | | ||:||||
gCCCGTCACCG-CCTTCGTCgc
5.000NO
36hsa-miR-18434783496-14.6121
ugGGAAU-AGUCAAGAGGCAGGu
||| | |||| :|||||
ggCCTCATTCAG----TCGTCCc
5.000NO
37hsa-miR-18527782795-14.4121
CUUGACGGAAAGAGAGgu
|| ||||| |||||
GACCTGCCCAACTCTCac
6.327NO
38hsa-miR-18710771102-19.8121
gCCGACGUUGUG-----UUCUGUGcu
||||| |||:| |:|||:|
aGGCTGGAACGCCTCTGAGGACGCtc
5.000NO
39hsa-miR-18a*10431062-13.1121
UCUUCCUCGUGAAUCCCGUca
| |||| :||| |||||
ACAAGG-TTACTGTGGGCAcc
NONO
40hsa-miR-19152135231-12.9121
uCGACGAAAACC-CUAAGGCaac
|| || || |:|||||
cGCAGC----GGCGGTTCCGgcg
NONO
41hsa-miR-191*12811308-13.6121
CCCC----UGC--UUUAGGUUCGCGUCg
|| | ||| |:| :|:|||| |
GGAGTTCTACGCTCAGTGTAGGCGCTGg
NONO
42hsa-miR-193a51935219-19.7121
GACC--CUGAAACAU---CCG-GUCaa
|||| | | | ||: ||| |||
CTGGCCGCCGTCGTGGGCGGCGCAGcg
NONO
43hsa-miR-196a22722291-13.7121
GGUUGUUGUACUUUGAUGGau
||::| | ||: :|||||
CCGGC-TCCTGGCGCTACCgc
NONO
44hsa-miR-196b342362-14.6121
gGUUGUUGUCCUUUGAUGGau
||:|: ::| | |||:||
tCAGCGTTGGTATACTGCCcc
NONO
45hsa-miR-199a68186844-14.5121
cUUGUCCAUCAGACU-----UGUGACCC
||| | | || ||| |:|||||
cAACTGCTCGT-TGAGAATGCCGCTGGG
10.003NO
46hsa-miR-20226202640-15.2121
aaaAGGGUACGG-GAUAUGGAGA
|||| ||| | :|||| ||
tgcTCCC--GCCTCGGTACCGCT
NONO
47hsa-miR-20547024733-16.72121
GUCUGA-GGC---CACC------UUACUUCCu
| ||:| |:| |||| : ||||||
CTGATTGCTGGCTGTGGCCTAAAGTTGAAGGt
5.000NO
48hsa-miR-20a12871309-16.92121
GAUG-GACGUGAUAUUCGUGAaau
|||| || || |:||:||:||
CTACGCT-CAGTGTAGGCGCTggc
NONO
49hsa-miR-20a62086228-13.2121
GAUGGACGUGAUAUUCGUGAAau
| :|| ||: || |||:|||
CGGCC-GCGGGAT-AGCGCTTac
NONO
50hsa-miR-20b62086228-13.2121
GAUGGACGUGAUACUCGUGAAac
| :|| ||: || |||:|||
CGGCC-GCGGGAT-AGCGCTTac
NONO
let-7a
Target on HEV 
Binding site 6289-6312
mfe : -12.5
Hybrid sequence
uugauauGUUGG-AUGAUG-GAGu
tggtggcCAGCTGTTCTACTCTCg let-7b
Target on HEV 
Binding site 6859-6881
mfe : -16.8
Hybrid sequence
uuGGUGUGUUG-GAUGAU-GGAgu
ttCCAC-CTACACTACTAGCCTgg let-7b
Target on HEV 
Binding site 6289-6312
mfe : -13.4
Hybrid sequence
uugguguGUUGG-AUGAUG-GAGu
tggtggcCAGCTGTTCTACTCTCg let-7c
Target on HEV 
Binding site 5314-5340
mfe : -21.4
Hybrid sequence
uUGGU-AUGUUGG--AUGA--UGGAGu
cACCGCTGCGGCCGGGGCTGGACCTCg let-7c
Target on HEV 
Binding site 6289-6312
mfe : -13.6
Hybrid sequence
uugguauGUUGG-AUGAUG-GAGu
tggtggcCAGCTGTTCTACTCTCg let-7c
Target on HEV 
Binding site 1270-1295
mfe : -15.5
Hybrid sequence
uuGGUAUGUUGG----AUGAUG-GAGU
ggCCGT-CAGTTGGAGTTCTACGCTCA let-7e
Target on HEV 
Binding site 1352-1372
mfe : -15.1
Hybrid sequence
ugauauGUUGGAGGAUGGAGu
atgagtCGGCCCCCTGCCACt let-7i
Target on HEV 
Binding site 5518-5551
mfe : -13.9
Hybrid sequence
uGUCGUGUUUGAU------------GA-UGGAGu
gCAGTATAACCTATCAACATCTCCCCTCACCTCt let-7i
Target on HEV 
Binding site 6284-6312
mfe : -17.9
Hybrid sequence
uGUCG-----UGUUUGAU--GAUG-GAGu
tCGGCTGGTGGCCAGCTGTTCTACTCTCg miR-100
Target on HEV 
Binding site 4931-4952
mfe : -13.2
Hybrid sequence
guguucaAGCCUAGAUGCCCaa
ttgtctcTCGTGTTTATGGGgt miR-100
Target on HEV 
Binding site 4609-4632
mfe : -13.5
Hybrid sequence
gUGUUCAA-GC-CUAGAUGCCCAa
tATGATTTCCGCGATCTGCAGGTg miR-103
Target on HEV 
Binding site 5115-5142
mfe : -17.2
Hybrid sequence
aGUAU-CGGGA--C--AUGUUACGACGA
cCATGCGCCCTCGGCCTATTTTGCTGTT miR-106a
Target on HEV 
Binding site 6203-6228
mfe : -12
Hybrid sequence
cgaUGGAC-GUGACAU-UCGUGAAaa
gagATCGGCCGCGGGATAGCGCTTac miR-10a
Target on HEV 
Binding site 4609-4633
mfe : -16.9
Hybrid sequence
gUGUUUAA-GC-CUAGAUGUCCcau
tATGATTTCCGCGATCTGCAGGtgg miR-126
Target on HEV 
Binding site 1718-1738
mfe : -14
Hybrid sequence
cguaauAAUGAGUGCCAUGCu
cgtcgtTTGTTGACGGGGCGg miR-127
Target on HEV 
Binding site 2847-2871
mfe : -20.5
Hybrid sequence
UCGGU-UC-G-AGUCUGCCUAGGCu
AGCCACAGACGTCGGCCGGGCCTGt miR-128a
Target on HEV 
Binding site 4810-4831
mfe : -15.5
Hybrid sequence
uuuucuCUGGCCAAGUGACACU
ttcgccGGTCGGCTTACTGAGA miR-128b
Target on HEV 
Binding site 4810-4831
mfe : -15.5
Hybrid sequence
cuuucuCUGGCCAAGUGACACU
ttcgccGGTCGGCTTACTGAGA miR-133a
Target on HEV 
Binding site 45-71
mfe : -15
Hybrid sequence
ugUCGACCAAC---UUC--CCCUGGUU
tgAGCAGGCTGCTCTAGCAGCGGCCAA miR-133b
Target on HEV 
Binding site 46-71
mfe : -15
Hybrid sequence
aUCGACCAAC---UUC--CCCUGGUU
gAGCAGGCTGCTCTAGCAGCGGCCAA miR-134
Target on HEV 
Binding site 6574-6595
mfe : -13.72
Hybrid sequence
GGGAGACCAGUU-GGUCAGugu
CTCTTCGACCGGCCCAGTCtat miR-134
Target on HEV 
Binding site 7017-7045
mfe : -14.8
Hybrid sequence
gGGAG--ACCAGU-UG----GUCAG-UGu
gCCTCCAGGGTTGTGCTTTTCAGTCTACt miR-135a
Target on HEV 
Binding site 5910-5932
mfe : -12.7
Hybrid sequence
aguguauCCUUAUUUUUCGGUau
gggtggcGGAGGAGGAGGCCAcc miR-138
Target on HEV 
Binding site 1026-1042
mfe : -15.9
Hybrid sequence
cuAAGUGUUGUGGUCGA
ccTCCGCGGCATTAGCT miR-141
Target on HEV 
Binding site 3452-3475
mfe : -18.92
Hybrid sequence
GGUAGAAAUGGU-CUGUC-ACAAu
CCATCATTGCCACGGCAGATGCTc miR-142-3p
Target on HEV 
Binding site 2073-2101
mfe : -14.9
Hybrid sequence
AGGUAUUUCAUC---CUU-UGUG--AUGU
TCCATTCTGTGGCGAGAGCACACTTTACA miR-152
Target on HEV 
Binding site 4243-4262
mfe : -16.9
Hybrid sequence
GGGUUCAAGACAGUACG-UGACU
CCCTGGTTC---CGTGCTATTGA miR-153
Target on HEV 
Binding site 5715-5735
mfe : -14.5
Hybrid sequence
aGUGA-AAACACUGAUACGuu
aCGCTGTTGGTGGCTACGCta miR-154
Target on HEV 
Binding site 4108-4136
mfe : -14
Hybrid sequence
gCUUC--CGUUGU----G-CCUAUUGGAu
tGTAGCCGCGACGTGTCCAGGATCACCTt miR-154
Target on HEV 
Binding site 3275-3301
mfe : -12.1
Hybrid sequence
gcuUCCGUU--GUGCC---UAUUGGAU
gtgAGCTAATCCGCGGCGCATACCCTA miR-17-5p
Target on HEV 
Binding site 601-625
mfe : -13.3
Hybrid sequence
UG-AUGGACGUGACAU-UCGUGAAac
ACATACC-GCACCGCGTCGTACTTgc miR-17-5p
Target on HEV 
Binding site 6203-6228
mfe : -12
Hybrid sequence
ugaUGGAC-GUGACAU-UCGUGAAac
gagATCGGCCGCGGGATAGCGCTTac miR-17-5p
Target on HEV 
Binding site 763-787
mfe : -13.4
Hybrid sequence
ugauggacGUGACAUUC-GUGAAAC
gttagggcCATTGGCTGCCACTTTG miR-181d
Target on HEV 
Binding site 2787-2811
mfe : -15.8
Hybrid sequence
UUGGGUG-GCUGUUGUUACUUACAA
AACTCTCACTATAACTGAGGATGTT miR-184
Target on HEV 
Binding site 6095-6115
mfe : -15.7
Hybrid sequence
uGGGAAUAGUCAAGAGGCAGgu
gCCCGTCACCG-CCTTCGTCgc miR-184
Target on HEV 
Binding site 3478-3496
mfe : -14.6
Hybrid sequence
ugGGAAU-AGUCAAGAGGCAGGu
ggCCTCATTCAG----TCGTCCc miR-185
Target on HEV 
Binding site 2778-2795
mfe : -14.4
Hybrid sequence
CUUGACGGAAAGAGAGgu
GACCTGCCCAACTCTCac miR-187
Target on HEV 
Binding site 1077-1102
mfe : -19.8
Hybrid sequence
gCCGACGUUGUG-----UUCUGUGcu
aGGCTGGAACGCCTCTGAGGACGCtc miR-18a*
Target on HEV 
Binding site 1043-1062
mfe : -13.1
Hybrid sequence
UCUUCCUCGUGAAUCCCGUca
ACAAGG-TTACTGTGGGCAcc miR-191
Target on HEV 
Binding site 5213-5231
mfe : -12.9
Hybrid sequence
uCGACGAAAACC-CUAAGGCaac
cGCAGC----GGCGGTTCCGgcg miR-191*
Target on HEV 
Binding site 1281-1308
mfe : -13.6
Hybrid sequence
CCCC----UGC--UUUAGGUUCGCGUCg
GGAGTTCTACGCTCAGTGTAGGCGCTGg miR-193a
Target on HEV 
Binding site 5193-5219
mfe : -19.7
Hybrid sequence
GACC--CUGAAACAU---CCG-GUCaa
CTGGCCGCCGTCGTGGGCGGCGCAGcg miR-196a
Target on HEV 
Binding site 2272-2291
mfe : -13.7
Hybrid sequence
GGUUGUUGUACUUUGAUGGau
CCGGC-TCCTGGCGCTACCgc miR-196b
Target on HEV 
Binding site 342-362
mfe : -14.6
Hybrid sequence
gGUUGUUGUCCUUUGAUGGau
tCAGCGTTGGTATACTGCCcc miR-199a
Target on HEV 
Binding site 6818-6844
mfe : -14.5
Hybrid sequence
cUUGUCCAUCAGACU-----UGUGACCC
cAACTGCTCGT-TGAGAATGCCGCTGGG miR-202
Target on HEV 
Binding site 2620-2640
mfe : -15.2
Hybrid sequence
aaaAGGGUACGG-GAUAUGGAGA
tgcTCCC--GCCTCGGTACCGCT miR-205
Target on HEV 
Binding site 4702-4733
mfe : -16.72
Hybrid sequence
GUCUGA-GGC---CACC------UUACUUCCu
CTGATTGCTGGCTGTGGCCTAAAGTTGAAGGt miR-20a
Target on HEV 
Binding site 1287-1309
mfe : -16.92
Hybrid sequence
GAUG-GACGUGAUAUUCGUGAaau
CTACGCT-CAGTGTAGGCGCTggc miR-20a
Target on HEV 
Binding site 6208-6228
mfe : -13.2
Hybrid sequence
GAUGGACGUGAUAUUCGUGAAau
CGGCC-GCGGGAT-AGCGCTTac miR-20b
Target on HEV 
Binding site 6208-6228
mfe : -13.2
Hybrid sequence
GAUGGACGUGAUACUCGUGAAac
CGGCC-GCGGGAT-AGCGCTTac