Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HEV target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
 Browse   Structural and nonstructural protein mRNA, complete cds   Complete cds   mexican strain) structural proteins and a nonstructural polyprotein genes, complete cds   nonstructural polyprotein and putative capsid protein genes, complete cds   
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 2506 rescords (51 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7a61676190-14.7121
uugauaUGUUG--GAUGAUGGagu
|| || ||:|||||
ctcaccACCACGGCTGCTACCcgc
11.678NO
2hsa-let-7c53445370-21.4121
uUGGU-AUGUUGG--AUGA--UGGAGu
|||: |:|::|| :|| |||||
cACCGCTGCGGCCGGGGCTGGACCTCg
11.774NO
3hsa-let-7d22962322-13.51121
uGAUAC-GUUG--GA---UGAUGGAGa
||: | |::| || :||||| |
gCTGAGCCGGCTTCTGGCGCTACCGCc
7.888NO
4hsa-let-7d26662686-12.8121
ugauACGU-UGGAUGAUGGAGa
|||| ||| :|| ||||
ccgcTGCATACCCGCT-CCTCg
7.888NO
5hsa-let-7f14241447-12.5121
uuGAUAUGUU---AGAUGAUGGAGU
|| | ||| |:|:||:|:|||
cgCTCT-CAAAGTTTTGCTGCTTCA
10.092NO
6hsa-let-7g14251447-12.8121
uGACAUGUUU---GAUGAUGGAGU
|| | |||| :|:||:|:|||
gCTCT-CAAAGTTTTGCTGCTTCA
9.988NO
7hsa-let-7i14241447-12.8121
ugucGUGUUU---GAUGAUGGAGU
| |||| :|:||:|:|||
cgctCTCAAAGTTTTGCTGCTTCA
7.883NO
8hsa-miR-10039503971-14.4121
GUGUUCAAGCCUAGAUGCCcaa
||| || | ||||||
CACTCGTGGGCCGCTACGGcgg
9.137NO
9hsa-miR-10061436159-14.7121
GUGUUCAAGCCUAGAUGCCCaa
|:| :|| ||| |||||
CGC-GGTGCGG----ACGGGac
9.137NO
10hsa-miR-10362556277-18121
AGUAUCGGGACA---UGUUACGACga
||| |||||| || |||||
TCA---CCCTGTTCAACCTTGCTGac
9.493NO
11hsa-miR-10737773798-14.2121
acUAUCGGGACAUGUUACGACGa
| || ||||| | ||:|||
ccACAGACCTGT-CCCTGTTGCa
9.255NO
12hsa-miR-10759565984-12.7121
aCUAUCGGGAC----AUGUUACG--ACGa
| || |:||| |:: |||| |||
gGCTACCTCTGGTCTTGTTATGCTTTGCa
9.255NO
13hsa-miR-10a49614983-12.9121
guguuuaaGCCUAGAUGUCCCAu
|| :|:||::||||
ttgtttccCGTGTTTATGGGGTt
7.071NO
14hsa-miR-122a26592684-18.5121
uguuuGUGGUAAC--A-GUGUGAGGu
||||: || | | |:||||
ctcggCACCGCTGCATACCCGCTCCt
12.384NO
15hsa-miR-122a71717192-13.3121
uguuugugGUAACAGUGUGAGGu
|:|| |:|:||||
catttctgCGTT-CCGCGCTCCc
12.384NO
16hsa-miR-124a65606584-19.46121
ACCG---UA-AGUGGCGCACGGaauu
|||| | ||||||| ||||
TGGCTCTCTCTCACCGC-TGCCgagt
5.000NO
17hsa-miR-128a48894912-14.1121
uuuUC-UC-UGGCCAAGUGACAcu
|| || ||| ||:||||
cggAGCAGCTCCGCCTCGCTGTta
5.472NO
18hsa-miR-130a37803802-12.4121
uaCGGGAAAAUUGUAACGU-GAC
| ||| | ::||||| |||
caGACCTGTCCCTGTTGCAGCTG
8.135NO
19hsa-miR-133a75101-15121
ugUCGACCAAC---UUC--CCCUGGUU
||| || || || | |:||||
tgAGCAGGCTGCTCTAGCAGCGGCCAA
5.000NO
20hsa-miR-133a33903419-13.1121
uGUC---GA-C-CAACU---UCCCCUGGUU
||| || | ||| | ||| |:||||
gCAGAAACTAGTGTTCACCCAGGCGGCCAA
5.000NO
21hsa-miR-133b76101-15121
aUCGACCAAC---UUC--CCCUGGUU
||| || || || | |:||||
gAGCAGGCTGCTCTAGCAGCGGCCAA
NONO
22hsa-miR-13410561083-13.7121
GGGAG-ACC--AGUUG--GU--CAGUGu
||:|| || |:|:| || |||||
CCTTCGCGGCATTAGCTACAAGGTCACt
5.000NO
23hsa-miR-142-3p21032131-14.9121
AGGUAUUUCAUC---CUU-UGUG--AUGU
||||| ||:| ||: |||| ||||
TCCATTCTGTGGCGAGAGCACACTTTACA
9.468NO
24hsa-miR-14930773103-16.9121
ccucacuUCUGUG-----CCUCGGUCu
|| ||| || |||:|
ccgccagAGTCACCCAGGGGCGCCGGg
5.000NO
25hsa-miR-15062116236-16121
gUGACCAUG-UU-CC-CAACC-CUCU
||| |||| || || || || ||||
tACTAGTACTAATGGTGTCGGTGAGA
7.336NO
26hsa-miR-15462356255-15.6121
gcuuCCGUUGUGCCUAUUGGau
||| :|: |||||:||
gatcGGCCGCG-GGATAGCCct
5.000NO
27hsa-miR-17-5p793817-13.4121
ugauggacGUGACAUUC-GUGAAAC
||:|| | |||||||
gttagggcCATTGGCTGCCACTTTG
8.771NO
28hsa-miR-17-5p30313055-17.1121
UGAUGGA-CGUGACAUUCG-UGAAAC
| |:||| ||:| || || :|||||
AATGCCTGGCGCCGT-CGCGGCTTTG
8.771NO
29hsa-miR-18340624092-17.8121
guCACUUAAGAU----GGUCA----CGGUAu
||||||| || |:||| |||||
ttGTGAATTGTACGAGCTAGTGGAGGCCATg
5.000NO
30hsa-miR-18363266349-12.5121
GUC-ACUUAAGAU--GGUCACGGUAu
||| || ||||| || || ||:|
CAGCTG--TTCTACTCCCGTCCCGTt
5.000NO
31hsa-miR-18760826103-16121
gccGACGUUGU-GUUCUGUGCu
| |:|||| ||| ||:||
cccCGGTAACACCAATACGCGg
5.000NO
32hsa-miR-18820322051-15.2121
ugggAGGUGGUACGUUCCCUac
||||:| | :|||||
tggtTCCATCCT--GAGGGAct
5.000NO
33hsa-miR-18932953325-15.6121
uGACUAUA---G-UCGAGU---CAUC-CGUg
| |||:| | |||||| ||:| |||
gCGGATGTATGCGAGCTCATCCGTGGTGCAt
5.126NO
34hsa-miR-18a*39533972-14.4121
ucuuCCUCGUGAAUCCCGUCA
||: |:| || |||:||
tcgtGGGCCGC-TACGGCGGT
NONO
35hsa-miR-19152435261-12.9121
uCGACGAAAACC-CUAAGGCaac
|| || || |:|||||
cGCAGC----GGCGGTTCCGgcg
NONO
36hsa-miR-193a52235249-19.7121
GACC--CUGAAACAU---CCG-GUCaa
|||| | | | ||: ||| |||
CTGGCCGCCGTCGTGGGCGGCGCAGcg
NONO
37hsa-miR-193a18951920-14.2121
GAC--CCUGAAAC----AUCCGGUCAA
||| ||:| ||| | || |:|||
CTGCCGGGC-TTGACCATCGGGCGGTT
NONO
38hsa-miR-193b23182338-15.12121
uuucGCCCUGAAACUCCCGGUcaa
||||:| |||||
ccgcCGGGGC---CCCGGCCAtaa
NONO
39hsa-miR-194603623-13.54121
AGGUGUACCUCAACGACAAUGu
|||:| | ||| | ||| |:|
TCCGCCT-GAGGTCCTGCTGCc
11.225NO
40hsa-miR-19515401561-14.5121
cGGUUAUAA-AGACACGACgau
||:||:|| | |||||
tCCGATGTTGACCCTGCTGagt
9.451NO
41hsa-miR-19537003724-17.5121
CGGUUAUAA----AGACACGACGau
||||||:|| | |||||
GCCAATGTTGACACCCTGGCTGCct
9.451NO
42hsa-miR-19568996920-12.3121
cGGUUAUAAAGA--CACGACGAu
||| || || |||||| |
aCCACTA-GCCTGGGTGCTGGTc
9.451NO
43hsa-miR-196a23022321-13.3121
GGUUGUUGUACUUUGAUGGau
||::| | ||: :|||||
CCGGCTTC-TGGCGCTACCgc
NONO
44hsa-miR-196b240267-14.5121
GG--UUG-UUGUCCUU----UGAUGGau
|| ||| |:| |||: |||:||
CCATAACGAGCTGGAGCTTTACTGCCgc
NONO
45hsa-miR-19818531877-18.3121
GGAUA--GAGGGG----AGACCUGg
||||| | ||:| ||||:|
CCTATGCCGCCTCTGCAGCTGGGCt
5.000NO
46hsa-miR-20260026031-17.22121
aaAAGGGUA--------CGGGAUAUGGaga
||||:|| |||||||||
aaTTCCTATACTAATACACCCTATACCggt
NONO
47hsa-miR-20233103331-13.32121
aaaagGGUACGGGAUAUGGAGa
||:|| : ||||| |
ctcatCCGTGGTGCATACCCCa
NONO
48hsa-miR-206917935-16.7121
gGUGUGUGAAGGAAUGUAAGGu
||| | |||||| :|||||
gCAC-CCCTTCCT--TATTCCc
5.000NO
49hsa-miR-20b18651891-17.2121
GAUG--GACGUGA--UACUCGUGAAAC
||:| ||| :|| | | ||:|| ||
CTGCAGCTGGGCTGGAGGTGCGCTATG
NONO
50hsa-miR-21031383161-23.9121
aGUCGGCGAC-A-GUGUGCGUguc
| ||:|||| | ||||:|||
cCTGCTGCTGCTCCACATGCAgcg
6.639NO
let-7a
Target on HEV 
Binding site 6167-6190
mfe : -14.7
Hybrid sequence
uugauaUGUUG--GAUGAUGGagu
ctcaccACCACGGCTGCTACCcgc let-7c
Target on HEV 
Binding site 5344-5370
mfe : -21.4
Hybrid sequence
uUGGU-AUGUUGG--AUGA--UGGAGu
cACCGCTGCGGCCGGGGCTGGACCTCg let-7d
Target on HEV 
Binding site 2296-2322
mfe : -13.51
Hybrid sequence
uGAUAC-GUUG--GA---UGAUGGAGa
gCTGAGCCGGCTTCTGGCGCTACCGCc let-7d
Target on HEV 
Binding site 2666-2686
mfe : -12.8
Hybrid sequence
ugauACGU-UGGAUGAUGGAGa
ccgcTGCATACCCGCT-CCTCg let-7f
Target on HEV 
Binding site 1424-1447
mfe : -12.5
Hybrid sequence
uuGAUAUGUU---AGAUGAUGGAGU
cgCTCT-CAAAGTTTTGCTGCTTCA let-7g
Target on HEV 
Binding site 1425-1447
mfe : -12.8
Hybrid sequence
uGACAUGUUU---GAUGAUGGAGU
gCTCT-CAAAGTTTTGCTGCTTCA let-7i
Target on HEV 
Binding site 1424-1447
mfe : -12.8
Hybrid sequence
ugucGUGUUU---GAUGAUGGAGU
cgctCTCAAAGTTTTGCTGCTTCA miR-100
Target on HEV 
Binding site 3950-3971
mfe : -14.4
Hybrid sequence
GUGUUCAAGCCUAGAUGCCcaa
CACTCGTGGGCCGCTACGGcgg miR-100
Target on HEV 
Binding site 6143-6159
mfe : -14.7
Hybrid sequence
GUGUUCAAGCCUAGAUGCCCaa
CGC-GGTGCGG----ACGGGac miR-103
Target on HEV 
Binding site 6255-6277
mfe : -18
Hybrid sequence
AGUAUCGGGACA---UGUUACGACga
TCA---CCCTGTTCAACCTTGCTGac miR-107
Target on HEV 
Binding site 3777-3798
mfe : -14.2
Hybrid sequence
acUAUCGGGACAUGUUACGACGa
ccACAGACCTGT-CCCTGTTGCa miR-107
Target on HEV 
Binding site 5956-5984
mfe : -12.7
Hybrid sequence
aCUAUCGGGAC----AUGUUACG--ACGa
gGCTACCTCTGGTCTTGTTATGCTTTGCa miR-10a
Target on HEV 
Binding site 4961-4983
mfe : -12.9
Hybrid sequence
guguuuaaGCCUAGAUGUCCCAu
ttgtttccCGTGTTTATGGGGTt miR-122a
Target on HEV 
Binding site 2659-2684
mfe : -18.5
Hybrid sequence
uguuuGUGGUAAC--A-GUGUGAGGu
ctcggCACCGCTGCATACCCGCTCCt miR-122a
Target on HEV 
Binding site 7171-7192
mfe : -13.3
Hybrid sequence
uguuugugGUAACAGUGUGAGGu
catttctgCGTT-CCGCGCTCCc miR-124a
Target on HEV 
Binding site 6560-6584
mfe : -19.46
Hybrid sequence
ACCG---UA-AGUGGCGCACGGaauu
TGGCTCTCTCTCACCGC-TGCCgagt miR-128a
Target on HEV 
Binding site 4889-4912
mfe : -14.1
Hybrid sequence
uuuUC-UC-UGGCCAAGUGACAcu
cggAGCAGCTCCGCCTCGCTGTta miR-130a
Target on HEV 
Binding site 3780-3802
mfe : -12.4
Hybrid sequence
uaCGGGAAAAUUGUAACGU-GAC
caGACCTGTCCCTGTTGCAGCTG miR-133a
Target on HEV 
Binding site 75-101
mfe : -15
Hybrid sequence
ugUCGACCAAC---UUC--CCCUGGUU
tgAGCAGGCTGCTCTAGCAGCGGCCAA miR-133a
Target on HEV 
Binding site 3390-3419
mfe : -13.1
Hybrid sequence
uGUC---GA-C-CAACU---UCCCCUGGUU
gCAGAAACTAGTGTTCACCCAGGCGGCCAA miR-133b
Target on HEV 
Binding site 76-101
mfe : -15
Hybrid sequence
aUCGACCAAC---UUC--CCCUGGUU
gAGCAGGCTGCTCTAGCAGCGGCCAA miR-134
Target on HEV 
Binding site 1056-1083
mfe : -13.7
Hybrid sequence
GGGAG-ACC--AGUUG--GU--CAGUGu
CCTTCGCGGCATTAGCTACAAGGTCACt miR-142-3p
Target on HEV 
Binding site 2103-2131
mfe : -14.9
Hybrid sequence
AGGUAUUUCAUC---CUU-UGUG--AUGU
TCCATTCTGTGGCGAGAGCACACTTTACA miR-149
Target on HEV 
Binding site 3077-3103
mfe : -16.9
Hybrid sequence
ccucacuUCUGUG-----CCUCGGUCu
ccgccagAGTCACCCAGGGGCGCCGGg miR-150
Target on HEV 
Binding site 6211-6236
mfe : -16
Hybrid sequence
gUGACCAUG-UU-CC-CAACC-CUCU
tACTAGTACTAATGGTGTCGGTGAGA miR-154
Target on HEV 
Binding site 6235-6255
mfe : -15.6
Hybrid sequence
gcuuCCGUUGUGCCUAUUGGau
gatcGGCCGCG-GGATAGCCct miR-17-5p
Target on HEV 
Binding site 793-817
mfe : -13.4
Hybrid sequence
ugauggacGUGACAUUC-GUGAAAC
gttagggcCATTGGCTGCCACTTTG miR-17-5p
Target on HEV 
Binding site 3031-3055
mfe : -17.1
Hybrid sequence
UGAUGGA-CGUGACAUUCG-UGAAAC
AATGCCTGGCGCCGT-CGCGGCTTTG miR-183
Target on HEV 
Binding site 4062-4092
mfe : -17.8
Hybrid sequence
guCACUUAAGAU----GGUCA----CGGUAu
ttGTGAATTGTACGAGCTAGTGGAGGCCATg miR-183
Target on HEV 
Binding site 6326-6349
mfe : -12.5
Hybrid sequence
GUC-ACUUAAGAU--GGUCACGGUAu
CAGCTG--TTCTACTCCCGTCCCGTt miR-187
Target on HEV 
Binding site 6082-6103
mfe : -16
Hybrid sequence
gccGACGUUGU-GUUCUGUGCu
cccCGGTAACACCAATACGCGg miR-188
Target on HEV 
Binding site 2032-2051
mfe : -15.2
Hybrid sequence
ugggAGGUGGUACGUUCCCUac
tggtTCCATCCT--GAGGGAct miR-189
Target on HEV 
Binding site 3295-3325
mfe : -15.6
Hybrid sequence
uGACUAUA---G-UCGAGU---CAUC-CGUg
gCGGATGTATGCGAGCTCATCCGTGGTGCAt miR-18a*
Target on HEV 
Binding site 3953-3972
mfe : -14.4
Hybrid sequence
ucuuCCUCGUGAAUCCCGUCA
tcgtGGGCCGC-TACGGCGGT miR-191
Target on HEV 
Binding site 5243-5261
mfe : -12.9
Hybrid sequence
uCGACGAAAACC-CUAAGGCaac
cGCAGC----GGCGGTTCCGgcg miR-193a
Target on HEV 
Binding site 5223-5249
mfe : -19.7
Hybrid sequence
GACC--CUGAAACAU---CCG-GUCaa
CTGGCCGCCGTCGTGGGCGGCGCAGcg miR-193a
Target on HEV 
Binding site 1895-1920
mfe : -14.2
Hybrid sequence
GAC--CCUGAAAC----AUCCGGUCAA
CTGCCGGGC-TTGACCATCGGGCGGTT miR-193b
Target on HEV 
Binding site 2318-2338
mfe : -15.12
Hybrid sequence
uuucGCCCUGAAACUCCCGGUcaa
ccgcCGGGGC---CCCGGCCAtaa miR-194
Target on HEV 
Binding site 603-623
mfe : -13.54
Hybrid sequence
AGGUGUACCUCAACGACAAUGu
TCCGCCT-GAGGTCCTGCTGCc miR-195
Target on HEV 
Binding site 1540-1561
mfe : -14.5
Hybrid sequence
cGGUUAUAA-AGACACGACgau
tCCGATGTTGACCCTGCTGagt miR-195
Target on HEV 
Binding site 3700-3724
mfe : -17.5
Hybrid sequence
CGGUUAUAA----AGACACGACGau
GCCAATGTTGACACCCTGGCTGCct miR-195
Target on HEV 
Binding site 6899-6920
mfe : -12.3
Hybrid sequence
cGGUUAUAAAGA--CACGACGAu
aCCACTA-GCCTGGGTGCTGGTc miR-196a
Target on HEV 
Binding site 2302-2321
mfe : -13.3
Hybrid sequence
GGUUGUUGUACUUUGAUGGau
CCGGCTTC-TGGCGCTACCgc miR-196b
Target on HEV 
Binding site 240-267
mfe : -14.5
Hybrid sequence
GG--UUG-UUGUCCUU----UGAUGGau
CCATAACGAGCTGGAGCTTTACTGCCgc miR-198
Target on HEV 
Binding site 1853-1877
mfe : -18.3
Hybrid sequence
GGAUA--GAGGGG----AGACCUGg
CCTATGCCGCCTCTGCAGCTGGGCt miR-202
Target on HEV 
Binding site 6002-6031
mfe : -17.22
Hybrid sequence
aaAAGGGUA--------CGGGAUAUGGaga
aaTTCCTATACTAATACACCCTATACCggt miR-202
Target on HEV 
Binding site 3310-3331
mfe : -13.32
Hybrid sequence
aaaagGGUACGGGAUAUGGAGa
ctcatCCGTGGTGCATACCCCa miR-206
Target on HEV 
Binding site 917-935
mfe : -16.7
Hybrid sequence
gGUGUGUGAAGGAAUGUAAGGu
gCAC-CCCTTCCT--TATTCCc miR-20b
Target on HEV 
Binding site 1865-1891
mfe : -17.2
Hybrid sequence
GAUG--GACGUGA--UACUCGUGAAAC
CTGCAGCTGGGCTGGAGGTGCGCTATG miR-210
Target on HEV 
Binding site 3138-3161
mfe : -23.9
Hybrid sequence
aGUCGGCGAC-A-GUGUGCGUguc
cCTGCTGCTGCTCCACATGCAgcg