Browse predicted human virus miRNA targets Browse predited mouse virus miRNA targets Browse predited rat virus miRNA targets Browse predited chicken virus miRNA targets
Predicted HCV 1a target of known human miRNA      Release 1.0: 2005
Run by miRanda, click to link to other liver virus : HAVHBV HCV HDVHEVHGV
Browse subtype    
Subtypes1a  1b  2a  3a  4a  5a  6a  10a  11a 
Browse relationship between conservation and target sites of subtypes.
mfe <=     score >=  
Rank by  score    mfe
  


Here just show
mfe<=-12
The miRNA expression : 5(low) - 12(high).

Total 3811 rescords (77 pages)previous   Page 1   next   
rankmiRNAtarget starttarget endmfescorehybridizatoinmiRNA expression
in liver
TargetScan
1hsa-miR-910701090-13.3121
aGUAUGUCGAUCUAUUGGUUUCU
| |||:|: |: ||||::||
cCCTACGGT--GGCCACCAGGGA
5.114NO
2hsa-let-7a59745995-20.6121
UUGAUAUGUUGGAUGAUGGagu
| ||: |||:|||||:||
ACCTGGTCAATCTACTGCCcgc
11.678NO
3hsa-let-7b22482273-16.9121
uuggUGUGUUGGA----UGAUGGAgu
|||||: || :||:|||
tcgaACACAGGCTGGAAGCTGCCTgc
11.726NO
4hsa-let-7c58075828-16.1121
uuGG-UAUGUUGGAUGAUGGAgu
|| :|:| : |||||:|||
ccCCGGTGCCG-CTACTGCCTtt
11.774NO
5hsa-let-7c26232649-14.8121
uugGUAUGUUGG---AU--GAUGGAGu
|: ||:::| || || ||||
ggaCGCACGGTCTTGTATCCTTCCTCg
11.774NO
6hsa-let-7e897921-13.82121
UGAUAU-GUUGGA---GGAUGGagu
|||:|: | :|:| ||||||
ACTGTGCCCGCTTCGGCCTACCaag
6.037NO
7hsa-let-7e65476565-14.6121
uGAUAUGUUGGAGGAUGGAgu
||:||| || ||| |||
cCTGTAC--CCCCCTTCCTgc
6.037NO
8hsa-let-7e20662088-12.5121
ugauaUGUUGGA-G-GAUGGAGU
||| ||| | ||:|| ||
caacaACACCCTGCACTGCCCCA
6.037NO
9hsa-let-7g897921-14.06121
UGACAUGUUUGA----UGAUGGagu
|||||:| :|| |||||
ACTGTGCCCGCTTCGGCCTACCaag
9.988NO
10hsa-let-7g35223542-19.8121
UGACAUGUUUGAUGAUGGagu
|:|||:: ||||:||:||
ATTGTGTCAACTGCTGCCcaa
9.988NO
11hsa-let-7g84648493-12.51121
uGACA----UGU-----UUGAUGAUGGAGU
|||| ||| | :|:|||| |||
gCTGTGGTAACACCCTCACTTGCTACATCA
9.988NO
12hsa-let-7i22492273-17.2121
ugUCGUGUUUGA----UGAUGGAgu
| ||||::|| :||:|||
cgAACACAGGCTGGAAGCTGCCTgc
7.883NO
13hsa-miR-10081888204-12.6121
GUGUUCAAGCCUAGAUGCCCAA
||| | ||| | :||||||
CACCA----GGA-CAGCGGGTT
9.137NO
14hsa-miR-106b17891809-12.12121
uagacgUGACAGUCGUGAaau
|||| ::|||||
gcccctACTGCTGGCACTacc
5.784NO
15hsa-miR-10a75267552-16121
guguuUAAGCCUAGA-----UGUCCCAu
|| ||||||| || ||||
tggggATCCGGATCTTAGCGAC-GGGTc
7.071NO
16hsa-miR-10b48374857-14.3121
UGUUUAAGCCAAGAUGUCCCau
|||:|||:| | || |||
ACAGATTTGTGGC-ACCGGGgg
6.727NO
17hsa-miR-124a199223-12.8121
ACCGUAAGU--GGCG---CACGGAauu
||| | ||| |||| |||||
TGG-A-TCAACCCGCTCAATGCCTgga
5.000NO
18hsa-miR-12737033724-13.5121
ucGGUUCGAGUCUGCCUAGGcu
|| || | :||| |||
caCCCTGCACTTGCGGCTCCtc
5.000NO
19hsa-miR-1279951021-13.3121
uCGGUUCGA-GUCUG----CCUAGGCu
|||| || || || ||:| ||
tGCCATCCTGCACACTCCGGGGTGCGt
5.000NO
20hsa-miR-12760746095-14.2121
uCGGUUCGAGUCUGCCUA---GGCu
|| ||: ||| :|||| |||
gGC--AGTGCAG-TGGATGAACCGg
5.000NO
21hsa-miR-12764556484-14.3121
uCGGUUCGAG-UCUG-----CCUAG--GCu
|:||| | :||| ||||| ||
tGTCAAAAACGGGACGATGAGGATCGTCGg
5.000NO
22hsa-miR-12771657186-14.2121
uCG-GUUC-GAGUCUGCCUAGGCu
|| ||| |||:|| |||:||
tGCGGAAGTCTCGGA--GATTCGc
5.000NO
23hsa-miR-12792219247-21.3121
uCGGUUCGA---GUCUGCCU----AGGCu
||| ||| ||| :||| ||||
gGCC--GCTGGCCAGCTGGACTTGTCCGg
5.000NO
24hsa-miR-128a66276648-12.5121
uuuuCUCUGGCCAAGUGA--CACU
|:|||: | |||| ||||
gtggGGGACT--TCCACTACGTGA
5.472NO
25hsa-miR-128b32733299-15.4121
cUUU--CUCUGG--CCA--AGUGACACu
||| |||||| | | |||| |||
cAAATGGAGACCAAGCTCATCAC-GTGg
5.226NO
26hsa-miR-12916121634-17.06121
CGU-UCGGGUC-UGGCGUUUUUc
||| :|||| | ||:|||| :|
GCACGGCCCTGAACTGCAATGAt
5.000NO
27hsa-miR-12934743500-14.7121
cGUUCGGGU---CUGG--C-GUUUUUc
| ||||:| |:|| | ||||||
aCCAGCCTAACTGGCCGGGACAAAAAc
5.000NO
28hsa-miR-12964806503-17.2121
CGUUCGGG--UCUGG-CGUUUUUc
|: :|:|| :|||| |||::||
GTCGGTCCTAGGACCTGCAGGAAc
5.000NO
29hsa-miR-130a44104442-16.9121
uACGGG--AAAAUUGU---------AACGUGAC
||||| | |||| |||| |||
gTGCCCCATCCCAACATCGAGGAGGTTGCTCTG
8.135NO
30hsa-miR-130b58485873-14.5121
uaCGG-GAAAGUAGU---AACGUGAC
||| | ||: || ||| ||||
gcGCCGCCATCGGCAGTGTTGGACTG
5.095NO
31hsa-miR-13262676292-14.42121
gCUGGUACC-----GACAUCUGACaau
|:|:| || ||| :|||||
tGGCTAAGGGACATCTG-GGACTGgat
5.000NO
32hsa-miR-133a58575881-17.36121
uGUCGAC-CAACUU--CCCCUgguu
|:|| | ||||:| |||||
tCGGCAGTGTTGGACTGGGGAaggt
5.000NO
33hsa-miR-133a48374862-15.9121
UGUC-GACCAACUU---CCCCUGGuu
|||| :| || | | ||||| |
ACAGATTTGTGGCACCGGGGGAGCgc
5.000NO
34hsa-miR-133a78987918-14121
ugUC-GACCAACUUCCCCUGGUU
|| :||||| | |||:| ||
caAGTTTGGTT--ATGGGGCAAA
5.000NO
35hsa-miR-133b90909116-15.2121
AUCG-ACCAACUUC-----CCCUGGuu
| || | |||:|| ||| ||
TTGCGAGCTTGGAGACACCGGGCCCgg
NONO
36hsa-miR-133b323-17.1121
aUCGACCAACUUCCCCUGGUu
||| ||| ||||:| |
cAGCCCCCTGATGGGGGCGAc
NONO
37hsa-miR-133b87288747-13121
auCGACCAACUUC-CCCUGGUu
||||| ||| ||| |:|
gcGCTGG--AAAGAGGGTCTAc
NONO
38hsa-miR-133b78997918-14.1121
aUC-GACCAACUUCCCCUGGUU
|| :||||| | |||:| ||
aAGTTTGGTT--ATGGGGCAAA
NONO
39hsa-miR-13412161233-12.7121
GGGAGACCAGUUGGUCAGUGu
||:||| || |||| |:|
CCTTCT-CTC--CCAGGCGCc
5.000NO
40hsa-miR-13828462862-14121
cuaaGUGUUGUGGUCGA
|:| |:|:|||||
caagCGCTATATCAGCT
5.000NO
41hsa-miR-14333123335-14.5121
acuCG-AUGUCAC-GAAGUAGagu
|| |:|:||| | |||||
gccGCGTGCGGTGACATCATCaac
10.136NO
42hsa-miR-142-3p61226144-12.21121
agguauuucauccUUUGUGAUGu
| :||||||
ccatgtttcccccACGCACTACg
9.468NO
43hsa-miR-14547954818-14.9121
uucccuaAGGACCCUUUUGACCug
|| || |::|||||
ctcaacgTCGGGGCAGGACTGGca
11.062NO
44hsa-miR-14558295850-15.6121
uuCCCUAAG-GACCCUUUUGACCug
||| | |||| |:||||
gtGGG---CGCTGGCTTAGCTGGcg
11.062NO
45hsa-miR-146a794816-13.9121
uuGGGUACCUUAAG-UCAAGAgu
| ||||| :| | :|||||
ggCGCATGGCGTCCGGGTTCTgg
NONO
46hsa-miR-146a27922811-12.2121
uuggguaCCUUAAGUCAAGAGu
|| :|| ||||||
gtgtggcGGTGTT--GTTCTCg
NONO
47hsa-miR-14716561680-14.54121
CGUCUUCGUAAA------GGUGUgug
|||| :|| ||| |||||
GCAG-GGCTTTTCTATCACCACAagt
5.000NO
48hsa-miR-14790079030-17.5121
cGUCUUCGUAA-----AGGUGUgug
||| ||||| ||||||
tCAG-CGCATTTTCACTCCACAgtt
5.000NO
49hsa-miR-148a22522279-15.9121
UGUUUCAAGACAU----C--ACG-UGACu
||| || ||| | | ||| ||||
ACACAG-GCTGGAAGCTGCCTGCAACTGg
NONO
50hsa-miR-148a60656086-16.1121
uguuucaagaCAUCACGUGACu
| |||||| ||
gggcgaggggGCAGTGCAGTGg
NONO
miR-9
Target on hcv 1a 
Binding site 1070-1090
mfe : -13.3
Hybrid sequence
aGUAUGUCGAUCUAUUGGUUUCU
cCCTACGGT--GGCCACCAGGGA let-7a
Target on hcv 1a 
Binding site 5974-5995
mfe : -20.6
Hybrid sequence
UUGAUAUGUUGGAUGAUGGagu
ACCTGGTCAATCTACTGCCcgc let-7b
Target on hcv 1a 
Binding site 2248-2273
mfe : -16.9
Hybrid sequence
uuggUGUGUUGGA----UGAUGGAgu
tcgaACACAGGCTGGAAGCTGCCTgc let-7c
Target on hcv 1a 
Binding site 5807-5828
mfe : -16.1
Hybrid sequence
uuGG-UAUGUUGGAUGAUGGAgu
ccCCGGTGCCG-CTACTGCCTtt let-7c
Target on hcv 1a 
Binding site 2623-2649
mfe : -14.8
Hybrid sequence
uugGUAUGUUGG---AU--GAUGGAGu
ggaCGCACGGTCTTGTATCCTTCCTCg let-7e
Target on hcv 1a 
Binding site 897-921
mfe : -13.82
Hybrid sequence
UGAUAU-GUUGGA---GGAUGGagu
ACTGTGCCCGCTTCGGCCTACCaag let-7e
Target on hcv 1a 
Binding site 6547-6565
mfe : -14.6
Hybrid sequence
uGAUAUGUUGGAGGAUGGAgu
cCTGTAC--CCCCCTTCCTgc let-7e
Target on hcv 1a 
Binding site 2066-2088
mfe : -12.5
Hybrid sequence
ugauaUGUUGGA-G-GAUGGAGU
caacaACACCCTGCACTGCCCCA let-7g
Target on hcv 1a 
Binding site 897-921
mfe : -14.06
Hybrid sequence
UGACAUGUUUGA----UGAUGGagu
ACTGTGCCCGCTTCGGCCTACCaag let-7g
Target on hcv 1a 
Binding site 3522-3542
mfe : -19.8
Hybrid sequence
UGACAUGUUUGAUGAUGGagu
ATTGTGTCAACTGCTGCCcaa let-7g
Target on hcv 1a 
Binding site 8464-8493
mfe : -12.51
Hybrid sequence
uGACA----UGU-----UUGAUGAUGGAGU
gCTGTGGTAACACCCTCACTTGCTACATCA let-7i
Target on hcv 1a 
Binding site 2249-2273
mfe : -17.2
Hybrid sequence
ugUCGUGUUUGA----UGAUGGAgu
cgAACACAGGCTGGAAGCTGCCTgc miR-100
Target on hcv 1a 
Binding site 8188-8204
mfe : -12.6
Hybrid sequence
GUGUUCAAGCCUAGAUGCCCAA
CACCA----GGA-CAGCGGGTT miR-106b
Target on hcv 1a 
Binding site 1789-1809
mfe : -12.12
Hybrid sequence
uagacgUGACAGUCGUGAaau
gcccctACTGCTGGCACTacc miR-10a
Target on hcv 1a 
Binding site 7526-7552
mfe : -16
Hybrid sequence
guguuUAAGCCUAGA-----UGUCCCAu
tggggATCCGGATCTTAGCGAC-GGGTc miR-10b
Target on hcv 1a 
Binding site 4837-4857
mfe : -14.3
Hybrid sequence
UGUUUAAGCCAAGAUGUCCCau
ACAGATTTGTGGC-ACCGGGgg miR-124a
Target on hcv 1a 
Binding site 199-223
mfe : -12.8
Hybrid sequence
ACCGUAAGU--GGCG---CACGGAauu
TGG-A-TCAACCCGCTCAATGCCTgga miR-127
Target on hcv 1a 
Binding site 3703-3724
mfe : -13.5
Hybrid sequence
ucGGUUCGAGUCUGCCUAGGcu
caCCCTGCACTTGCGGCTCCtc miR-127
Target on hcv 1a 
Binding site 995-1021
mfe : -13.3
Hybrid sequence
uCGGUUCGA-GUCUG----CCUAGGCu
tGCCATCCTGCACACTCCGGGGTGCGt miR-127
Target on hcv 1a 
Binding site 6074-6095
mfe : -14.2
Hybrid sequence
uCGGUUCGAGUCUGCCUA---GGCu
gGC--AGTGCAG-TGGATGAACCGg miR-127
Target on hcv 1a 
Binding site 6455-6484
mfe : -14.3
Hybrid sequence
uCGGUUCGAG-UCUG-----CCUAG--GCu
tGTCAAAAACGGGACGATGAGGATCGTCGg miR-127
Target on hcv 1a 
Binding site 7165-7186
mfe : -14.2
Hybrid sequence
uCG-GUUC-GAGUCUGCCUAGGCu
tGCGGAAGTCTCGGA--GATTCGc miR-127
Target on hcv 1a 
Binding site 9221-9247
mfe : -21.3
Hybrid sequence
uCGGUUCGA---GUCUGCCU----AGGCu
gGCC--GCTGGCCAGCTGGACTTGTCCGg miR-128a
Target on hcv 1a 
Binding site 6627-6648
mfe : -12.5
Hybrid sequence
uuuuCUCUGGCCAAGUGA--CACU
gtggGGGACT--TCCACTACGTGA miR-128b
Target on hcv 1a 
Binding site 3273-3299
mfe : -15.4
Hybrid sequence
cUUU--CUCUGG--CCA--AGUGACACu
cAAATGGAGACCAAGCTCATCAC-GTGg miR-129
Target on hcv 1a 
Binding site 1612-1634
mfe : -17.06
Hybrid sequence
CGU-UCGGGUC-UGGCGUUUUUc
GCACGGCCCTGAACTGCAATGAt miR-129
Target on hcv 1a 
Binding site 3474-3500
mfe : -14.7
Hybrid sequence
cGUUCGGGU---CUGG--C-GUUUUUc
aCCAGCCTAACTGGCCGGGACAAAAAc miR-129
Target on hcv 1a 
Binding site 6480-6503
mfe : -17.2
Hybrid sequence
CGUUCGGG--UCUGG-CGUUUUUc
GTCGGTCCTAGGACCTGCAGGAAc miR-130a
Target on hcv 1a 
Binding site 4410-4442
mfe : -16.9
Hybrid sequence
uACGGG--AAAAUUGU---------AACGUGAC
gTGCCCCATCCCAACATCGAGGAGGTTGCTCTG miR-130b
Target on hcv 1a 
Binding site 5848-5873
mfe : -14.5
Hybrid sequence
uaCGG-GAAAGUAGU---AACGUGAC
gcGCCGCCATCGGCAGTGTTGGACTG miR-132
Target on hcv 1a 
Binding site 6267-6292
mfe : -14.42
Hybrid sequence
gCUGGUACC-----GACAUCUGACaau
tGGCTAAGGGACATCTG-GGACTGgat miR-133a
Target on hcv 1a 
Binding site 5857-5881
mfe : -17.36
Hybrid sequence
uGUCGAC-CAACUU--CCCCUgguu
tCGGCAGTGTTGGACTGGGGAaggt miR-133a
Target on hcv 1a 
Binding site 4837-4862
mfe : -15.9
Hybrid sequence
UGUC-GACCAACUU---CCCCUGGuu
ACAGATTTGTGGCACCGGGGGAGCgc miR-133a
Target on hcv 1a 
Binding site 7898-7918
mfe : -14
Hybrid sequence
ugUC-GACCAACUUCCCCUGGUU
caAGTTTGGTT--ATGGGGCAAA miR-133b
Target on hcv 1a 
Binding site 9090-9116
mfe : -15.2
Hybrid sequence
AUCG-ACCAACUUC-----CCCUGGuu
TTGCGAGCTTGGAGACACCGGGCCCgg miR-133b
Target on hcv 1a 
Binding site 3-23
mfe : -17.1
Hybrid sequence
aUCGACCAACUUCCCCUGGUu
cAGCCCCCTGATGGGGGCGAc miR-133b
Target on hcv 1a 
Binding site 8728-8747
mfe : -13
Hybrid sequence
auCGACCAACUUC-CCCUGGUu
gcGCTGG--AAAGAGGGTCTAc miR-133b
Target on hcv 1a 
Binding site 7899-7918
mfe : -14.1
Hybrid sequence
aUC-GACCAACUUCCCCUGGUU
aAGTTTGGTT--ATGGGGCAAA miR-134
Target on hcv 1a 
Binding site 1216-1233
mfe : -12.7
Hybrid sequence
GGGAGACCAGUUGGUCAGUGu
CCTTCT-CTC--CCAGGCGCc miR-138
Target on hcv 1a 
Binding site 2846-2862
mfe : -14
Hybrid sequence
cuaaGUGUUGUGGUCGA
caagCGCTATATCAGCT miR-143
Target on hcv 1a 
Binding site 3312-3335
mfe : -14.5
Hybrid sequence
acuCG-AUGUCAC-GAAGUAGagu
gccGCGTGCGGTGACATCATCaac miR-142-3p
Target on hcv 1a 
Binding site 6122-6144
mfe : -12.21
Hybrid sequence
agguauuucauccUUUGUGAUGu
ccatgtttcccccACGCACTACg miR-145
Target on hcv 1a 
Binding site 4795-4818
mfe : -14.9
Hybrid sequence
uucccuaAGGACCCUUUUGACCug
ctcaacgTCGGGGCAGGACTGGca miR-145
Target on hcv 1a 
Binding site 5829-5850
mfe : -15.6
Hybrid sequence
uuCCCUAAG-GACCCUUUUGACCug
gtGGG---CGCTGGCTTAGCTGGcg miR-146a
Target on hcv 1a 
Binding site 794-816
mfe : -13.9
Hybrid sequence
uuGGGUACCUUAAG-UCAAGAgu
ggCGCATGGCGTCCGGGTTCTgg miR-146a
Target on hcv 1a 
Binding site 2792-2811
mfe : -12.2
Hybrid sequence
uuggguaCCUUAAGUCAAGAGu
gtgtggcGGTGTT--GTTCTCg miR-147
Target on hcv 1a 
Binding site 1656-1680
mfe : -14.54
Hybrid sequence
CGUCUUCGUAAA------GGUGUgug
GCAG-GGCTTTTCTATCACCACAagt miR-147
Target on hcv 1a 
Binding site 9007-9030
mfe : -17.5
Hybrid sequence
cGUCUUCGUAA-----AGGUGUgug
tCAG-CGCATTTTCACTCCACAgtt miR-148a
Target on hcv 1a 
Binding site 2252-2279
mfe : -15.9
Hybrid sequence
UGUUUCAAGACAU----C--ACG-UGACu
ACACAG-GCTGGAAGCTGCCTGCAACTGg miR-148a
Target on hcv 1a 
Binding site 6065-6086
mfe : -16.1
Hybrid sequence
uguuucaagaCAUCACGUGACu
gggcgaggggGCAGTGCAGTGg