Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HBV subtype adr target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    adr   adyw   unspecified   ayw   adr4   ayw(patient C)   adw2   wildtype    
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 916 rescords (19 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7b13421364-14.5121
uuGGUGUG-UUGGAUGAUGG-AGu
||:: : ::||| ||||| ||
ggCCGTTTGGGCCT-CTACCGTCc
11.726NO
2hsa-let-7b21722194-16121
uUGGUGUGUU---GGAUGAUGGAGU
||||| ||| || |||:||:|
gACCAC-CAAATGCC-CCTATCTTA
11.726NO
3hsa-let-7g277302-13121
uGACAUGU---UUGAUGAU--GGAGU
|| | || :||:||| |||||
cCTCTTCATCCTGCTGCTATGCCTCA
9.988NO
4hsa-miR-100245266-14.9121
GUGUUCAAGCCUAGAUGCC-CAA
|:| :| | | :|||:||| |||
CGCTGGAT-GTGTCTGCGGCGTT
9.137NO
5hsa-miR-105246269-14121
uGUCCU---CAGAC-UCGUAAAcu
| ||| ||||| :||:|||
gCTGGATGTGTCTGCGGCGTTTta
5.000NO
6hsa-miR-106b251269-14.3121
UAGACGUGACAGUCGUGAAAU
|| ||: ||| |:||::||||
ATGTGT-CTG-CGGCGTTTTA
5.784NO
7hsa-miR-10b6084-14.5121
uguuuaAGC-CAA-G-AUGUCCCAu
||| ||| | :|:||||
ccctgcTCGTGTTACAGGCGGGGTt
6.727NO
8hsa-miR-12613121331-14.3121
CGUAAUAAUGAGUGCCAUGCU
||: |: | |:||| ||||
GCGCTGAATCCCGCGG-ACGA
10.720NO
9hsa-miR-12727962818-13.7121
ucGGUUCG-AGUCUGCCUAGGcu
||:| | ||| :||| ||
tcCCGATCACCAGTTGGACCCtg
5.000NO
10hsa-miR-128a18971920-17121
uuuUCUC--UGGCCAAGUGACAcu
|||| |||| ||:|||
cttAGAGTCTCCGGAACATTGTtc
5.472NO
11hsa-miR-128b18971920-17121
cuuUCUC--UGGCCAAGUGACAcu
|||| |||| ||:|||
cttAGAGTCTCCGGAACATTGTtc
5.226NO
12hsa-miR-129161184-12.1121
CGUUCGGGU---CUGG--CGUUUUUc
||| |||| | || || ||||
GCA--CCCACGTGTCCTGGCCAAAAt
5.000NO
13hsa-miR-13627372761-16.2121
AGGU----AGUAGUUUUGUUUACCUCa
|||| ||: |||::| ||||:|
TCCAAACCTCGACAAGGC--ATGGGGa
7.279NO
14hsa-miR-14326582686-15.1121
aCUC---GAU----GUCACGAAGUAGAgu
||| ||| ||| |||||||:|
aGAGAAACTACACGCAGCGCTTCATTTtg
10.136NO
15hsa-miR-145934-16.1121
uuCCCUAAGGAC-CCUUUUG-ACCUg
|||: |||| :||| ||||
ctGGGGACCCTGCACCGAACATGGAg
11.062NO
16hsa-miR-15017391765-12.7121
gugaccAUGUUC--C-C--AACCCUCu
| |||| | | ||||| |
caagccTCCAAGCTGTGCCTTGGGTGg
7.336NO
17hsa-miR-15019812007-13.31121
GU-GA-CCAUGUUCC---CAACCCUCU
|| || |||: :| | |||| |||
CACCTGGGTGGGAAGTAATTTGGAAGA
7.336NO
18hsa-miR-18722052230-12.2121
GCC---GACG-UUGUGUUCUG-UGCU
||| || | : ::: |||| ||||
CGGAAACTACTGTTGTTAGACGACGA
5.000NO
19hsa-miR-18830443064-18.1121
uGGGAGGUGGUACGUUCCCUac
|:||||||| | :||| ||
tCTCTCCACC-TCTAAGAGAca
5.000NO
20hsa-miR-188315337-13.4121
ugGGAGG--UGGUACGUUCCCUAC
|:||: ||:| ||||| |||
ttCTTCTGGACTA-CCAAGGTATG
5.000NO
21hsa-miR-193a13371358-14.96121
GA-CCCUGAAACAUCCGGucaa
|| |||:| | |:||||
CTCGGGGCCGTTTGGGCCtcta
NONO
22hsa-miR-193a14821507-13.7121
gACC-C---UGAAACAU-CCGGUcaa
||| | || || | |||||
aTGGAGACCACCGTGAACGGCCAcca
NONO
23hsa-miR-193a31463163-15.11121
GACCCUGAAACAUCC--GGUCAA
||| | | || || ||||||
CTG---C-TGGT-GGCTCCAGTT
NONO
24hsa-miR-193b12801310-16121
uuuCGCCCU----GAAAC---UCCCGGUCAa
|||||| ||||| | | || ||
tgcGCGGGACGTCCTTTGTCTACGTCCCGTc
NONO
25hsa-miR-196a21952217-13.9121
gGUUGU--UGUACUUUGAUGgau
||||| | ||||||||
tCAACACTTCCGGAAACTACtgt
NONO
26hsa-miR-199a*12551276-13.3121
uuGGUUACACGUCUGAUGACau
| ::||||| | | ||||
ctCGGGTGTGCTGCCAACTGga
9.369NO
27hsa-miR-200b30653089-17.02121
CAGUAGUAAU--GGUCCGUCAuaau
|||||| | | ||| |||||
GTCATCCTCAGGCCATGCAGTggaa
5.000NO
28hsa-miR-21014651483-16121
AGUCGGCGACAGUGUGC-GUGUc
||| || ||| |||| |:||
TCA-CCTCTG---CACGTCGCAt
6.639NO
29hsa-miR-21031833205-15.7121
AGUC-GGCGACAGUGUGCGUGUc
|| | |: ||||| ||| ||:|
TCCGACTACTGTCTCACCCATAt
6.639NO
30hsa-miR-214876896-14.2121
gaCGGACAGACAC-GGACGACa
|:|| |:|| | ::|||||
ggGTCT-TTTGGGCTTTGCTGc
8.407NO
31hsa-miR-22410611089-17.9121
auuUGCCUU---GGUGAU---CACUGAAC
||| || |||||: | |:||||
ctgACGCAACCCCCACTGGATGGGGCTTG
7.182NO
32hsa-miR-27a578600-14.02121
CGCCUUGAA--UCGGUGACAcuu
|| |::||| |||||||
GCAGGGCTTTCCCCCACTGTttg
10.858NO
33hsa-miR-302a*575600-12.9121
uuuCGUUC---AUGUAGGUG-CAAAu
|||:| | | |||| ||||
ttcGCAGGGCTTTCCCCCACTGTTTg
NONO
34hsa-miR-324-5p17431767-17.34121
uGUGGUU----ACGGGAUCCCCUACGc
| |||| ||||:| ||| ||
cCTCCAAGCTGTGCCTT--GGGTGGCt
NONO
35hsa-miR-324-5p10881112-17.7121
uguGGU-UACGGGAUCC-CCUACGC
||| | ||| | || | |||||
tggCCATAGGCCATCGGCGCATGCG
NONO
36hsa-miR-326152172-14.82121
GACCUCCUUCCCGGGU-CUCc
|| |:||:|| |||| | |
CTAGGGGGAGCACCCACGTGt
NONO
37hsa-miR-33929512970-20.1121
aCUCGAGGACCUCC-UGUCCCu
|||| ||| ||| |||||
gGAGC-CCT-CAGGCTCAGGGc
NONO
38hsa-miR-33927112727-14.2121
aCUCGAGGACCUCCUGU-CCCU
||||| | |:|| ||||
aGAGCTAC-----GGCATGGGA
NONO
39hsa-miR-34512911314-13.4121
cGGGACCUGAUCC---UCAGUCGu
||:| | ||| | |||:||
tCCTTTGTCTACGTCCCGTCGGCg
NONO
40hsa-miR-34622162238-14121
ucuCCGUCCGUACGC-CCGUCugu
| :|| |: || |||||
gttGTTAGACG-ACGAGGCAGgtc
NONO
41hsa-miR-34616471667-14.5121
ucUCCGUCCGUACGCCCGUCUgu
||| |||| ||: |||| |
ctAGG-AGGC-TGTAGGCATAaa
NONO
42hsa-miR-34a905925-12.2121
uUGUUG-GUCGAUUCUGUGACGGu
||||: ::|||| | |||||
cACAATGTGGCTA--TC-CTGCCt
7.376NO
43hsa-miR-34b10331053-14121
GUUAGUCGAUUACUGUGACGGau
||| |:| | | | | |||||
CAA-CGG-TCAGGTCTCTGCCaa
7.593NO
44hsa-miR-363*14841508-15.8121
uuuaacGUAGCACU---AGGUGGgc
|| ||||| |||||
ggagacCACCGTGAACGGCCACCag
NONO
45hsa-miR-363*14041425-17121
uuuaacguaGCACUAGGUGGGC
|| |:||: ||||
ctctctttaCGCGGTCTCCCCG
NONO
46hsa-miR-37029452969-18.2121
gguCCAAGGUGGG-GUC---GUCCg
||| :||| ||| ||||
tggGGTGGAGCCCTCAGGCTCAGGg
NONO
47hsa-miR-373189211-14.3121
uguGGGGUUUUAGCUUCGUGAag
|||||| || || ||||
agtCCCCAACCTCCAATCACTca
NONO
48hsa-miR-409-3p155187-20.6121
uCCCCAAGUGG----------CUCGUUGUAAGC
|||| |||| |: ||| |||||
gGGGGAGCACCCACGTGTCCTGGCCAAAATTCG
NONO
49hsa-miR-4126183-16.8121
uGCCGAUCACCUGGUCCACUUCA
| ||| ||| |||| |::||
cCTGCTCGTGTTACAGGCGGGGT
NONO
50hsa-miR-43117541781-15.8121
ACGUA--CUGCCGGA----CGU-UCUGU
||| | |::|||:| ||| :||||
TGCCTTGGGTGGCTTTGGGGCATGGACA
NONO
let-7b
Target on HBV subtype adr 
Binding site 1342-1364
mfe : -14.5
Hybrid sequence
uuGGUGUG-UUGGAUGAUGG-AGu
ggCCGTTTGGGCCT-CTACCGTCc let-7b
Target on HBV subtype adr 
Binding site 2172-2194
mfe : -16
Hybrid sequence
uUGGUGUGUU---GGAUGAUGGAGU
gACCAC-CAAATGCC-CCTATCTTA let-7g
Target on HBV subtype adr 
Binding site 277-302
mfe : -13
Hybrid sequence
uGACAUGU---UUGAUGAU--GGAGU
cCTCTTCATCCTGCTGCTATGCCTCA miR-100
Target on HBV subtype adr 
Binding site 245-266
mfe : -14.9
Hybrid sequence
GUGUUCAAGCCUAGAUGCC-CAA
CGCTGGAT-GTGTCTGCGGCGTT miR-105
Target on HBV subtype adr 
Binding site 246-269
mfe : -14
Hybrid sequence
uGUCCU---CAGAC-UCGUAAAcu
gCTGGATGTGTCTGCGGCGTTTta miR-106b
Target on HBV subtype adr 
Binding site 251-269
mfe : -14.3
Hybrid sequence
UAGACGUGACAGUCGUGAAAU
ATGTGT-CTG-CGGCGTTTTA miR-10b
Target on HBV subtype adr 
Binding site 60-84
mfe : -14.5
Hybrid sequence
uguuuaAGC-CAA-G-AUGUCCCAu
ccctgcTCGTGTTACAGGCGGGGTt miR-126
Target on HBV subtype adr 
Binding site 1312-1331
mfe : -14.3
Hybrid sequence
CGUAAUAAUGAGUGCCAUGCU
GCGCTGAATCCCGCGG-ACGA miR-127
Target on HBV subtype adr 
Binding site 2796-2818
mfe : -13.7
Hybrid sequence
ucGGUUCG-AGUCUGCCUAGGcu
tcCCGATCACCAGTTGGACCCtg miR-128a
Target on HBV subtype adr 
Binding site 1897-1920
mfe : -17
Hybrid sequence
uuuUCUC--UGGCCAAGUGACAcu
cttAGAGTCTCCGGAACATTGTtc miR-128b
Target on HBV subtype adr 
Binding site 1897-1920
mfe : -17
Hybrid sequence
cuuUCUC--UGGCCAAGUGACAcu
cttAGAGTCTCCGGAACATTGTtc miR-129
Target on HBV subtype adr 
Binding site 161-184
mfe : -12.1
Hybrid sequence
CGUUCGGGU---CUGG--CGUUUUUc
GCA--CCCACGTGTCCTGGCCAAAAt miR-136
Target on HBV subtype adr 
Binding site 2737-2761
mfe : -16.2
Hybrid sequence
AGGU----AGUAGUUUUGUUUACCUCa
TCCAAACCTCGACAAGGC--ATGGGGa miR-143
Target on HBV subtype adr 
Binding site 2658-2686
mfe : -15.1
Hybrid sequence
aCUC---GAU----GUCACGAAGUAGAgu
aGAGAAACTACACGCAGCGCTTCATTTtg miR-145
Target on HBV subtype adr 
Binding site 9-34
mfe : -16.1
Hybrid sequence
uuCCCUAAGGAC-CCUUUUG-ACCUg
ctGGGGACCCTGCACCGAACATGGAg miR-150
Target on HBV subtype adr 
Binding site 1739-1765
mfe : -12.7
Hybrid sequence
gugaccAUGUUC--C-C--AACCCUCu
caagccTCCAAGCTGTGCCTTGGGTGg miR-150
Target on HBV subtype adr 
Binding site 1981-2007
mfe : -13.31
Hybrid sequence
GU-GA-CCAUGUUCC---CAACCCUCU
CACCTGGGTGGGAAGTAATTTGGAAGA miR-187
Target on HBV subtype adr 
Binding site 2205-2230
mfe : -12.2
Hybrid sequence
GCC---GACG-UUGUGUUCUG-UGCU
CGGAAACTACTGTTGTTAGACGACGA miR-188
Target on HBV subtype adr 
Binding site 3044-3064
mfe : -18.1
Hybrid sequence
uGGGAGGUGGUACGUUCCCUac
tCTCTCCACC-TCTAAGAGAca miR-188
Target on HBV subtype adr 
Binding site 315-337
mfe : -13.4
Hybrid sequence
ugGGAGG--UGGUACGUUCCCUAC
ttCTTCTGGACTA-CCAAGGTATG miR-193a
Target on HBV subtype adr 
Binding site 1337-1358
mfe : -14.96
Hybrid sequence
GA-CCCUGAAACAUCCGGucaa
CTCGGGGCCGTTTGGGCCtcta miR-193a
Target on HBV subtype adr 
Binding site 1482-1507
mfe : -13.7
Hybrid sequence
gACC-C---UGAAACAU-CCGGUcaa
aTGGAGACCACCGTGAACGGCCAcca miR-193a
Target on HBV subtype adr 
Binding site 3146-3163
mfe : -15.11
Hybrid sequence
GACCCUGAAACAUCC--GGUCAA
CTG---C-TGGT-GGCTCCAGTT miR-193b
Target on HBV subtype adr 
Binding site 1280-1310
mfe : -16
Hybrid sequence
uuuCGCCCU----GAAAC---UCCCGGUCAa
tgcGCGGGACGTCCTTTGTCTACGTCCCGTc miR-196a
Target on HBV subtype adr 
Binding site 2195-2217
mfe : -13.9
Hybrid sequence
gGUUGU--UGUACUUUGAUGgau
tCAACACTTCCGGAAACTACtgt miR-199a*
Target on HBV subtype adr 
Binding site 1255-1276
mfe : -13.3
Hybrid sequence
uuGGUUACACGUCUGAUGACau
ctCGGGTGTGCTGCCAACTGga miR-200b
Target on HBV subtype adr 
Binding site 3065-3089
mfe : -17.02
Hybrid sequence
CAGUAGUAAU--GGUCCGUCAuaau
GTCATCCTCAGGCCATGCAGTggaa miR-210
Target on HBV subtype adr 
Binding site 1465-1483
mfe : -16
Hybrid sequence
AGUCGGCGACAGUGUGC-GUGUc
TCA-CCTCTG---CACGTCGCAt miR-210
Target on HBV subtype adr 
Binding site 3183-3205
mfe : -15.7
Hybrid sequence
AGUC-GGCGACAGUGUGCGUGUc
TCCGACTACTGTCTCACCCATAt miR-214
Target on HBV subtype adr 
Binding site 876-896
mfe : -14.2
Hybrid sequence
gaCGGACAGACAC-GGACGACa
ggGTCT-TTTGGGCTTTGCTGc miR-224
Target on HBV subtype adr 
Binding site 1061-1089
mfe : -17.9
Hybrid sequence
auuUGCCUU---GGUGAU---CACUGAAC
ctgACGCAACCCCCACTGGATGGGGCTTG miR-27a
Target on HBV subtype adr 
Binding site 578-600
mfe : -14.02
Hybrid sequence
CGCCUUGAA--UCGGUGACAcuu
GCAGGGCTTTCCCCCACTGTttg miR-302a*
Target on HBV subtype adr 
Binding site 575-600
mfe : -12.9
Hybrid sequence
uuuCGUUC---AUGUAGGUG-CAAAu
ttcGCAGGGCTTTCCCCCACTGTTTg miR-324-5p
Target on HBV subtype adr 
Binding site 1743-1767
mfe : -17.34
Hybrid sequence
uGUGGUU----ACGGGAUCCCCUACGc
cCTCCAAGCTGTGCCTT--GGGTGGCt miR-324-5p
Target on HBV subtype adr 
Binding site 1088-1112
mfe : -17.7
Hybrid sequence
uguGGU-UACGGGAUCC-CCUACGC
tggCCATAGGCCATCGGCGCATGCG miR-326
Target on HBV subtype adr 
Binding site 152-172
mfe : -14.82
Hybrid sequence
GACCUCCUUCCCGGGU-CUCc
CTAGGGGGAGCACCCACGTGt miR-339
Target on HBV subtype adr 
Binding site 2951-2970
mfe : -20.1
Hybrid sequence
aCUCGAGGACCUCC-UGUCCCu
gGAGC-CCT-CAGGCTCAGGGc miR-339
Target on HBV subtype adr 
Binding site 2711-2727
mfe : -14.2
Hybrid sequence
aCUCGAGGACCUCCUGU-CCCU
aGAGCTAC-----GGCATGGGA miR-345
Target on HBV subtype adr 
Binding site 1291-1314
mfe : -13.4
Hybrid sequence
cGGGACCUGAUCC---UCAGUCGu
tCCTTTGTCTACGTCCCGTCGGCg miR-346
Target on HBV subtype adr 
Binding site 2216-2238
mfe : -14
Hybrid sequence
ucuCCGUCCGUACGC-CCGUCugu
gttGTTAGACG-ACGAGGCAGgtc miR-346
Target on HBV subtype adr 
Binding site 1647-1667
mfe : -14.5
Hybrid sequence
ucUCCGUCCGUACGCCCGUCUgu
ctAGG-AGGC-TGTAGGCATAaa miR-34a
Target on HBV subtype adr 
Binding site 905-925
mfe : -12.2
Hybrid sequence
uUGUUG-GUCGAUUCUGUGACGGu
cACAATGTGGCTA--TC-CTGCCt miR-34b
Target on HBV subtype adr 
Binding site 1033-1053
mfe : -14
Hybrid sequence
GUUAGUCGAUUACUGUGACGGau
CAA-CGG-TCAGGTCTCTGCCaa miR-363*
Target on HBV subtype adr 
Binding site 1484-1508
mfe : -15.8
Hybrid sequence
uuuaacGUAGCACU---AGGUGGgc
ggagacCACCGTGAACGGCCACCag miR-363*
Target on HBV subtype adr 
Binding site 1404-1425
mfe : -17
Hybrid sequence
uuuaacguaGCACUAGGUGGGC
ctctctttaCGCGGTCTCCCCG miR-370
Target on HBV subtype adr 
Binding site 2945-2969
mfe : -18.2
Hybrid sequence
gguCCAAGGUGGG-GUC---GUCCg
tggGGTGGAGCCCTCAGGCTCAGGg miR-373
Target on HBV subtype adr 
Binding site 189-211
mfe : -14.3
Hybrid sequence
uguGGGGUUUUAGCUUCGUGAag
agtCCCCAACCTCCAATCACTca miR-409-3p
Target on HBV subtype adr 
Binding site 155-187
mfe : -20.6
Hybrid sequence
uCCCCAAGUGG----------CUCGUUGUAAGC
gGGGGAGCACCCACGTGTCCTGGCCAAAATTCG miR-412
Target on HBV subtype adr 
Binding site 61-83
mfe : -16.8
Hybrid sequence
uGCCGAUCACCUGGUCCACUUCA
cCTGCTCGTGTTACAGGCGGGGT miR-431
Target on HBV subtype adr 
Binding site 1754-1781
mfe : -15.8
Hybrid sequence
ACGUA--CUGCCGGA----CGU-UCUGU
TGCCTTGGGTGGCTTTGGGGCATGGACA