Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HCV 5a target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    
Subtypes1a  1b  2a  3a  4a  5a  6a  10a  11a 
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 3500 rescords (71 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7a77817802-12.1121
uugauauGUUGGAUGAUGGAGu
||: |||||:|| |
ttaaggcCAGACTACTGCCCCt
11.678NO
2hsa-let-7b77817802-12.9121
uugguguGUUGGAUGAUGGAGu
||: |||||:|| |
ttaaggcCAGACTACTGCCCCt
11.726NO
3hsa-let-7b22982320-18.4121
uuGGUGUGUUGG-AUGAUGGAGU
|||:|: :|| |:|| |:|||
ggCCATATTGCCGTGCTCCTTCA
11.726NO
4hsa-let-7b70247051-15.6121
UUGGU---G-UGUUGGA--UGAUGGAGU
||| | | | | ||| |||:|:|||
AACAAGGTCGAGATCCTTGACTGCTTCA
11.726NO
5hsa-let-7b79417963-14.4121
uUGGUGUGUUGGAUGAUGG-AGU
||| ||: :|| || ||| |||
tACCCCATTGCCGACAACCATCA
11.726NO
6hsa-let-7c41464170-13.3121
UUGG-UAUGUUGGAU--GAUGGAgu
|:|| :||:||| || ||||:|
AGCCGGTATAACATACTCTACTTat
11.774NO
7hsa-let-7c77817802-13.8121
uugguauGUUGGAUGAUGGAGu
||: |||||:|| |
ttaaggcCAGACTACTGCCCCt
11.774NO
8hsa-let-7c86308652-16.9121
UUG-GUA-UGUUGGAUGAUGGAGu
|:| |:| ||| |:|:|| ||||
AGCTCGTAACATCTTGCT-CCTCg
11.774NO
9hsa-let-7f77817802-12.1121
uugauauGUUAGAUGAUGGAGu
||: |||||:|| |
ttaaggcCAGACTACTGCCCCt
10.092NO
10hsa-miR-10015101535-12.7121
guguUCAAGC--CUA--GAUGCCCaa
|||||| || | |||||
ttgcAGTTCGTAAATACCAACGGGag
9.137NO
11hsa-miR-10a17471770-15.4121
guguuuaagcCUAG-AUGUCCCAu
|| | |:|:||||
tatcccccacGACCGTGCGGGGTg
7.071NO
12hsa-miR-10a63166334-13.4121
GUGUUUAAGCCUAGAUG-UCCCAu
|| ||: ||: ||| |||||
CAGAAG---GGG--TACAAGGGTg
7.071NO
13hsa-miR-10a77187749-13.1121
gUGUUUA--AGC--CU--AGAUGUC---CCAu
||||:| ||| || |||||| |||
tACAAGTCCTCGACGACCACTACAGAGAGGTt
7.071NO
14hsa-miR-10a57935818-17.2121
GUGUUUAAGCC----UAG-AUGUCCCAU
|:||: |||| ||| :| |||||
CGCAG--TCGGTAACATCGGGCTGGGTA
7.071NO
15hsa-miR-10b88318854-12.4121
UGUUUAAG-C-CAAGAUGUCCCau
|| ||| | ||||||||| |
ACTTTTTCAGCGTTCTACAGAGcc
6.727NO
16hsa-miR-10b628645-12.5121
uGUUUAAGCCAAGAUGUCCCAu
| ||||:|| ::|||||
cCCAATTTGG----GTAGGGTc
6.727NO
17hsa-miR-10b63156334-12.5121
uGUUUAAGCCAAGAUG-UCCCAu
||:| || ||| |||||
cCAGAAGGGG---TACAAGGGTg
6.727NO
18hsa-miR-10b48444865-14121
UGUUUAAGCCAAGAUGUCCCAU
||:| ||| | |:|| ||||
ACGATGCCGGGTGTGCATGGTA
6.727NO
19hsa-miR-12731053125-13121
uCGGUUCGAGUCU-GCCUAGGcu
| :|:||| || |||| ||
tGGTAGGCT--GACCGGAACCta
5.000NO
20hsa-miR-12740854111-15.32121
uCGGUUCGAGUCUG-----CCUAGGcu
|:|||| || || ||| ||
tGTCAAGAGCATACGGCGTGGACCCca
5.000NO
21hsa-miR-12770177041-14.8121
uCGGUUCGAGU--CUGC-CUAGGcu
||::|| || | || |||||
gGCTGAGAACAAGGTCGAGATCCtt
5.000NO
22hsa-miR-127418439-16.1121
uCG-GUUCGAGUCUGCCUAGGCu
|| |:| |||:|| | ||:||
cGCGCGA-CTCGGAAGAATTCGg
5.000NO
23hsa-miR-12955465573-13.3121
CGUU-CGG---GUCUGG---CGUUUuuc
|||| ||| ||| :| |||||
GCAAGGCCGAGCAGTTCTGGGCAAAgca
5.000NO
24hsa-miR-130b91929214-18121
uaCGGGAAAGUAGUAA-CGUGAC
||: |||| |:|| ||:|||
caGCTGGTTCACCGTTGGCGCTG
5.095NO
25hsa-miR-133a53005327-15.54121
UGUCGA----CCAACU--UCCCCUGGUu
|| ||| ||| |: || |:|||
ACTGCTTGACGGTGGGCTCGGTGGCCAt
5.000NO
26hsa-miR-133a13691388-14.2121
uGUCGACCAACUUCCCCUGGUU
|| | || | | ||| ||||
tCAAC-GGCTAACTGGG-CCAA
5.000NO
27hsa-miR-133b90029034-17.8121
AUCGACCAA-------CUU----CCCC-UGGuu
|:||| ||| ||| |||| |||
TGGCTAGTTGCCTCAGGAAGCTTGGGGTACCcc
NONO
28hsa-miR-147638655-14.3121
CGUCUUCGUAAAGGUGUGug
|:||:: || ||||:||
GTAGGGTCA--TCCATACcc
5.000NO
29hsa-miR-14752335260-12.1121
CGUCU-----UC--GUAAAGGU-GUGug
||||| || |||| ||| |||
GCAGACTTGGAGGTCATTACCAGCACtt
5.000NO
30hsa-miR-14768086827-12.9121
cGUCUUCGUAAAGGUGU-GUG
||| | | ||||| |||
tCAG-ATCCCGCCCACATCAC
5.000NO
31hsa-miR-14933913411-12.8121
cCUCACUUCUGUGCCUCGGUcu
||| |:: || || ||||
cGAG-GGGTACTGGGCGCCAta
5.000NO
32hsa-miR-14972627283-13.8121
cCUCACUUCUGUGCC-UCGGUcu
| | ||:|| | || |||||
cGCG-GAGGAAAAGGAAGCCAat
5.000NO
33hsa-miR-14948324854-19121
ccuCACUU-CUGUGCCU-CGGUCu
||||: | :|| || |||:|
tctGTGAGTGCTAC-GATGCCGGg
5.000NO
34hsa-miR-15b25852608-12.2121
acauuugGUACUACACGA--CGAu
|:| :|||||| |||
gcctgctCGTTGTGTGCTTGGCTt
9.090NO
35hsa-miR-15b70207049-12.7121
ACAUUUG-----GUACUA--CAC-GACGAu
|| :||| |: ||| || |||||
TGAGAACAAGGTCGAGATCCTTGACTGCTt
9.090NO
36hsa-miR-16975998-14.32121
gCGGUUAUA--AAUGCACGACgau
| :|||:| || ||||||
aGATAATGTCAGTAGGTGCTGggt
11.196NO
37hsa-miR-17-3p90949114-15.7121
uguUCACGGAAGU-GACGUCa
|| ||| || ||||:|
ggtAGGGCCGCCATCTGCGGc
6.278NO
38hsa-miR-18460566079-13.1121
ugggaaUAGU--CAAGAGGCAGgu
|||| | |||||| |
ggggcaATCATGGGTCTCCGACac
5.000NO
39hsa-miR-18421142143-20.6121
UGGGAAUAGUCAA----G----AGGCAGGU
||||||| |:||| | |||| ||
ACCCTTACCGGTTGTGGCATTACCCGTGCA
5.000NO
40hsa-miR-18828652888-20.8121
uGGGAGGUG--GUAC-GUUCCCuac
||| ||:: || | :|||||
gCCC-CCGTTGCAGGTTAAGGGtgg
5.000NO
41hsa-miR-18947304749-12121
uGACUAUAGUCGAGUCAUCCgug
| || : |||| |||||
cCAGAAGCCAGC---GTAGGggc
5.126NO
42hsa-miR-18939383963-15121
ugacuaUAGUCGAG--UCA-UCCGUG
|| ||:|| ||| :|||||
tccctcATGAGTTCCAAGTGGGGCAC
5.126NO
43hsa-miR-18a*92809299-12.1121
ucuuccUCGUGAAUCCCGUCa
|||: | :|||:||
ctacttAGCG-TAGGGGTAGg
NONO
44hsa-miR-193a12061229-14.7121
GAC-CCUGAAACAU--CCGGUcaa
| | || | | || |||||
CAGTGGCCATATTACCGGCCAccg
NONO
45hsa-miR-193b541564-13.5121
UUUCGCCCUGAAACUCCCGGUCaa
|| | || || |: || |||
AATGAAGGCCTCGGGTGGGCAGgg
NONO
46hsa-miR-196a768790-13.8121
GGU-UGUUGU-ACUUUGAUGGau
|:| :||||| ||| |||||
CTATGCAACAGGGAATCTACCcg
NONO
47hsa-miR-196a64756499-17.1121
gGUUGUUGUACU---UUG-AUGGAu
|||||||| |: |:| |||||
aCAACAACAGGGCCCAGCGTACCTg
NONO
48hsa-miR-19758605898-20121
CGACC-------CACC------UCU--U-C-CACCACUU
||||| || | ||| | | |||| |||
GCTGGGGCGCTCGTCGCCTTCAAGATCATGTGTGGGGAA
6.957NO
49hsa-miR-19889298954-14.9121
gGAUAGAGGG-----GAG--ACCUGg
||||| ::| ||| |||||
gCTATCATTCAAAGACTCCATGGACt
5.000NO
50hsa-miR-199a57895811-13.1121
CUUGUCCAUCAGAC-UUGUGACCC
|::| | |||| | ||||: |||
GGGC-CGCAGTCGGTAACATCGGG
10.003NO
let-7a
Target on hcv 5a 
Binding site 7781-7802
mfe : -12.1
Hybrid sequence
uugauauGUUGGAUGAUGGAGu
ttaaggcCAGACTACTGCCCCt let-7b
Target on hcv 5a 
Binding site 7781-7802
mfe : -12.9
Hybrid sequence
uugguguGUUGGAUGAUGGAGu
ttaaggcCAGACTACTGCCCCt let-7b
Target on hcv 5a 
Binding site 2298-2320
mfe : -18.4
Hybrid sequence
uuGGUGUGUUGG-AUGAUGGAGU
ggCCATATTGCCGTGCTCCTTCA let-7b
Target on hcv 5a 
Binding site 7024-7051
mfe : -15.6
Hybrid sequence
UUGGU---G-UGUUGGA--UGAUGGAGU
AACAAGGTCGAGATCCTTGACTGCTTCA let-7b
Target on hcv 5a 
Binding site 7941-7963
mfe : -14.4
Hybrid sequence
uUGGUGUGUUGGAUGAUGG-AGU
tACCCCATTGCCGACAACCATCA let-7c
Target on hcv 5a 
Binding site 4146-4170
mfe : -13.3
Hybrid sequence
UUGG-UAUGUUGGAU--GAUGGAgu
AGCCGGTATAACATACTCTACTTat let-7c
Target on hcv 5a 
Binding site 7781-7802
mfe : -13.8
Hybrid sequence
uugguauGUUGGAUGAUGGAGu
ttaaggcCAGACTACTGCCCCt let-7c
Target on hcv 5a 
Binding site 8630-8652
mfe : -16.9
Hybrid sequence
UUG-GUA-UGUUGGAUGAUGGAGu
AGCTCGTAACATCTTGCT-CCTCg let-7f
Target on hcv 5a 
Binding site 7781-7802
mfe : -12.1
Hybrid sequence
uugauauGUUAGAUGAUGGAGu
ttaaggcCAGACTACTGCCCCt miR-100
Target on hcv 5a 
Binding site 1510-1535
mfe : -12.7
Hybrid sequence
guguUCAAGC--CUA--GAUGCCCaa
ttgcAGTTCGTAAATACCAACGGGag miR-10a
Target on hcv 5a 
Binding site 1747-1770
mfe : -15.4
Hybrid sequence
guguuuaagcCUAG-AUGUCCCAu
tatcccccacGACCGTGCGGGGTg miR-10a
Target on hcv 5a 
Binding site 6316-6334
mfe : -13.4
Hybrid sequence
GUGUUUAAGCCUAGAUG-UCCCAu
CAGAAG---GGG--TACAAGGGTg miR-10a
Target on hcv 5a 
Binding site 7718-7749
mfe : -13.1
Hybrid sequence
gUGUUUA--AGC--CU--AGAUGUC---CCAu
tACAAGTCCTCGACGACCACTACAGAGAGGTt miR-10a
Target on hcv 5a 
Binding site 5793-5818
mfe : -17.2
Hybrid sequence
GUGUUUAAGCC----UAG-AUGUCCCAU
CGCAG--TCGGTAACATCGGGCTGGGTA miR-10b
Target on hcv 5a 
Binding site 8831-8854
mfe : -12.4
Hybrid sequence
UGUUUAAG-C-CAAGAUGUCCCau
ACTTTTTCAGCGTTCTACAGAGcc miR-10b
Target on hcv 5a 
Binding site 628-645
mfe : -12.5
Hybrid sequence
uGUUUAAGCCAAGAUGUCCCAu
cCCAATTTGG----GTAGGGTc miR-10b
Target on hcv 5a 
Binding site 6315-6334
mfe : -12.5
Hybrid sequence
uGUUUAAGCCAAGAUG-UCCCAu
cCAGAAGGGG---TACAAGGGTg miR-10b
Target on hcv 5a 
Binding site 4844-4865
mfe : -14
Hybrid sequence
UGUUUAAGCCAAGAUGUCCCAU
ACGATGCCGGGTGTGCATGGTA miR-127
Target on hcv 5a 
Binding site 3105-3125
mfe : -13
Hybrid sequence
uCGGUUCGAGUCU-GCCUAGGcu
tGGTAGGCT--GACCGGAACCta miR-127
Target on hcv 5a 
Binding site 4085-4111
mfe : -15.32
Hybrid sequence
uCGGUUCGAGUCUG-----CCUAGGcu
tGTCAAGAGCATACGGCGTGGACCCca miR-127
Target on hcv 5a 
Binding site 7017-7041
mfe : -14.8
Hybrid sequence
uCGGUUCGAGU--CUGC-CUAGGcu
gGCTGAGAACAAGGTCGAGATCCtt miR-127
Target on hcv 5a 
Binding site 418-439
mfe : -16.1
Hybrid sequence
uCG-GUUCGAGUCUGCCUAGGCu
cGCGCGA-CTCGGAAGAATTCGg miR-129
Target on hcv 5a 
Binding site 5546-5573
mfe : -13.3
Hybrid sequence
CGUU-CGG---GUCUGG---CGUUUuuc
GCAAGGCCGAGCAGTTCTGGGCAAAgca miR-130b
Target on hcv 5a 
Binding site 9192-9214
mfe : -18
Hybrid sequence
uaCGGGAAAGUAGUAA-CGUGAC
caGCTGGTTCACCGTTGGCGCTG miR-133a
Target on hcv 5a 
Binding site 5300-5327
mfe : -15.54
Hybrid sequence
UGUCGA----CCAACU--UCCCCUGGUu
ACTGCTTGACGGTGGGCTCGGTGGCCAt miR-133a
Target on hcv 5a 
Binding site 1369-1388
mfe : -14.2
Hybrid sequence
uGUCGACCAACUUCCCCUGGUU
tCAAC-GGCTAACTGGG-CCAA miR-133b
Target on hcv 5a 
Binding site 9002-9034
mfe : -17.8
Hybrid sequence
AUCGACCAA-------CUU----CCCC-UGGuu
TGGCTAGTTGCCTCAGGAAGCTTGGGGTACCcc miR-147
Target on hcv 5a 
Binding site 638-655
mfe : -14.3
Hybrid sequence
CGUCUUCGUAAAGGUGUGug
GTAGGGTCA--TCCATACcc miR-147
Target on hcv 5a 
Binding site 5233-5260
mfe : -12.1
Hybrid sequence
CGUCU-----UC--GUAAAGGU-GUGug
GCAGACTTGGAGGTCATTACCAGCACtt miR-147
Target on hcv 5a 
Binding site 6808-6827
mfe : -12.9
Hybrid sequence
cGUCUUCGUAAAGGUGU-GUG
tCAG-ATCCCGCCCACATCAC miR-149
Target on hcv 5a 
Binding site 3391-3411
mfe : -12.8
Hybrid sequence
cCUCACUUCUGUGCCUCGGUcu
cGAG-GGGTACTGGGCGCCAta miR-149
Target on hcv 5a 
Binding site 7262-7283
mfe : -13.8
Hybrid sequence
cCUCACUUCUGUGCC-UCGGUcu
cGCG-GAGGAAAAGGAAGCCAat miR-149
Target on hcv 5a 
Binding site 4832-4854
mfe : -19
Hybrid sequence
ccuCACUU-CUGUGCCU-CGGUCu
tctGTGAGTGCTAC-GATGCCGGg miR-15b
Target on hcv 5a 
Binding site 2585-2608
mfe : -12.2
Hybrid sequence
acauuugGUACUACACGA--CGAu
gcctgctCGTTGTGTGCTTGGCTt miR-15b
Target on hcv 5a 
Binding site 7020-7049
mfe : -12.7
Hybrid sequence
ACAUUUG-----GUACUA--CAC-GACGAu
TGAGAACAAGGTCGAGATCCTTGACTGCTt miR-16
Target on hcv 5a 
Binding site 975-998
mfe : -14.32
Hybrid sequence
gCGGUUAUA--AAUGCACGACgau
aGATAATGTCAGTAGGTGCTGggt miR-17-3p
Target on hcv 5a 
Binding site 9094-9114
mfe : -15.7
Hybrid sequence
uguUCACGGAAGU-GACGUCa
ggtAGGGCCGCCATCTGCGGc miR-184
Target on hcv 5a 
Binding site 6056-6079
mfe : -13.1
Hybrid sequence
ugggaaUAGU--CAAGAGGCAGgu
ggggcaATCATGGGTCTCCGACac miR-184
Target on hcv 5a 
Binding site 2114-2143
mfe : -20.6
Hybrid sequence
UGGGAAUAGUCAA----G----AGGCAGGU
ACCCTTACCGGTTGTGGCATTACCCGTGCA miR-188
Target on hcv 5a 
Binding site 2865-2888
mfe : -20.8
Hybrid sequence
uGGGAGGUG--GUAC-GUUCCCuac
gCCC-CCGTTGCAGGTTAAGGGtgg miR-189
Target on hcv 5a 
Binding site 4730-4749
mfe : -12
Hybrid sequence
uGACUAUAGUCGAGUCAUCCgug
cCAGAAGCCAGC---GTAGGggc miR-189
Target on hcv 5a 
Binding site 3938-3963
mfe : -15
Hybrid sequence
ugacuaUAGUCGAG--UCA-UCCGUG
tccctcATGAGTTCCAAGTGGGGCAC miR-18a*
Target on hcv 5a 
Binding site 9280-9299
mfe : -12.1
Hybrid sequence
ucuuccUCGUGAAUCCCGUCa
ctacttAGCG-TAGGGGTAGg miR-193a
Target on hcv 5a 
Binding site 1206-1229
mfe : -14.7
Hybrid sequence
GAC-CCUGAAACAU--CCGGUcaa
CAGTGGCCATATTACCGGCCAccg miR-193b
Target on hcv 5a 
Binding site 541-564
mfe : -13.5
Hybrid sequence
UUUCGCCCUGAAACUCCCGGUCaa
AATGAAGGCCTCGGGTGGGCAGgg miR-196a
Target on hcv 5a 
Binding site 768-790
mfe : -13.8
Hybrid sequence
GGU-UGUUGU-ACUUUGAUGGau
CTATGCAACAGGGAATCTACCcg miR-196a
Target on hcv 5a 
Binding site 6475-6499
mfe : -17.1
Hybrid sequence
gGUUGUUGUACU---UUG-AUGGAu
aCAACAACAGGGCCCAGCGTACCTg miR-197
Target on hcv 5a 
Binding site 5860-5898
mfe : -20
Hybrid sequence
CGACC-------CACC------UCU--U-C-CACCACUU
GCTGGGGCGCTCGTCGCCTTCAAGATCATGTGTGGGGAA miR-198
Target on hcv 5a 
Binding site 8929-8954
mfe : -14.9
Hybrid sequence
gGAUAGAGGG-----GAG--ACCUGg
gCTATCATTCAAAGACTCCATGGACt miR-199a
Target on hcv 5a 
Binding site 5789-5811
mfe : -13.1
Hybrid sequence
CUUGUCCAUCAGAC-UUGUGACCC
GGGC-CGCAGTCGGTAACATCGGG