Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HCV 6a target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    
Subtypes1a  1b  2a  3a  4a  5a  6a  10a  11a 
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 3541 rescords (71 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7a91189140-12.5121
uuGAUAUGUUGGA-UGAUGGAGu
|||||:: | | ||||||
ggCTATATGCGGTAAGTACCTCt
11.678NO
2hsa-let-7c29082929-15.8121
uuGGUAUGUUGGAU-GAUGGAgu
|||| || |:|| :|||||
ctCCAT-CATCTTACTTACCTgc
11.774NO
3hsa-let-7c23772402-12.6121
uUGGUAU--GUUGGAUG--AUGGAGu
| |||| :|| |:| ||||||
gAACATAGTGGACGTGCAGTACCTCt
11.774NO
4hsa-let-7c37373755-16.2121
UUGGUAUGUUGGAUGAUGGAGu
|:||:|:| :|| || ||||
AGCCGTGCTGCC--CT-CCTCt
11.774NO
5hsa-let-7e818839-16.1121
ugauaUGUUG-GAGGAUGGAGU
|| || ||| |:|||||
ttggcACTACTCTCGTGCCTCA
6.037NO
6hsa-miR-150445064-13121
auGUAUGAAGAAAUGUAAGGU
|:||| || | :||| |||
cgCGTACCTCGTGGCATACCA
5.340NO
7hsa-miR-10016351658-13.7121
guGUUCAAGCCUA--GAUGCCCAa
| || ||||| ||:|| ||
gcCCAGAGCGGATGGCTGCGTGTa
9.137NO
8hsa-miR-10330423062-14.7121
aGUAUCGGGACAUGUUACG-ACGa
|||| :|||| | :||| |||
aCATACTCCTG--C-GTGCTTGCc
9.493NO
9hsa-miR-106a39723990-16.06121
CGAUGGACGUGACAUUCGUGaaaa
| ||||||||| ||||
GGTACCTGCAC-----GCACcaac
8.618NO
10hsa-miR-106b21392161-16.79121
uagaCGUGA--CAGUCGUGAAAu
||||| | ||||| |
tgtgGCACTACCCCTGCACTGTc
5.784NO
11hsa-miR-10b62256247-13.6121
uguuuaaGC-CAAGAUGUCCCAu
|| || || ||||
tacgcgaCGTGTGGGACTGGGTg
6.727NO
12hsa-miR-124a140165-12.4121
ACC--GUAAGUGGCG---CACGGAauu
||| || | |||| |||||
TGGATCAAAC-CCGCTCAATGCCTgga
5.000NO
13hsa-miR-124a42994326-14.8121
aCCG--UAAG-UGGCGC---ACGGAAUu
||| | | :||| | ||||||
aGGCTGAGACTGCCGGGGTTCGCCTTAc
5.000NO
14hsa-miR-125a20782103-13.1121
GUGUCCA-AUUU--CCCAGAGUCCCu
|| ||| |::| ||| | | |||
CAGCGGTGTGGATCGGGACCCTGGGt
10.086NO
15hsa-miR-125a32783300-17121
gUGUCCAAUUUCCCAGAGUCCCu
||| ||:|: |||||| ||
gACATTTTGAGTGGTCTCCCGGt
10.086NO
16hsa-miR-125a81868212-12.4121
guguCCAAUUUC--CCA-GAGU-CCCu
||| |||| ||| | || |||
tggcGGTCAAAGAAGGTGCCCATGGGc
10.086NO
17hsa-miR-12647544774-13.1121
cguaauaauGAGUGCCAUGCu
| ||||| :||
cgacgaggcCGCACGGGGCGg
10.720NO
18hsa-miR-12768536879-13.4121
UCGGUUCG--AG--UC-UGCCUAGGcu
||| :|| |: || | ||:|||
AGCACGGCGGTTAAAGAAGGGGTCCcc
5.000NO
19hsa-miR-12724622491-16.4121
ucGGUUC--GA--GUCU----GCCUAGGCu
|| :| || |||| |||||::|
ttCCTGGTTCTGGCAGATGCTCGGATTTGc
5.000NO
20hsa-miR-12727332757-15121
UCGGUUCG----AGUCUGCCUAGGCu
|| ||||| || |||| |:|
AG-CAAGCGGCATCCCTCGGAGCTGt
5.000NO
21hsa-miR-128a56325657-13.5121
uuuucuCUGGCC---AAGU-GACACu
| |||| || |||||
cactctGCCCGGCAACCCAGCTGTGg
5.472NO
22hsa-miR-128b56325657-13.5121
cuuucuCUGGCC---AAGU-GACACu
| |||| || |||||
cactctGCCCGGCAACCCAGCTGTGg
5.226NO
23hsa-miR-12980618080-17.1121
CGUUCGGGUCUGGCGUUUUUC
||: | | :| |:||:|:|||
GCGTG-CGGGTCTGCGAGAAG
5.000NO
24hsa-miR-133a34513472-17.06121
ugucgaCCAACUUCCCCUgguu
||| ||||||||
aaatgaGGTCGAAGGGGAggta
5.000NO
25hsa-miR-133a74777499-17.4121
ugucgaccAACUUCCCCU-GGuu
| ||:||||| ||
gccccctcTCGAGGGGGAGCCtg
5.000NO
26hsa-miR-133a65886612-13.1121
UGUCGACCA-ACUUC--CCCUGGUu
|| || | || :| |||::||
ACTGCCACTATGTGGTAGGGGTCAc
5.000NO
27hsa-miR-133b34523472-17.06121
aucgaCCAACUUCCCCUgguu
||| ||||||||
aatgaGGTCGAAGGGGAggta
NONO
28hsa-miR-133b74787499-15.7121
aucgaccAACUUCCCCU-GGuu
| ||:||||| ||
ccccctcTCGAGGGGGAGCCtg
NONO
29hsa-miR-133b36183647-12.4121
AUCGACCAACU--U-------CCCCUGGUU
|||: || ||: | |||| |||
TAGTAGGATGGCCATCTCCCCCGGGAGCAA
NONO
30hsa-miR-14063556379-14.1121
gauggUAUCCCAU----UUUGGUGA
| :||||: | ||||||
aggggACGGGGTGTGCCACACCACT
5.000NO
31hsa-miR-145583606-13.1121
uuCCCUAAGGACCCUUUUGACCug
| |: ||| || | |||||
ccGCGGCTCCCGGCCACACTGGgg
11.062NO
32hsa-miR-14963516374-17.9121
CCUCACUUCUGUGC--CUCGGUcu
||: |::|||: | | ||||
GGGCAGGGGACGGGGTGTGCCAca
5.000NO
33hsa-miR-15028602879-14.7121
GUGACCAUGUUC-CCAACCCUCu
|| ||||||| | | |||| |
CA-TGGTACACGAG--TGGGTGc
7.336NO
34hsa-miR-15418471869-13.7121
GCUUCCGUU-GUGCCUAU-UGGAu
|| :||||| | | ||| ||||
CG-GGGCAACCCCACATACACCTg
5.000NO
35hsa-miR-15b58355855-12.9121
ACAUUUGGUACUACACGA-CGau
||| ::: ||||||||| ||
TGTTGGT--TGATGTGCTCGCcg
9.090NO
36hsa-miR-1660056026-12.5121
GCGGUUAUAAAUGCACGACgau
||||| | | |||||
CGCCACGTTGGCCCTGCTGagg
11.196NO
37hsa-miR-181b327349-17121
GGGUGGCUGU-CGUUACUUACAa
|| |||| |: |||||:| ||
CCAACCGCCGCCCAATGGACGTc
6.484NO
38hsa-miR-181d56455670-15.4121
UUGGGUGG---CUGUUGUUACUUACAa
|||||| | |:|| || || ||||
AACCCAGCTGTGGCATCATTG-ATGTc
NONO
39hsa-miR-1832346-13.2121
GUCACUUAA-GAUGGUCACGGUAU
|| | :|| ||: ||||:|:||
CATGGCGTTAGTATGAGTGTCGTA
5.000NO
40hsa-miR-18854385460-20.72121
UGGGAGGUGGUACG-UUCCCuac
|:|| |:||| || :||||
ATCCCCTACCTCGCTGAGGGcca
5.000NO
41hsa-miR-18865876610-20.9121
ugGGAGGUGGUACG--UUCCCUAc
|: ||||:|||: ||||:|
gaCTGCCACTATGTGGTAGGGGTc
5.000NO
42hsa-miR-18881488168-17.7121
UGGGAGG--UGGUACGUUCCCUAC
||:| || |||| :|||| ||
ACTCCCCTAACCA---GAGGGTTG
5.000NO
43hsa-miR-18a66256654-18.21121
auagACGUGA----UCU----ACGUGGAau
||| || ||: |||:|||
aaagTGCCCTTGTCAGGTGCCTGCGCCTga
NONO
44hsa-miR-19155355555-12.42121
UC-GACGAAAACCCUAAGGCaac
|| ||||| | ||||||
AGCCTGCTGT--CCATTCCGcgt
NONO
45hsa-miR-193a547569-15.3121
gaccCUGAAA--CAUCCGGUCAA
|:|| | ||:||| :|||
cgaaGGCTGTGGGTGGGCAGGTT
NONO
46hsa-miR-19441284153-12.1121
AGGUGU-ACCUCA-AC--GACAAUGu
|||: | ||:|| | |||| ||
TCCGGACCGGGGTCAGAACTGTAACt
11.225NO
47hsa-miR-196a84218443-15.8121
GGUUGUUGUA--CUUUGAUGGAu
||| ||:||| ||||| |||
CCACCAGCATGGGAAACACCCTc
NONO
48hsa-miR-196b32493270-13.9121
GGUUGUUGU-CCUUUGAUGGau
|| : ::|: ||| |||:||
CCTGGGGCGCGGATACTGCCgc
NONO
49hsa-miR-19747664791-19.2121
cGACCCACCUC--UU--CCACCACuu
| ||| ||:| || | ||||
aCGGGGCGGGGTAAACCAGGGGTGta
6.957NO
50hsa-miR-19759655992-18.3121
CGACC-----CACCUCUUCCAC-CACuu
| ||| ||||:|: ||| |||
GGTGGCTCTCGTGGGGGTCGTGTGTGct
6.957NO
let-7a
Target on hcv 6a 
Binding site 9118-9140
mfe : -12.5
Hybrid sequence
uuGAUAUGUUGGA-UGAUGGAGu
ggCTATATGCGGTAAGTACCTCt let-7c
Target on hcv 6a 
Binding site 2908-2929
mfe : -15.8
Hybrid sequence
uuGGUAUGUUGGAU-GAUGGAgu
ctCCAT-CATCTTACTTACCTgc let-7c
Target on hcv 6a 
Binding site 2377-2402
mfe : -12.6
Hybrid sequence
uUGGUAU--GUUGGAUG--AUGGAGu
gAACATAGTGGACGTGCAGTACCTCt let-7c
Target on hcv 6a 
Binding site 3737-3755
mfe : -16.2
Hybrid sequence
UUGGUAUGUUGGAUGAUGGAGu
AGCCGTGCTGCC--CT-CCTCt let-7e
Target on hcv 6a 
Binding site 818-839
mfe : -16.1
Hybrid sequence
ugauaUGUUG-GAGGAUGGAGU
ttggcACTACTCTCGTGCCTCA miR-1
Target on hcv 6a 
Binding site 5044-5064
mfe : -13
Hybrid sequence
auGUAUGAAGAAAUGUAAGGU
cgCGTACCTCGTGGCATACCA miR-100
Target on hcv 6a 
Binding site 1635-1658
mfe : -13.7
Hybrid sequence
guGUUCAAGCCUA--GAUGCCCAa
gcCCAGAGCGGATGGCTGCGTGTa miR-103
Target on hcv 6a 
Binding site 3042-3062
mfe : -14.7
Hybrid sequence
aGUAUCGGGACAUGUUACG-ACGa
aCATACTCCTG--C-GTGCTTGCc miR-106a
Target on hcv 6a 
Binding site 3972-3990
mfe : -16.06
Hybrid sequence
CGAUGGACGUGACAUUCGUGaaaa
GGTACCTGCAC-----GCACcaac miR-106b
Target on hcv 6a 
Binding site 2139-2161
mfe : -16.79
Hybrid sequence
uagaCGUGA--CAGUCGUGAAAu
tgtgGCACTACCCCTGCACTGTc miR-10b
Target on hcv 6a 
Binding site 6225-6247
mfe : -13.6
Hybrid sequence
uguuuaaGC-CAAGAUGUCCCAu
tacgcgaCGTGTGGGACTGGGTg miR-124a
Target on hcv 6a 
Binding site 140-165
mfe : -12.4
Hybrid sequence
ACC--GUAAGUGGCG---CACGGAauu
TGGATCAAAC-CCGCTCAATGCCTgga miR-124a
Target on hcv 6a 
Binding site 4299-4326
mfe : -14.8
Hybrid sequence
aCCG--UAAG-UGGCGC---ACGGAAUu
aGGCTGAGACTGCCGGGGTTCGCCTTAc miR-125a
Target on hcv 6a 
Binding site 2078-2103
mfe : -13.1
Hybrid sequence
GUGUCCA-AUUU--CCCAGAGUCCCu
CAGCGGTGTGGATCGGGACCCTGGGt miR-125a
Target on hcv 6a 
Binding site 3278-3300
mfe : -17
Hybrid sequence
gUGUCCAAUUUCCCAGAGUCCCu
gACATTTTGAGTGGTCTCCCGGt miR-125a
Target on hcv 6a 
Binding site 8186-8212
mfe : -12.4
Hybrid sequence
guguCCAAUUUC--CCA-GAGU-CCCu
tggcGGTCAAAGAAGGTGCCCATGGGc miR-126
Target on hcv 6a 
Binding site 4754-4774
mfe : -13.1
Hybrid sequence
cguaauaauGAGUGCCAUGCu
cgacgaggcCGCACGGGGCGg miR-127
Target on hcv 6a 
Binding site 6853-6879
mfe : -13.4
Hybrid sequence
UCGGUUCG--AG--UC-UGCCUAGGcu
AGCACGGCGGTTAAAGAAGGGGTCCcc miR-127
Target on hcv 6a 
Binding site 2462-2491
mfe : -16.4
Hybrid sequence
ucGGUUC--GA--GUCU----GCCUAGGCu
ttCCTGGTTCTGGCAGATGCTCGGATTTGc miR-127
Target on hcv 6a 
Binding site 2733-2757
mfe : -15
Hybrid sequence
UCGGUUCG----AGUCUGCCUAGGCu
AG-CAAGCGGCATCCCTCGGAGCTGt miR-128a
Target on hcv 6a 
Binding site 5632-5657
mfe : -13.5
Hybrid sequence
uuuucuCUGGCC---AAGU-GACACu
cactctGCCCGGCAACCCAGCTGTGg miR-128b
Target on hcv 6a 
Binding site 5632-5657
mfe : -13.5
Hybrid sequence
cuuucuCUGGCC---AAGU-GACACu
cactctGCCCGGCAACCCAGCTGTGg miR-129
Target on hcv 6a 
Binding site 8061-8080
mfe : -17.1
Hybrid sequence
CGUUCGGGUCUGGCGUUUUUC
GCGTG-CGGGTCTGCGAGAAG miR-133a
Target on hcv 6a 
Binding site 3451-3472
mfe : -17.06
Hybrid sequence
ugucgaCCAACUUCCCCUgguu
aaatgaGGTCGAAGGGGAggta miR-133a
Target on hcv 6a 
Binding site 7477-7499
mfe : -17.4
Hybrid sequence
ugucgaccAACUUCCCCU-GGuu
gccccctcTCGAGGGGGAGCCtg miR-133a
Target on hcv 6a 
Binding site 6588-6612
mfe : -13.1
Hybrid sequence
UGUCGACCA-ACUUC--CCCUGGUu
ACTGCCACTATGTGGTAGGGGTCAc miR-133b
Target on hcv 6a 
Binding site 3452-3472
mfe : -17.06
Hybrid sequence
aucgaCCAACUUCCCCUgguu
aatgaGGTCGAAGGGGAggta miR-133b
Target on hcv 6a 
Binding site 7478-7499
mfe : -15.7
Hybrid sequence
aucgaccAACUUCCCCU-GGuu
ccccctcTCGAGGGGGAGCCtg miR-133b
Target on hcv 6a 
Binding site 3618-3647
mfe : -12.4
Hybrid sequence
AUCGACCAACU--U-------CCCCUGGUU
TAGTAGGATGGCCATCTCCCCCGGGAGCAA miR-140
Target on hcv 6a 
Binding site 6355-6379
mfe : -14.1
Hybrid sequence
gauggUAUCCCAU----UUUGGUGA
aggggACGGGGTGTGCCACACCACT miR-145
Target on hcv 6a 
Binding site 583-606
mfe : -13.1
Hybrid sequence
uuCCCUAAGGACCCUUUUGACCug
ccGCGGCTCCCGGCCACACTGGgg miR-149
Target on hcv 6a 
Binding site 6351-6374
mfe : -17.9
Hybrid sequence
CCUCACUUCUGUGC--CUCGGUcu
GGGCAGGGGACGGGGTGTGCCAca miR-150
Target on hcv 6a 
Binding site 2860-2879
mfe : -14.7
Hybrid sequence
GUGACCAUGUUC-CCAACCCUCu
CA-TGGTACACGAG--TGGGTGc miR-154
Target on hcv 6a 
Binding site 1847-1869
mfe : -13.7
Hybrid sequence
GCUUCCGUU-GUGCCUAU-UGGAu
CG-GGGCAACCCCACATACACCTg miR-15b
Target on hcv 6a 
Binding site 5835-5855
mfe : -12.9
Hybrid sequence
ACAUUUGGUACUACACGA-CGau
TGTTGGT--TGATGTGCTCGCcg miR-16
Target on hcv 6a 
Binding site 6005-6026
mfe : -12.5
Hybrid sequence
GCGGUUAUAAAUGCACGACgau
CGCCACGTTGGCCCTGCTGagg miR-181b
Target on hcv 6a 
Binding site 327-349
mfe : -17
Hybrid sequence
GGGUGGCUGU-CGUUACUUACAa
CCAACCGCCGCCCAATGGACGTc miR-181d
Target on hcv 6a 
Binding site 5645-5670
mfe : -15.4
Hybrid sequence
UUGGGUGG---CUGUUGUUACUUACAa
AACCCAGCTGTGGCATCATTG-ATGTc miR-183
Target on hcv 6a 
Binding site 23-46
mfe : -13.2
Hybrid sequence
GUCACUUAA-GAUGGUCACGGUAU
CATGGCGTTAGTATGAGTGTCGTA miR-188
Target on hcv 6a 
Binding site 5438-5460
mfe : -20.72
Hybrid sequence
UGGGAGGUGGUACG-UUCCCuac
ATCCCCTACCTCGCTGAGGGcca miR-188
Target on hcv 6a 
Binding site 6587-6610
mfe : -20.9
Hybrid sequence
ugGGAGGUGGUACG--UUCCCUAc
gaCTGCCACTATGTGGTAGGGGTc miR-188
Target on hcv 6a 
Binding site 8148-8168
mfe : -17.7
Hybrid sequence
UGGGAGG--UGGUACGUUCCCUAC
ACTCCCCTAACCA---GAGGGTTG miR-18a
Target on hcv 6a 
Binding site 6625-6654
mfe : -18.21
Hybrid sequence
auagACGUGA----UCU----ACGUGGAau
aaagTGCCCTTGTCAGGTGCCTGCGCCTga miR-191
Target on hcv 6a 
Binding site 5535-5555
mfe : -12.42
Hybrid sequence
UC-GACGAAAACCCUAAGGCaac
AGCCTGCTGT--CCATTCCGcgt miR-193a
Target on hcv 6a 
Binding site 547-569
mfe : -15.3
Hybrid sequence
gaccCUGAAA--CAUCCGGUCAA
cgaaGGCTGTGGGTGGGCAGGTT miR-194
Target on hcv 6a 
Binding site 4128-4153
mfe : -12.1
Hybrid sequence
AGGUGU-ACCUCA-AC--GACAAUGu
TCCGGACCGGGGTCAGAACTGTAACt miR-196a
Target on hcv 6a 
Binding site 8421-8443
mfe : -15.8
Hybrid sequence
GGUUGUUGUA--CUUUGAUGGAu
CCACCAGCATGGGAAACACCCTc miR-196b
Target on hcv 6a 
Binding site 3249-3270
mfe : -13.9
Hybrid sequence
GGUUGUUGU-CCUUUGAUGGau
CCTGGGGCGCGGATACTGCCgc miR-197
Target on hcv 6a 
Binding site 4766-4791
mfe : -19.2
Hybrid sequence
cGACCCACCUC--UU--CCACCACuu
aCGGGGCGGGGTAAACCAGGGGTGta miR-197
Target on hcv 6a 
Binding site 5965-5992
mfe : -18.3
Hybrid sequence
CGACC-----CACCUCUUCCAC-CACuu
GGTGGCTCTCGTGGGGGTCGTGTGTGct