Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HEV target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
 Browse   Structural and nonstructural protein mRNA, complete cds   Complete cds   mexican strain) structural proteins and a nonstructural polyprotein genes, complete cds   nonstructural polyprotein and putative capsid protein genes, complete cds   
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 2607 rescords (53 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-miR-741854211-16.8121
guuGUUUUAGUGA---UC--AGAAGGu
||||:||: | :| ||||||
tggCAAAGTCGGTCAGGGTATCTTCCg
5.000NO
2hsa-let-7a21882211-13.3121
uugauauGUUG--GAUGAUGGAGU
|| | |||||:|| ||
ggggggcCACCTGCTACTGCCACA
11.678NO
3hsa-let-7b18051828-15.5121
uugGUGUGUUGG--AUGAUGGAGU
|| |::|| | :|:|||||
tggCAGCCGGCCCGTTTTGCCTCA
11.726NO
4hsa-let-7c18051828-16.2121
uugGUAUGUUGG--AUGAUGGAGU
|| |::|| | :|:|||||
tggCAGCCGGCCCGTTTTGCCTCA
11.774NO
5hsa-let-7c21922211-13.9121
uuGGUAUGUUGGAUGAUGGAGU
|| || |||||:|| ||
ggCC--ACCTGCTACTGCCACA
11.774NO
6hsa-let-7d21882208-15.7121
ugauaCGUUGGAUGAUGGAGa
|| ||||:||||: |
gggggGCCACCTGCTACTGCc
7.888NO
7hsa-let-7e15951615-15121
uGAUAUGUUGGAG-GAUGGAgu
|||| ||| ||| | ||||
tCTAT-CAAGCTCTCGACCTgc
6.037NO
8hsa-let-7e71057123-15.6121
uGAUAUGUUGGAGGAUGGAgu
||:|:| || |||||:|
gCTGTGC--CCACCTACTTat
6.037NO
9hsa-let-7e18011828-16.2121
UGAUA-UGUUGG------AGGAUGGAGU
| ||| :||:|| |::|:|||||
AGTATGGCAGCCGGCCCGTTTTGCCTCA
6.037NO
10hsa-miR-10046094632-12.3121
gUGUUCAAG--CCUAGAUGCCCAA
|::||||| ||| || | ||||
tATGAGTTCCGGGACCTCCAGGTT
9.137NO
11hsa-miR-10369246945-17.3121
aguauCGGGACAUGUUACGACga
|||||| :| |||||
gctccGCCCTG-GCTCTGCTGga
9.493NO
12hsa-miR-10344764505-19.4121
aGUAU--CGGGACA--UG---UUACGACGa
|||: |:|| || :| :|| ||||
cCATGCCGTCCGGTCGGCGTGGATCCTGCa
9.493NO
13hsa-miR-10352985320-14.3121
aGUAUCGGGACAUGUUACGACGA
| | |||| ||: ||| |||
cCTTTGCCCCAGACGTTGCCGCT
9.493NO
14hsa-miR-106a591612-15.36121
CGAUGGACGUGACAUUCGUGAAaa
||| ||||| || :|||| |
GCT-CCTGC-CTCCTGGCACCTac
8.618NO
15hsa-miR-106a51115136-16121
CGAUGG-ACGUGACAUUC-GUGAAAA
|| ||| |||:| ||:| | |||||
GCCACCATGCGCCCTAGGCCTCTTTT
8.618NO
16hsa-miR-106a64756499-14.5121
CGAUGGACGUG--ACAUUCGUGAAAA
|: :|||||:| | | :|| |||||
GTCGCCTGCGCCATCTCGGC-CTTTT
8.618NO
17hsa-miR-106b70397064-16.2121
UAGAC-GUGAC---A-GUCGUGAAAU
| ||| |:||| | ||||:| |||
AACTGTCGCTGAGCTCCAGCGCCTTA
5.784NO
18hsa-miR-10769246945-17.2121
acuauCGGGACAUGUUACGACga
|||||| :| |||||
gctccGCCCTG-GCTCTGCTGga
9.255NO
19hsa-miR-10749684991-12.1121
ACUAUCGGGACAUGU-UACGACGa
| ||| ||: || : ||||| |
TCATAACCTGATAGGCATGCTCCa
9.255NO
20hsa-miR-10b29012923-13.8121
uguuuaAGCCAAGAUGUC--CCAu
|| ||| ||||| |||
gcggtaTCAGTT-TACAGCCGGTg
6.727NO
21hsa-miR-125b64196439-13.9121
AGUGUUCAAUCCCA--GAGUCCcu
||:|: || ||| :|||||
TCGCGTGT---GGTCATTCAGGat
10.846NO
22hsa-miR-125b30563074-12.6121
AGUGUUCAAUCCCAGAGUCCCu
|||| || || | :||||
TCACTAG---CGGCCGTAGGGt
10.846NO
23hsa-miR-12717891814-19121
UCGGU--UCGAGUC-UGCC-UAGGCu
||||| ||: :|| |:|| | |||
AGCCAGCAGTGTAGTATGGCAGCCGg
5.000NO
24hsa-miR-12746784697-21.5121
uCGGU-UCGAGUCUGCCUAGGCu
|||| ||| || || |||
cGCCAGAGCCCA---GGCGCCGg
5.000NO
25hsa-miR-128a48594882-13.6121
uUUUC-UC-UGGCCAAGUGACACu
|:|| || ||| ||:| |||
cAGAGCAGCTCCGCCTCGCCGTGc
5.472NO
26hsa-miR-130a783808-12.3121
uACGG-GAAA-AUUGUAAC--GUGAC
||:| |||| |: ::||| |||||
cTGTCACTTTGTGTTGTTGATCACTG
8.135NO
27hsa-miR-132762788-14.6121
GCUGGUAC-CG--ACAU--CUGACAau
||| |: | || ||| |:||||
CGAGCGGGTGCGGGGTATTGGCTGTca
5.000NO
28hsa-miR-13247344758-17.09121
gCUG-GUACCGAC--AUCUGACAau
||| : ||| | |:|:||||
tGACTTCCGGCCGATTGGGCTGTat
5.000NO
29hsa-miR-134378397-15.9121
gGGAGACCAGUUGGUCAGUGu
||| || |:| | |||:|
aCCTGCGG-CGAACTGTCGCc
5.000NO
30hsa-miR-13457455767-16.3121
GGGAGACC--AGUUGGUCAGUGU
|::||||| |||| || ||||
CTTTCTGGCCTCAAACAACCACA
5.000NO
31hsa-miR-146b55575582-13.7121
uCGGAUACC----UUAAGUCAAGAgu
|||| ||| ||||:||| ||
gGCCTCTGGCACTAATTTAGTCCTgt
NONO
32hsa-miR-14734663487-15.6121
CGUCUUC--GUAAAGGUGUGUG
||||| | |:| || ||:||
GCAGATGCCCGTGGCCTCATAC
5.000NO
33hsa-miR-148b24912510-17.4121
UGUUUCAAGACACUACGUGACU
|| ||||| ||||||||: |||
ACCAAGTT-TGTGATGCG-TGA
NONO
34hsa-miR-14911751195-14.9121
ccucACUUCUGUGCCUCGGUCu
| |:|:||: | |||:|
tttcTAAGGGCAT-GCGCCGGc
5.000NO
35hsa-miR-15170157042-15.76121
GGAGUUCCU----CGAA--GUCAGAUca
|||| |||: |||| ||||| |
CCTCCAGGGTTGTGCTTTCCAGTCAAct
NONO
36hsa-miR-15160246043-15.4121
GGAGUUCCUCGAAGUCAGAUCa
|||:| |||||| |||:| |
CCTTA--GAGCTTGAGTTTCGc
NONO
37hsa-miR-15225372560-16.4121
GGGUU--CAAGACAGUACGUGACu
|||:: | || ||||||: ||
CCCGGCCGATCATTCATGCGGTGg
7.093NO
38hsa-miR-15215981622-12121
ggGUUCAAGA-CAGUACG--UGACU
|||| ||| | | ||| :||||
atCAAGCTCTCGACCTGCCAGCTGA
7.093NO
39hsa-miR-15242434262-16.9121
GGGUUCAAGACAGUACG-UGACU
||| :|||| |:||| |:|||
CCCTGGTTC---CGTGCGATTGA
7.093NO
40hsa-miR-1681100-12.5121
GCGGUUAUAAAUGC--ACGACgau
|||| ||:|| |||||
CGCC----CTTGCGAATGCTGtgg
11.196NO
41hsa-miR-181a15591578-13.7121
uGAGUGGCUGUCGCAACUUACaa
||||: ||| || ||:|||
gCTCAT--ACATCG-TGGATGgt
9.523NO
42hsa-miR-181a327348-16.4121
uGAGUGGCUGUC-GCAACUUACAA
| | ||| |:| || |:|||||
cCACCCCGTCGGCCG--GGATGTT
9.523NO
43hsa-miR-181c48884911-14.6121
ugaGUGGCUGUCCA---ACUUACAa
| ||| :|||| ||||||
ttcCTCCG-TAGGTTAACGAATGTg
8.945NO
44hsa-miR-18571397156-12.9121
cuUGACGGAAAGAGAGgu
|:| |||||:||||
ttATTTCCTTTTTCTCgg
6.327NO
45hsa-miR-18766966721-12.3121
GCCGA--CGUUGU---GUUCUGUgcu
| |:| ||||:| |||||||
CTGTTGAGCAATATTCCAAGACAttc
5.000NO
46hsa-miR-191*37433763-13.9121
cCCCUGCUUUAGGUUCGCGUCg
||| | : || :|||| |
tGGGCCACCGGCC-GGCGCCGg
NONO
47hsa-miR-191*58465864-14.4121
ccCCUGCUUUAGGUUCGCGUCG
|| | | ||||||| |||
ttGGTC--ATCCCAAGCG-AGC
NONO
48hsa-miR-193a51935219-19.7121
GACC--CUGAAACAU---CCG-GUCaa
|||| | | | ||: ||| |||
CTGGCCGCCGTCGTGGGCGGCGCAGcg
NONO
49hsa-miR-193b14251442-12.2121
uUUCGCCCUGAAACUCCCGGUCaa
|||:|| || ||:|||
gAAGTGG--CT----CGGTCAGga
NONO
50hsa-miR-193b43344354-13.8121
uuucGCCCUGAAACUCC-CGGUCaa
|| |:|| || |||||
ctgcCGTGGCT----GGCGCCAGcc
NONO
miR-7
Target on HEV 
Binding site 4185-4211
mfe : -16.8
Hybrid sequence
guuGUUUUAGUGA---UC--AGAAGGu
tggCAAAGTCGGTCAGGGTATCTTCCg let-7a
Target on HEV 
Binding site 2188-2211
mfe : -13.3
Hybrid sequence
uugauauGUUG--GAUGAUGGAGU
ggggggcCACCTGCTACTGCCACA let-7b
Target on HEV 
Binding site 1805-1828
mfe : -15.5
Hybrid sequence
uugGUGUGUUGG--AUGAUGGAGU
tggCAGCCGGCCCGTTTTGCCTCA let-7c
Target on HEV 
Binding site 1805-1828
mfe : -16.2
Hybrid sequence
uugGUAUGUUGG--AUGAUGGAGU
tggCAGCCGGCCCGTTTTGCCTCA let-7c
Target on HEV 
Binding site 2192-2211
mfe : -13.9
Hybrid sequence
uuGGUAUGUUGGAUGAUGGAGU
ggCC--ACCTGCTACTGCCACA let-7d
Target on HEV 
Binding site 2188-2208
mfe : -15.7
Hybrid sequence
ugauaCGUUGGAUGAUGGAGa
gggggGCCACCTGCTACTGCc let-7e
Target on HEV 
Binding site 1595-1615
mfe : -15
Hybrid sequence
uGAUAUGUUGGAG-GAUGGAgu
tCTAT-CAAGCTCTCGACCTgc let-7e
Target on HEV 
Binding site 7105-7123
mfe : -15.6
Hybrid sequence
uGAUAUGUUGGAGGAUGGAgu
gCTGTGC--CCACCTACTTat let-7e
Target on HEV 
Binding site 1801-1828
mfe : -16.2
Hybrid sequence
UGAUA-UGUUGG------AGGAUGGAGU
AGTATGGCAGCCGGCCCGTTTTGCCTCA miR-100
Target on HEV 
Binding site 4609-4632
mfe : -12.3
Hybrid sequence
gUGUUCAAG--CCUAGAUGCCCAA
tATGAGTTCCGGGACCTCCAGGTT miR-103
Target on HEV 
Binding site 6924-6945
mfe : -17.3
Hybrid sequence
aguauCGGGACAUGUUACGACga
gctccGCCCTG-GCTCTGCTGga miR-103
Target on HEV 
Binding site 4476-4505
mfe : -19.4
Hybrid sequence
aGUAU--CGGGACA--UG---UUACGACGa
cCATGCCGTCCGGTCGGCGTGGATCCTGCa miR-103
Target on HEV 
Binding site 5298-5320
mfe : -14.3
Hybrid sequence
aGUAUCGGGACAUGUUACGACGA
cCTTTGCCCCAGACGTTGCCGCT miR-106a
Target on HEV 
Binding site 591-612
mfe : -15.36
Hybrid sequence
CGAUGGACGUGACAUUCGUGAAaa
GCT-CCTGC-CTCCTGGCACCTac miR-106a
Target on HEV 
Binding site 5111-5136
mfe : -16
Hybrid sequence
CGAUGG-ACGUGACAUUC-GUGAAAA
GCCACCATGCGCCCTAGGCCTCTTTT miR-106a
Target on HEV 
Binding site 6475-6499
mfe : -14.5
Hybrid sequence
CGAUGGACGUG--ACAUUCGUGAAAA
GTCGCCTGCGCCATCTCGGC-CTTTT miR-106b
Target on HEV 
Binding site 7039-7064
mfe : -16.2
Hybrid sequence
UAGAC-GUGAC---A-GUCGUGAAAU
AACTGTCGCTGAGCTCCAGCGCCTTA miR-107
Target on HEV 
Binding site 6924-6945
mfe : -17.2
Hybrid sequence
acuauCGGGACAUGUUACGACga
gctccGCCCTG-GCTCTGCTGga miR-107
Target on HEV 
Binding site 4968-4991
mfe : -12.1
Hybrid sequence
ACUAUCGGGACAUGU-UACGACGa
TCATAACCTGATAGGCATGCTCCa miR-10b
Target on HEV 
Binding site 2901-2923
mfe : -13.8
Hybrid sequence
uguuuaAGCCAAGAUGUC--CCAu
gcggtaTCAGTT-TACAGCCGGTg miR-125b
Target on HEV 
Binding site 6419-6439
mfe : -13.9
Hybrid sequence
AGUGUUCAAUCCCA--GAGUCCcu
TCGCGTGT---GGTCATTCAGGat miR-125b
Target on HEV 
Binding site 3056-3074
mfe : -12.6
Hybrid sequence
AGUGUUCAAUCCCAGAGUCCCu
TCACTAG---CGGCCGTAGGGt miR-127
Target on HEV 
Binding site 1789-1814
mfe : -19
Hybrid sequence
UCGGU--UCGAGUC-UGCC-UAGGCu
AGCCAGCAGTGTAGTATGGCAGCCGg miR-127
Target on HEV 
Binding site 4678-4697
mfe : -21.5
Hybrid sequence
uCGGU-UCGAGUCUGCCUAGGCu
cGCCAGAGCCCA---GGCGCCGg miR-128a
Target on HEV 
Binding site 4859-4882
mfe : -13.6
Hybrid sequence
uUUUC-UC-UGGCCAAGUGACACu
cAGAGCAGCTCCGCCTCGCCGTGc miR-130a
Target on HEV 
Binding site 783-808
mfe : -12.3
Hybrid sequence
uACGG-GAAA-AUUGUAAC--GUGAC
cTGTCACTTTGTGTTGTTGATCACTG miR-132
Target on HEV 
Binding site 762-788
mfe : -14.6
Hybrid sequence
GCUGGUAC-CG--ACAU--CUGACAau
CGAGCGGGTGCGGGGTATTGGCTGTca miR-132
Target on HEV 
Binding site 4734-4758
mfe : -17.09
Hybrid sequence
gCUG-GUACCGAC--AUCUGACAau
tGACTTCCGGCCGATTGGGCTGTat miR-134
Target on HEV 
Binding site 378-397
mfe : -15.9
Hybrid sequence
gGGAGACCAGUUGGUCAGUGu
aCCTGCGG-CGAACTGTCGCc miR-134
Target on HEV 
Binding site 5745-5767
mfe : -16.3
Hybrid sequence
GGGAGACC--AGUUGGUCAGUGU
CTTTCTGGCCTCAAACAACCACA miR-146b
Target on HEV 
Binding site 5557-5582
mfe : -13.7
Hybrid sequence
uCGGAUACC----UUAAGUCAAGAgu
gGCCTCTGGCACTAATTTAGTCCTgt miR-147
Target on HEV 
Binding site 3466-3487
mfe : -15.6
Hybrid sequence
CGUCUUC--GUAAAGGUGUGUG
GCAGATGCCCGTGGCCTCATAC miR-148b
Target on HEV 
Binding site 2491-2510
mfe : -17.4
Hybrid sequence
UGUUUCAAGACACUACGUGACU
ACCAAGTT-TGTGATGCG-TGA miR-149
Target on HEV 
Binding site 1175-1195
mfe : -14.9
Hybrid sequence
ccucACUUCUGUGCCUCGGUCu
tttcTAAGGGCAT-GCGCCGGc miR-151
Target on HEV 
Binding site 7015-7042
mfe : -15.76
Hybrid sequence
GGAGUUCCU----CGAA--GUCAGAUca
CCTCCAGGGTTGTGCTTTCCAGTCAAct miR-151
Target on HEV 
Binding site 6024-6043
mfe : -15.4
Hybrid sequence
GGAGUUCCUCGAAGUCAGAUCa
CCTTA--GAGCTTGAGTTTCGc miR-152
Target on HEV 
Binding site 2537-2560
mfe : -16.4
Hybrid sequence
GGGUU--CAAGACAGUACGUGACu
CCCGGCCGATCATTCATGCGGTGg miR-152
Target on HEV 
Binding site 1598-1622
mfe : -12
Hybrid sequence
ggGUUCAAGA-CAGUACG--UGACU
atCAAGCTCTCGACCTGCCAGCTGA miR-152
Target on HEV 
Binding site 4243-4262
mfe : -16.9
Hybrid sequence
GGGUUCAAGACAGUACG-UGACU
CCCTGGTTC---CGTGCGATTGA miR-16
Target on HEV 
Binding site 81-100
mfe : -12.5
Hybrid sequence
GCGGUUAUAAAUGC--ACGACgau
CGCC----CTTGCGAATGCTGtgg miR-181a
Target on HEV 
Binding site 1559-1578
mfe : -13.7
Hybrid sequence
uGAGUGGCUGUCGCAACUUACaa
gCTCAT--ACATCG-TGGATGgt miR-181a
Target on HEV 
Binding site 327-348
mfe : -16.4
Hybrid sequence
uGAGUGGCUGUC-GCAACUUACAA
cCACCCCGTCGGCCG--GGATGTT miR-181c
Target on HEV 
Binding site 4888-4911
mfe : -14.6
Hybrid sequence
ugaGUGGCUGUCCA---ACUUACAa
ttcCTCCG-TAGGTTAACGAATGTg miR-185
Target on HEV 
Binding site 7139-7156
mfe : -12.9
Hybrid sequence
cuUGACGGAAAGAGAGgu
ttATTTCCTTTTTCTCgg miR-187
Target on HEV 
Binding site 6696-6721
mfe : -12.3
Hybrid sequence
GCCGA--CGUUGU---GUUCUGUgcu
CTGTTGAGCAATATTCCAAGACAttc miR-191*
Target on HEV 
Binding site 3743-3763
mfe : -13.9
Hybrid sequence
cCCCUGCUUUAGGUUCGCGUCg
tGGGCCACCGGCC-GGCGCCGg miR-191*
Target on HEV 
Binding site 5846-5864
mfe : -14.4
Hybrid sequence
ccCCUGCUUUAGGUUCGCGUCG
ttGGTC--ATCCCAAGCG-AGC miR-193a
Target on HEV 
Binding site 5193-5219
mfe : -19.7
Hybrid sequence
GACC--CUGAAACAU---CCG-GUCaa
CTGGCCGCCGTCGTGGGCGGCGCAGcg miR-193b
Target on HEV 
Binding site 1425-1442
mfe : -12.2
Hybrid sequence
uUUCGCCCUGAAACUCCCGGUCaa
gAAGTGG--CT----CGGTCAGga miR-193b
Target on HEV 
Binding site 4334-4354
mfe : -13.8
Hybrid sequence
uuucGCCCUGAAACUCC-CGGUCaa
ctgcCGTGGCT----GGCGCCAGcc