Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HGV target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
 Browse   strain Iowan, complete genome   wildtype(complete genome)   
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 4132 rescords (83 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7a41894208-12.5121
uuGAUAUGUUGGAUGAUGGAGu
|| ||| :|| |||:|| |
tgCTCTAC-GCC-ACTGCCACc
11.678NO
2hsa-let-7a87898814-12.5121
uuGAUAUGUU---GGA--UGAUGGAGU
||: :||| || :| ||||||
ggCTG-GCAAGGTGCTGAGCGACCTCA
11.678NO
3hsa-let-7b30033023-18.5121
uUGGUGUGUUGGAUGAUGGAGu
||||||::: || || :|||
gACCACATGGGCT-CTTTCTCg
11.726NO
4hsa-let-7c4568-13.06121
uuGGUAUGUUGGAU---GAUGGAgu
||||| |||| | |||:||
ccCCATA-AACCGACGCCTATCTaa
11.774NO
5hsa-let-7e78347854-13.8121
ugaUAUGUUGGAGGAUGGAGU
| | ::|| || :|||||
aagAGAAGGCCCCCCGCCTCA
6.037NO
6hsa-let-7f16211643-13.3121
uuGAUAUGUUAGAU-GAUGGAGU
||: || :|| : ||:|:|||
ttCTGGACCGTCGGCCTGCTTCA
10.092NO
7hsa-miR-10540784103-13.2121
ugUCCUCAGAC-----UC-GUAAACu
|||:|| || :| ||||||
tgAGGGGTGTGTCGGTGGTCATTTGt
5.000NO
8hsa-miR-106a92289254-13.25121
cgauGGAC-GUGAC-AUU-CGUGAaaa
|||| :: || ||| |||||
aaagCCTGATGGTGCTAATGCACTgcc
8.618NO
9hsa-miR-10a12461271-15.8121
GUGUUUAAGCCUAGA----UGUCCCAu
|:|: |||| | || | |||||
CGCGTATTCCCA-CTGGGGAGAGGGTg
7.071NO
10hsa-miR-10b224244-13.3121
uguuuaaGCCAAGAUGUCCcau
||| || |||||
ccgcgcaCGG-TCCACAGGtgc
6.727NO
11hsa-miR-122a56605686-15.44121
uGUUUGUG-GUAAC--A-GUGUGAGGu
||||| | | | | | |:| ||||
gCAAACCCGCTTAGCCTCCGCTCTCCt
12.384NO
12hsa-miR-122a82808302-14121
uguuuguggUAACAGUGUGAGGu
| |||| |:||||
gggctgaaaAATGTCTCGCTCCt
12.384NO
13hsa-miR-124a14521469-17.2121
ACCGUAAGUGGCGCACGGAAuu
||| :||| ||||:|||
TGGGGTTC----CGTGTCTTgg
5.000NO
14hsa-miR-125a19731991-14121
GUGUCCAAUUUCCCAGAGUCCcu
||| || ||| |||| |||
CAC-GG---AAGTGTCTGAGGca
10.086NO
15hsa-miR-125a46224644-20.9121
GUGUCCAAUUUC--CCAGAGUCCCu
|||:||| :::| || || |||
CACGGGTAGGGGCAGG--TCTGGGc
10.086NO
16hsa-miR-125a12561284-22.9121
GUGUCCAAUUUCCCA-----GAG-UCCCU
||| || |:||||| || |||||
CACTGGGGAGAGGGTGTGGGATCGAGGGA
10.086NO
17hsa-miR-12692479267-12.9121
CGUAAUAAUGAGUGCCA-UGCu
||| |: |||: |||| :||
GCACTGCCACTT-CGGTGGCGg
10.720NO
18hsa-miR-12761106132-14.71121
uCGGUUCGAGUCUG--CCUAGGcu
||| | ||| || ||| ||
tGCCCTGGTCA-ACAGGGAGCCta
5.000NO
19hsa-miR-12714131435-14.42121
ucGGUU---CGAGUCUGCCUAGGCu
|||| | || |:||:||:|
ccCCAATATG-TC-TATGGGTCTGt
5.000NO
20hsa-miR-12781058126-17.3121
UCGGUUCGAGUC-UGCCUAGGCu
|| | | | ||| |:||:| ||
AGACCATC-CAGAATGGGTGCGt
5.000NO
21hsa-miR-12791679187-14.2121
uCGGUUCGAGUCUGCCUAGGCu
||:::| | | | ||: |||
cGCTGGG-TAAAAAGGGCCCGg
5.000NO
22hsa-miR-12720262055-17.7121
UCG--GUUCGA--GUCU----GCCUAGGCU
||| | :|:| |||: |||| |:||
AGCCTCTGGTTCGCAGGTGTTCGGAGCTGA
5.000NO
23hsa-miR-12767336754-17.5121
uCGGUUCGAGUCUGCC----UAGGCU
||| ||| || || ||||||
cGCC---CTCTGA-GGTGTCATCCGA
5.000NO
24hsa-miR-128a26902709-15121
uUUUCUC-UGGCCAAGUGACACu
||||:| ||| | :|||||
tAAAGGGTACCAG---GCTGTGc
5.472NO
25hsa-miR-128a91769205-18.1121
UUUUCUCUGGCC--AA------GUGACACu
|||||:| |||| || ||: |||
AAAAGGGCCCGGCCTTGGGAGGCATGGTGg
5.472NO
26hsa-miR-128b26902709-14.9121
cUUUCUC-UGGCCAAGUGACACu
||||:| ||| | :|||||
tAAAGGGTACCAG---GCTGTGc
5.226NO
27hsa-miR-128b50975116-12.9121
CUUUCUCUGGCCAAGUGACACU
||::| || || |:||| ||
GAGGGTTAC--GTCCGCTGCGA
5.226NO
28hsa-miR-128b65066531-13.2121
CUUUCUCUGGCCA--AGUG--ACACU
|: :| |||| | ||| |||||
GGTGGTGACCCCTACCCACGTTGTGA
5.226NO
29hsa-miR-130b90529074-18.1121
uaCGGGA-AAGUAGUAACGUGAc
||||| |||||:| || ||
taGCCCTGCTCATCGTAGCCCTc
5.095NO
30hsa-miR-133a862887-12.2121
uguCG-ACCAACU---UCCCCUGGuu
|| |||| | |||| ||
tggGCGAGGTTTACTCCGGGGTCCtg
5.000NO
31hsa-miR-133a13121334-15.3121
UGUC---GACCAACUUCCCCUGGuu
||:| |||| | ||| ||
ACGGCCCCTGG--GTTTGGGTCCcg
5.000NO
32hsa-miR-133a50095030-15.72121
UGUCGACCAACUUC-CCCUGGUu
|| || | |||:| |||:| |
ACTCCT-GCTGAGGTGGGGCAAt
5.000NO
33hsa-miR-133a57155737-13.1121
UGUCGACCAACUUCCCC---UGGUu
||: ||| | : |||| ||||
ACGCCTG--TCGTGGGGTTAACCAt
5.000NO
34hsa-miR-133b24842509-18.4121
auCGACC-----AACUUCCCCUgguu
||||| |||| |||||
ccGCTGGCACTTTTGATGGGGAtttc
NONO
35hsa-miR-133b863887-12.3121
auCG-ACCAACU---UCCCCUGGuu
|| |||| | |||| ||
ggGCGAGGTTTACTCCGGGGTCCtg
NONO
36hsa-miR-133b32623283-13121
aucgaCC-AACUUCCCCUGGUu
|| || ||||::||
gaaagGGCTTCCTGGGGGTCAc
NONO
37hsa-miR-133b81508181-18.8121
AUCG----ACCA------ACUUCCCC-UGGUu
|:|| |||| ||:|||| :|||
TGGCACAATGGTAACCCCCGAGGGGGTGCCAg
NONO
38hsa-miR-133b84528483-12.2121
AUCGAC-CA----ACUUC--CCCU----GGUu
|||||| || || || |||| |||
TAGCTGAGTGCAATGCAGATGGGAAACGCCAt
NONO
39hsa-miR-13472177238-14.1121
ggGAGACC--AGUUGGUCAGUGu
| :||| |::| |:|||:|
ttCATTGGGATTGA-CGGTCGCt
5.000NO
40hsa-miR-13488648881-18.3121
gGGAGACCAGUUGGUCAGUGu
| | || | ||:|||:|
gCGTATGCT---CCGGTCGCg
5.000NO
41hsa-miR-13430783099-13.2121
ggGAGA-CCAGUUGGUCAGUGU
| || || |:: | |||:||
ttCACTAGGACGGACTGTCGCA
5.000NO
42hsa-miR-135a26442672-20.3121
aGUGUAUCCUUA--UU----UUUCGGUAu
|:|| :||::| || ||:|||:|
gCGCAGGGGGGTGGAAGCACAAGGCCGTg
NONO
43hsa-miR-13642394263-13.7121
AGGUAGUAGUUUUG--UUUACCUca
|| |||||::|:|| || ||||
TCAATCATTGAGACAAAACTGGAcg
7.279NO
44hsa-miR-13830923108-13.1121
cuaAGUGUUGUGGUCga
||:|| ||:|||
ctgTCGCATCATCAGag
5.000NO
45hsa-miR-138778793-15.8121
cuAAGUGUUGUGGUCGA
| |:|::| ||||||
agTCCGCGGC-CCAGCT
5.000NO
46hsa-miR-14343014329-16.7121
ACUCG---AUGUCACG----AAGUAGAGu
||||| |:|:| | ||||||
TGAGCGGATGCGGACCGGAAGGCATCTCg
10.136NO
47hsa-miR-146a19091934-14.3121
uuGGGU-ACCUU--AAG-UCAAGAgu
|| | ||||| ||| :|||||
ctCCGACTGGAACGTTCGGGTTCTtc
NONO
48hsa-miR-14987868811-13.8121
CCUC--AC--UUCUGUGCCUCGGUcu
|||| || |||:::| |||| |
GGAGGCTGGCAAGGTGCTGAGCGAcc
5.000NO
49hsa-miR-149477498-14.8121
ccuCACUUCUGUGCCUCGGUCu
| |: |:| :| ||||:|
tccGCGGCGGCCTGCAGCCGGg
5.000NO
50hsa-miR-149971996-13.5121
cCUC---ACUUCUG--UGCCUCGGUCu
||| ||:|||: || ||| |||
tGAGTTTTGGAGATGGACTGAG-CAGt
5.000NO
let-7a
Target on HGV 
Binding site 4189-4208
mfe : -12.5
Hybrid sequence
uuGAUAUGUUGGAUGAUGGAGu
tgCTCTAC-GCC-ACTGCCACc let-7a
Target on HGV 
Binding site 8789-8814
mfe : -12.5
Hybrid sequence
uuGAUAUGUU---GGA--UGAUGGAGU
ggCTG-GCAAGGTGCTGAGCGACCTCA let-7b
Target on HGV 
Binding site 3003-3023
mfe : -18.5
Hybrid sequence
uUGGUGUGUUGGAUGAUGGAGu
gACCACATGGGCT-CTTTCTCg let-7c
Target on HGV 
Binding site 45-68
mfe : -13.06
Hybrid sequence
uuGGUAUGUUGGAU---GAUGGAgu
ccCCATA-AACCGACGCCTATCTaa let-7e
Target on HGV 
Binding site 7834-7854
mfe : -13.8
Hybrid sequence
ugaUAUGUUGGAGGAUGGAGU
aagAGAAGGCCCCCCGCCTCA let-7f
Target on HGV 
Binding site 1621-1643
mfe : -13.3
Hybrid sequence
uuGAUAUGUUAGAU-GAUGGAGU
ttCTGGACCGTCGGCCTGCTTCA miR-105
Target on HGV 
Binding site 4078-4103
mfe : -13.2
Hybrid sequence
ugUCCUCAGAC-----UC-GUAAACu
tgAGGGGTGTGTCGGTGGTCATTTGt miR-106a
Target on HGV 
Binding site 9228-9254
mfe : -13.25
Hybrid sequence
cgauGGAC-GUGAC-AUU-CGUGAaaa
aaagCCTGATGGTGCTAATGCACTgcc miR-10a
Target on HGV 
Binding site 1246-1271
mfe : -15.8
Hybrid sequence
GUGUUUAAGCCUAGA----UGUCCCAu
CGCGTATTCCCA-CTGGGGAGAGGGTg miR-10b
Target on HGV 
Binding site 224-244
mfe : -13.3
Hybrid sequence
uguuuaaGCCAAGAUGUCCcau
ccgcgcaCGG-TCCACAGGtgc miR-122a
Target on HGV 
Binding site 5660-5686
mfe : -15.44
Hybrid sequence
uGUUUGUG-GUAAC--A-GUGUGAGGu
gCAAACCCGCTTAGCCTCCGCTCTCCt miR-122a
Target on HGV 
Binding site 8280-8302
mfe : -14
Hybrid sequence
uguuuguggUAACAGUGUGAGGu
gggctgaaaAATGTCTCGCTCCt miR-124a
Target on HGV 
Binding site 1452-1469
mfe : -17.2
Hybrid sequence
ACCGUAAGUGGCGCACGGAAuu
TGGGGTTC----CGTGTCTTgg miR-125a
Target on HGV 
Binding site 1973-1991
mfe : -14
Hybrid sequence
GUGUCCAAUUUCCCAGAGUCCcu
CAC-GG---AAGTGTCTGAGGca miR-125a
Target on HGV 
Binding site 4622-4644
mfe : -20.9
Hybrid sequence
GUGUCCAAUUUC--CCAGAGUCCCu
CACGGGTAGGGGCAGG--TCTGGGc miR-125a
Target on HGV 
Binding site 1256-1284
mfe : -22.9
Hybrid sequence
GUGUCCAAUUUCCCA-----GAG-UCCCU
CACTGGGGAGAGGGTGTGGGATCGAGGGA miR-126
Target on HGV 
Binding site 9247-9267
mfe : -12.9
Hybrid sequence
CGUAAUAAUGAGUGCCA-UGCu
GCACTGCCACTT-CGGTGGCGg miR-127
Target on HGV 
Binding site 6110-6132
mfe : -14.71
Hybrid sequence
uCGGUUCGAGUCUG--CCUAGGcu
tGCCCTGGTCA-ACAGGGAGCCta miR-127
Target on HGV 
Binding site 1413-1435
mfe : -14.42
Hybrid sequence
ucGGUU---CGAGUCUGCCUAGGCu
ccCCAATATG-TC-TATGGGTCTGt miR-127
Target on HGV 
Binding site 8105-8126
mfe : -17.3
Hybrid sequence
UCGGUUCGAGUC-UGCCUAGGCu
AGACCATC-CAGAATGGGTGCGt miR-127
Target on HGV 
Binding site 9167-9187
mfe : -14.2
Hybrid sequence
uCGGUUCGAGUCUGCCUAGGCu
cGCTGGG-TAAAAAGGGCCCGg miR-127
Target on HGV 
Binding site 2026-2055
mfe : -17.7
Hybrid sequence
UCG--GUUCGA--GUCU----GCCUAGGCU
AGCCTCTGGTTCGCAGGTGTTCGGAGCTGA miR-127
Target on HGV 
Binding site 6733-6754
mfe : -17.5
Hybrid sequence
uCGGUUCGAGUCUGCC----UAGGCU
cGCC---CTCTGA-GGTGTCATCCGA miR-128a
Target on HGV 
Binding site 2690-2709
mfe : -15
Hybrid sequence
uUUUCUC-UGGCCAAGUGACACu
tAAAGGGTACCAG---GCTGTGc miR-128a
Target on HGV 
Binding site 9176-9205
mfe : -18.1
Hybrid sequence
UUUUCUCUGGCC--AA------GUGACACu
AAAAGGGCCCGGCCTTGGGAGGCATGGTGg miR-128b
Target on HGV 
Binding site 2690-2709
mfe : -14.9
Hybrid sequence
cUUUCUC-UGGCCAAGUGACACu
tAAAGGGTACCAG---GCTGTGc miR-128b
Target on HGV 
Binding site 5097-5116
mfe : -12.9
Hybrid sequence
CUUUCUCUGGCCAAGUGACACU
GAGGGTTAC--GTCCGCTGCGA miR-128b
Target on HGV 
Binding site 6506-6531
mfe : -13.2
Hybrid sequence
CUUUCUCUGGCCA--AGUG--ACACU
GGTGGTGACCCCTACCCACGTTGTGA miR-130b
Target on HGV 
Binding site 9052-9074
mfe : -18.1
Hybrid sequence
uaCGGGA-AAGUAGUAACGUGAc
taGCCCTGCTCATCGTAGCCCTc miR-133a
Target on HGV 
Binding site 862-887
mfe : -12.2
Hybrid sequence
uguCG-ACCAACU---UCCCCUGGuu
tggGCGAGGTTTACTCCGGGGTCCtg miR-133a
Target on HGV 
Binding site 1312-1334
mfe : -15.3
Hybrid sequence
UGUC---GACCAACUUCCCCUGGuu
ACGGCCCCTGG--GTTTGGGTCCcg miR-133a
Target on HGV 
Binding site 5009-5030
mfe : -15.72
Hybrid sequence
UGUCGACCAACUUC-CCCUGGUu
ACTCCT-GCTGAGGTGGGGCAAt miR-133a
Target on HGV 
Binding site 5715-5737
mfe : -13.1
Hybrid sequence
UGUCGACCAACUUCCCC---UGGUu
ACGCCTG--TCGTGGGGTTAACCAt miR-133b
Target on HGV 
Binding site 2484-2509
mfe : -18.4
Hybrid sequence
auCGACC-----AACUUCCCCUgguu
ccGCTGGCACTTTTGATGGGGAtttc miR-133b
Target on HGV 
Binding site 863-887
mfe : -12.3
Hybrid sequence
auCG-ACCAACU---UCCCCUGGuu
ggGCGAGGTTTACTCCGGGGTCCtg miR-133b
Target on HGV 
Binding site 3262-3283
mfe : -13
Hybrid sequence
aucgaCC-AACUUCCCCUGGUu
gaaagGGCTTCCTGGGGGTCAc miR-133b
Target on HGV 
Binding site 8150-8181
mfe : -18.8
Hybrid sequence
AUCG----ACCA------ACUUCCCC-UGGUu
TGGCACAATGGTAACCCCCGAGGGGGTGCCAg miR-133b
Target on HGV 
Binding site 8452-8483
mfe : -12.2
Hybrid sequence
AUCGAC-CA----ACUUC--CCCU----GGUu
TAGCTGAGTGCAATGCAGATGGGAAACGCCAt miR-134
Target on HGV 
Binding site 7217-7238
mfe : -14.1
Hybrid sequence
ggGAGACC--AGUUGGUCAGUGu
ttCATTGGGATTGA-CGGTCGCt miR-134
Target on HGV 
Binding site 8864-8881
mfe : -18.3
Hybrid sequence
gGGAGACCAGUUGGUCAGUGu
gCGTATGCT---CCGGTCGCg miR-134
Target on HGV 
Binding site 3078-3099
mfe : -13.2
Hybrid sequence
ggGAGA-CCAGUUGGUCAGUGU
ttCACTAGGACGGACTGTCGCA miR-135a
Target on HGV 
Binding site 2644-2672
mfe : -20.3
Hybrid sequence
aGUGUAUCCUUA--UU----UUUCGGUAu
gCGCAGGGGGGTGGAAGCACAAGGCCGTg miR-136
Target on HGV 
Binding site 4239-4263
mfe : -13.7
Hybrid sequence
AGGUAGUAGUUUUG--UUUACCUca
TCAATCATTGAGACAAAACTGGAcg miR-138
Target on HGV 
Binding site 3092-3108
mfe : -13.1
Hybrid sequence
cuaAGUGUUGUGGUCga
ctgTCGCATCATCAGag miR-138
Target on HGV 
Binding site 778-793
mfe : -15.8
Hybrid sequence
cuAAGUGUUGUGGUCGA
agTCCGCGGC-CCAGCT miR-143
Target on HGV 
Binding site 4301-4329
mfe : -16.7
Hybrid sequence
ACUCG---AUGUCACG----AAGUAGAGu
TGAGCGGATGCGGACCGGAAGGCATCTCg miR-146a
Target on HGV 
Binding site 1909-1934
mfe : -14.3
Hybrid sequence
uuGGGU-ACCUU--AAG-UCAAGAgu
ctCCGACTGGAACGTTCGGGTTCTtc miR-149
Target on HGV 
Binding site 8786-8811
mfe : -13.8
Hybrid sequence
CCUC--AC--UUCUGUGCCUCGGUcu
GGAGGCTGGCAAGGTGCTGAGCGAcc miR-149
Target on HGV 
Binding site 477-498
mfe : -14.8
Hybrid sequence
ccuCACUUCUGUGCCUCGGUCu
tccGCGGCGGCCTGCAGCCGGg miR-149
Target on HGV 
Binding site 971-996
mfe : -13.5
Hybrid sequence
cCUC---ACUUCUG--UGCCUCGGUCu
tGAGTTTTGGAGATGGACTGAG-CAGt