Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HCV 4a target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    
Subtypes1a  1b  2a  3a  4a  5a  6a  10a  11a 
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 3501 rescords (71 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-let-7c215234-15.4121
uuGGUAUGUUGGAUGAUGGAgu
|| |:|:: ||||:|||
ggCCTTGCGG--TACTGCCTga
11.774NO
2hsa-let-7d31513172-12.8121
ugauaCGUUGG-AUGAUGGAGa
|| :|| ||| :||||
gattgGCCGCCTTACGGCCTCc
7.888NO
3hsa-let-7e23642386-12.4121
ugauauguUGGAGG--AUGGAGu
|| ||| ||||||
tatcgtggACGTCCAGTACCTCt
6.037NO
4hsa-let-7e26632681-17.7121
uGAUAUGUUGGAGGAUGGAGu
||:| : :|||||:|:||
cCTGTTT--TCTCCTGCTTCt
6.037NO
5hsa-let-7g659679-12.6121
uGACAUGUUUGAUGAUGGAGU
||| : | | ||||||
cCTGCGGCTTCGCCGACCTCA
9.988NO
6hsa-let-7i26262643-17.6121
uGUCGUGUUUGAUGAUGGAgu
|||| :||:||:|||
cCAGC---TGCTGCTGCCTac
7.883NO
7hsa-miR-10026352657-14.9121
guguucAAGCCU-AGAUGCCCaa
| || | ||:||||
gctgccTACGCAGCCTGCGGGct
9.137NO
8hsa-miR-106a21082134-14.1121
cgAUGGACGU----GACAUUCGUGAAaa
|||| |:| |||| :|||:||
atTACCCGTACCGGCTGT-GGCATTTcc
8.618NO
9hsa-miR-10732353255-15.8121
ACUAUCGGGACAUGUUACGACGa
||: :|| ||| ||| |||||
TGG-GGCGCTG-ACACCGCTGCg
9.255NO
10hsa-miR-122a929951-17.5121
UGUU--UGUGGUAACAGUGUGAGGU
|| | |||:|| || ||| :||||
ACCATCACATCA-TG-CACCTTCCA
12.384NO
11hsa-miR-122a50625082-17.4121
uGUUUGUGGUAACAGUGUGAGGU
| || ::| || | |:|||||
gCCAAGGTC--TGGCTCGCTCCA
12.384NO
12hsa-miR-124a71977224-14.02121
accGUAAGUG---GCGC---ACGGAauu
|:| ||| :||| |||||
gacCGTCCACGGTTGCGCTCTGCCTccg
5.000NO
13hsa-miR-124a62666286-13.6121
acCGUAAGUGGCGCAC-GGAAUU
||| | : |||| ||||||
aaGCA--AAGTTCGTGCCCTTAA
5.000NO
14hsa-miR-125a34023431-13121
GU-GUCCAAUUUCCC--A--GA--GUCCCU
|| || ||| | | | || ||||||
CACCATCGTAACGAGCCTCACTGGCAGGGA
10.086NO
15hsa-miR-12978267848-15.4121
cgUUCGGGUC--UGGCGUUUUUC
|||::|:| || | ||||||
caAAGTTCGGCTACGGGAAAAAG
5.000NO
16hsa-miR-130b89378957-14.1121
UACGGGAAAGUAGUAACGUGac
| || | |||| |: |||||
AAGCGCGTTCA-CGCTGCACgg
5.095NO
17hsa-miR-13276927718-15.8121
GCUGGU--A---CCGACAUCUGACAau
|||||: | ||: ||:||| ||
CGACCGCCTGCAGGTGGTGGACAGTac
5.000NO
18hsa-miR-133a27902809-19.1121
UGUCGACCAACUUCCCCUgguu
|::||||| | ||||||
ATGGCTGGCT--AGGGGAttgt
5.000NO
19hsa-miR-133a24012421-13.4121
uGUCGACCAACUUCCCCUGGuu
||| |||| ||| ||
gCAG-TGGTATCTTGGGCCCtt
5.000NO
20hsa-miR-133a74437465-16121
ugucgaccAACUUCCCCU-GGuu
| ||:||||| ||
gcctccacTAGAGGGGGAGCCcg
5.000NO
21hsa-miR-133a32473280-19121
UGUCGACCAAC------------UUCCCCUGGUu
|| |||| || |||||||::|
ACCGCTGCGTGCGGAGACATCATAAGGGGATTAc
5.000NO
22hsa-miR-133a19371967-12.81121
ugucgACCAACU--UC----CCC---UGGUU
||| ||| || ||| |||||
gcgtgTGGATGAACAGTACCGGGTTCACCAA
5.000NO
23hsa-miR-133b27912809-19.7121
AUCGACCAACUUCCCCUgguu
|:||||| | ||||||
TGGCTGGCT--AGGGGAttgt
NONO
24hsa-miR-133b74447465-16121
aucgaccAACUUCCCCU-GGuu
| ||:||||| ||
cctccacTAGAGGGGGAGCCcg
NONO
25hsa-miR-133b76727691-12.2121
auCGACCAACUUCCCCUGGuu
|| | ||||| ||||
cgGC-AGAAGAAGGTGACCtt
NONO
26hsa-miR-133b19381967-12.7121
aucgACCAACU--UC----CCC---UGGUU
||| ||| || ||| |||||
cgtgTGGATGAACAGTACCGGGTTCACCAA
NONO
27hsa-miR-133b90169045-14.8121
auCGAC---C-AACUUC-----CCCUGGUU
|||| | ||:|| ||| ||:|
ccGCTGAGAGCGTGGAGACATCGGGCCCGA
NONO
28hsa-miR-13659375965-17.9121
AGGUAGU-AGUUUUGU-----UUACCUCa
||:|||: |::|:|| ::|||||
TCTATCGCCCGGAGCATTGGTGGTGGAGg
7.279NO
29hsa-miR-13663026332-15121
AGG-UAGUA---GUUUU---GU-UUACCUCa
||| |||| |||:| :| || ||||
TCCTCTCATGGCCAAGAGGCTATAAGGGAGa
7.279NO
30hsa-miR-146a64916522-14.7121
uUGGGUA----C----CUU-AAG-UCAAGAGu
|||||| | ||| | | ||||| |
tACCCATCCCGGCTCCGAACTACAAGTTCGCg
NONO
31hsa-miR-14715921612-14.4121
cgucuUCGUA-AAGGUGUGug
||| | |||:||||
tggctAGCTTGTTCTACACcc
5.000NO
32hsa-miR-14777577775-12.8121
cGUCUUCGUAAAGGUGUGug
||| ||:: ||||:|
cCAG-AGTGAAGCCACGCtt
5.000NO
33hsa-miR-15370397056-15.9121
AGUGAAAACACUGAUACGUU
||| | ||||:||: ||||
TCA--TGTGTGGCTGAGCAA
7.150NO
34hsa-miR-15443764403-12.8121
gcuuCCGUUG-UGCC-----UAUUGGAu
| |||| |||| ||| |||
ccctGCCAACAACGGGGGAAATACCCTt
5.000NO
35hsa-miR-15464076434-12.1121
GCUUC-CGUUGUG---C--CUAUUGGAu
||| | | | ||| | || |||||
CGATGAGAATCACCGGGCCGAAAACCTg
5.000NO
36hsa-miR-17-5p725753-18.5121
ugauGGA-CGUG----ACAUUCGUGAAAC
||| |||| ||| || :|||||
gggcCCTGGCACATGGTGTCAGGGCTTTG
8.771NO
37hsa-miR-181c53035328-12.4121
ugAGU-GGCUGUC-CA--ACUUACAA
||| : |:||| || ||| ||||
ttTCAGTGGGCAGCGTAGTGATTGTT
8.945NO
38hsa-miR-182*21742193-12.1121
AUCAACCGUUCAGAUCUUGgu
| || ||| :|| ||||:|
TTGTCGGC-GGTATAGAGCat
5.173NO
39hsa-miR-182*73227341-20121
aucAACCGUUCAGAUCUUGGu
||||| ||| |||:||
cctTTGGCCAGT-CAGAGCCg
5.173NO
40hsa-miR-18391389162-14.3121
GUCACUUAA--GAUGGUCACGGUau
|| | ||| ||:||: |||||
CACTCCATTGCCTGCCGCTGCCAaa
5.000NO
41hsa-miR-18410001019-16.4121
uGGGAAUAGUCAAGA-GGCAGgu
|||||| | | || |||||
gCCCTTA-C--TCCTACCGTCgc
5.000NO
42hsa-miR-188960981-18.3121
uGGGAGGUGGUACGUUCCCUac
|||| |:: | |:||||
gCCCTGCGTGAGAGAGGGGAat
5.000NO
43hsa-miR-18817511770-24.3121
ugGGAGGUGGUACGUUCCCUAc
|||| :|||| : |||||
cgCCTCGGCCAT--GCGGGATt
5.000NO
44hsa-miR-18844184442-19.2121
uGGGAGG--UGGUAC--GUUCCCUAC
|||||: | | || ||||||: |
tCCCTCTGGAGC-TGATCAAGGGGGG
5.000NO
45hsa-miR-18914411460-15.5121
uGACUAUAGUCGAGUCAUCCGug
|||: : ||| |||| |||
tCTGG-GGCAG--CAGTCGGCcg
5.126NO
46hsa-miR-18932803302-18.9121
uGACUAUAGUCGAGUC-AUCCGUg
||| | ||:|| :| |:||||
cCTG-TTTCGGCCAGGTTGGGCAa
5.126NO
47hsa-miR-18a49394965-14.4121
aUAGACGU---GA---UCUACGUGGAAu
||||| | || ||| ||::|||
cATCTGGAATTCTGGGAGA-GCGTCTTt
NONO
48hsa-miR-191*83538375-14.6121
CCCCU-G-CUUUA-GGUUCGCGUcg
||| | | ||:|| :| |||||
GGGTATCGGAGATGTC--GCGCAac
NONO
49hsa-miR-191*65416564-12.8121
CCCCUGCUUUAGGUUC--GCGUCg
| |||| | :| |:| |||||
GAGGACTACGTGGAGGTTCGCAGa
NONO
50hsa-miR-193a59746005-20.4121
GACC-CUGAAA----------CAUCCGGUCaa
| || ||:||| ||:|||| |
CCGGCGATTTTGCGCCGCCACGTGGGCCCGgg
NONO
let-7c
Target on hcv 4a 
Binding site 215-234
mfe : -15.4
Hybrid sequence
uuGGUAUGUUGGAUGAUGGAgu
ggCCTTGCGG--TACTGCCTga let-7d
Target on hcv 4a 
Binding site 3151-3172
mfe : -12.8
Hybrid sequence
ugauaCGUUGG-AUGAUGGAGa
gattgGCCGCCTTACGGCCTCc let-7e
Target on hcv 4a 
Binding site 2364-2386
mfe : -12.4
Hybrid sequence
ugauauguUGGAGG--AUGGAGu
tatcgtggACGTCCAGTACCTCt let-7e
Target on hcv 4a 
Binding site 2663-2681
mfe : -17.7
Hybrid sequence
uGAUAUGUUGGAGGAUGGAGu
cCTGTTT--TCTCCTGCTTCt let-7g
Target on hcv 4a 
Binding site 659-679
mfe : -12.6
Hybrid sequence
uGACAUGUUUGAUGAUGGAGU
cCTGCGGCTTCGCCGACCTCA let-7i
Target on hcv 4a 
Binding site 2626-2643
mfe : -17.6
Hybrid sequence
uGUCGUGUUUGAUGAUGGAgu
cCAGC---TGCTGCTGCCTac miR-100
Target on hcv 4a 
Binding site 2635-2657
mfe : -14.9
Hybrid sequence
guguucAAGCCU-AGAUGCCCaa
gctgccTACGCAGCCTGCGGGct miR-106a
Target on hcv 4a 
Binding site 2108-2134
mfe : -14.1
Hybrid sequence
cgAUGGACGU----GACAUUCGUGAAaa
atTACCCGTACCGGCTGT-GGCATTTcc miR-107
Target on hcv 4a 
Binding site 3235-3255
mfe : -15.8
Hybrid sequence
ACUAUCGGGACAUGUUACGACGa
TGG-GGCGCTG-ACACCGCTGCg miR-122a
Target on hcv 4a 
Binding site 929-951
mfe : -17.5
Hybrid sequence
UGUU--UGUGGUAACAGUGUGAGGU
ACCATCACATCA-TG-CACCTTCCA miR-122a
Target on hcv 4a 
Binding site 5062-5082
mfe : -17.4
Hybrid sequence
uGUUUGUGGUAACAGUGUGAGGU
gCCAAGGTC--TGGCTCGCTCCA miR-124a
Target on hcv 4a 
Binding site 7197-7224
mfe : -14.02
Hybrid sequence
accGUAAGUG---GCGC---ACGGAauu
gacCGTCCACGGTTGCGCTCTGCCTccg miR-124a
Target on hcv 4a 
Binding site 6266-6286
mfe : -13.6
Hybrid sequence
acCGUAAGUGGCGCAC-GGAAUU
aaGCA--AAGTTCGTGCCCTTAA miR-125a
Target on hcv 4a 
Binding site 3402-3431
mfe : -13
Hybrid sequence
GU-GUCCAAUUUCCC--A--GA--GUCCCU
CACCATCGTAACGAGCCTCACTGGCAGGGA miR-129
Target on hcv 4a 
Binding site 7826-7848
mfe : -15.4
Hybrid sequence
cgUUCGGGUC--UGGCGUUUUUC
caAAGTTCGGCTACGGGAAAAAG miR-130b
Target on hcv 4a 
Binding site 8937-8957
mfe : -14.1
Hybrid sequence
UACGGGAAAGUAGUAACGUGac
AAGCGCGTTCA-CGCTGCACgg miR-132
Target on hcv 4a 
Binding site 7692-7718
mfe : -15.8
Hybrid sequence
GCUGGU--A---CCGACAUCUGACAau
CGACCGCCTGCAGGTGGTGGACAGTac miR-133a
Target on hcv 4a 
Binding site 2790-2809
mfe : -19.1
Hybrid sequence
UGUCGACCAACUUCCCCUgguu
ATGGCTGGCT--AGGGGAttgt miR-133a
Target on hcv 4a 
Binding site 2401-2421
mfe : -13.4
Hybrid sequence
uGUCGACCAACUUCCCCUGGuu
gCAG-TGGTATCTTGGGCCCtt miR-133a
Target on hcv 4a 
Binding site 7443-7465
mfe : -16
Hybrid sequence
ugucgaccAACUUCCCCU-GGuu
gcctccacTAGAGGGGGAGCCcg miR-133a
Target on hcv 4a 
Binding site 3247-3280
mfe : -19
Hybrid sequence
UGUCGACCAAC------------UUCCCCUGGUu
ACCGCTGCGTGCGGAGACATCATAAGGGGATTAc miR-133a
Target on hcv 4a 
Binding site 1937-1967
mfe : -12.81
Hybrid sequence
ugucgACCAACU--UC----CCC---UGGUU
gcgtgTGGATGAACAGTACCGGGTTCACCAA miR-133b
Target on hcv 4a 
Binding site 2791-2809
mfe : -19.7
Hybrid sequence
AUCGACCAACUUCCCCUgguu
TGGCTGGCT--AGGGGAttgt miR-133b
Target on hcv 4a 
Binding site 7444-7465
mfe : -16
Hybrid sequence
aucgaccAACUUCCCCU-GGuu
cctccacTAGAGGGGGAGCCcg miR-133b
Target on hcv 4a 
Binding site 7672-7691
mfe : -12.2
Hybrid sequence
auCGACCAACUUCCCCUGGuu
cgGC-AGAAGAAGGTGACCtt miR-133b
Target on hcv 4a 
Binding site 1938-1967
mfe : -12.7
Hybrid sequence
aucgACCAACU--UC----CCC---UGGUU
cgtgTGGATGAACAGTACCGGGTTCACCAA miR-133b
Target on hcv 4a 
Binding site 9016-9045
mfe : -14.8
Hybrid sequence
auCGAC---C-AACUUC-----CCCUGGUU
ccGCTGAGAGCGTGGAGACATCGGGCCCGA miR-136
Target on hcv 4a 
Binding site 5937-5965
mfe : -17.9
Hybrid sequence
AGGUAGU-AGUUUUGU-----UUACCUCa
TCTATCGCCCGGAGCATTGGTGGTGGAGg miR-136
Target on hcv 4a 
Binding site 6302-6332
mfe : -15
Hybrid sequence
AGG-UAGUA---GUUUU---GU-UUACCUCa
TCCTCTCATGGCCAAGAGGCTATAAGGGAGa miR-146a
Target on hcv 4a 
Binding site 6491-6522
mfe : -14.7
Hybrid sequence
uUGGGUA----C----CUU-AAG-UCAAGAGu
tACCCATCCCGGCTCCGAACTACAAGTTCGCg miR-147
Target on hcv 4a 
Binding site 1592-1612
mfe : -14.4
Hybrid sequence
cgucuUCGUA-AAGGUGUGug
tggctAGCTTGTTCTACACcc miR-147
Target on hcv 4a 
Binding site 7757-7775
mfe : -12.8
Hybrid sequence
cGUCUUCGUAAAGGUGUGug
cCAG-AGTGAAGCCACGCtt miR-153
Target on hcv 4a 
Binding site 7039-7056
mfe : -15.9
Hybrid sequence
AGUGAAAACACUGAUACGUU
TCA--TGTGTGGCTGAGCAA miR-154
Target on hcv 4a 
Binding site 4376-4403
mfe : -12.8
Hybrid sequence
gcuuCCGUUG-UGCC-----UAUUGGAu
ccctGCCAACAACGGGGGAAATACCCTt miR-154
Target on hcv 4a 
Binding site 6407-6434
mfe : -12.1
Hybrid sequence
GCUUC-CGUUGUG---C--CUAUUGGAu
CGATGAGAATCACCGGGCCGAAAACCTg miR-17-5p
Target on hcv 4a 
Binding site 725-753
mfe : -18.5
Hybrid sequence
ugauGGA-CGUG----ACAUUCGUGAAAC
gggcCCTGGCACATGGTGTCAGGGCTTTG miR-181c
Target on hcv 4a 
Binding site 5303-5328
mfe : -12.4
Hybrid sequence
ugAGU-GGCUGUC-CA--ACUUACAA
ttTCAGTGGGCAGCGTAGTGATTGTT miR-182*
Target on hcv 4a 
Binding site 2174-2193
mfe : -12.1
Hybrid sequence
AUCAACCGUUCAGAUCUUGgu
TTGTCGGC-GGTATAGAGCat miR-182*
Target on hcv 4a 
Binding site 7322-7341
mfe : -20
Hybrid sequence
aucAACCGUUCAGAUCUUGGu
cctTTGGCCAGT-CAGAGCCg miR-183
Target on hcv 4a 
Binding site 9138-9162
mfe : -14.3
Hybrid sequence
GUCACUUAA--GAUGGUCACGGUau
CACTCCATTGCCTGCCGCTGCCAaa miR-184
Target on hcv 4a 
Binding site 1000-1019
mfe : -16.4
Hybrid sequence
uGGGAAUAGUCAAGA-GGCAGgu
gCCCTTA-C--TCCTACCGTCgc miR-188
Target on hcv 4a 
Binding site 960-981
mfe : -18.3
Hybrid sequence
uGGGAGGUGGUACGUUCCCUac
gCCCTGCGTGAGAGAGGGGAat miR-188
Target on hcv 4a 
Binding site 1751-1770
mfe : -24.3
Hybrid sequence
ugGGAGGUGGUACGUUCCCUAc
cgCCTCGGCCAT--GCGGGATt miR-188
Target on hcv 4a 
Binding site 4418-4442
mfe : -19.2
Hybrid sequence
uGGGAGG--UGGUAC--GUUCCCUAC
tCCCTCTGGAGC-TGATCAAGGGGGG miR-189
Target on hcv 4a 
Binding site 1441-1460
mfe : -15.5
Hybrid sequence
uGACUAUAGUCGAGUCAUCCGug
tCTGG-GGCAG--CAGTCGGCcg miR-189
Target on hcv 4a 
Binding site 3280-3302
mfe : -18.9
Hybrid sequence
uGACUAUAGUCGAGUC-AUCCGUg
cCTG-TTTCGGCCAGGTTGGGCAa miR-18a
Target on hcv 4a 
Binding site 4939-4965
mfe : -14.4
Hybrid sequence
aUAGACGU---GA---UCUACGUGGAAu
cATCTGGAATTCTGGGAGA-GCGTCTTt miR-191*
Target on hcv 4a 
Binding site 8353-8375
mfe : -14.6
Hybrid sequence
CCCCU-G-CUUUA-GGUUCGCGUcg
GGGTATCGGAGATGTC--GCGCAac miR-191*
Target on hcv 4a 
Binding site 6541-6564
mfe : -12.8
Hybrid sequence
CCCCUGCUUUAGGUUC--GCGUCg
GAGGACTACGTGGAGGTTCGCAGa miR-193a
Target on hcv 4a 
Binding site 5974-6005
mfe : -20.4
Hybrid sequence
GACC-CUGAAA----------CAUCCGGUCaa
CCGGCGATTTTGCGCCGCCACGTGGGCCCGgg